ID: 946337668

View in Genome Browser
Species Human (GRCh38)
Location 2:219049413-219049435
Sequence GCAGCAGGTGTGACTCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946337656_946337668 29 Left 946337656 2:219049361-219049383 CCAGCTGGGCAGAAGGCCCAGCT No data
Right 946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG No data
946337655_946337668 30 Left 946337655 2:219049360-219049382 CCCAGCTGGGCAGAAGGCCCAGC No data
Right 946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG No data
946337663_946337668 12 Left 946337663 2:219049378-219049400 CCAGCTGGGGTAGATGGGATGTG No data
Right 946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG No data
946337662_946337668 13 Left 946337662 2:219049377-219049399 CCCAGCTGGGGTAGATGGGATGT No data
Right 946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946337668 Original CRISPR GCAGCAGGTGTGACTCAGGC CGG Intergenic
No off target data available for this crispr