ID: 946337904

View in Genome Browser
Species Human (GRCh38)
Location 2:219050571-219050593
Sequence CTGTAAGGCCAGCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946337898_946337904 21 Left 946337898 2:219050527-219050549 CCATGCCAGCAGTGAGTGGGGCT No data
Right 946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG No data
946337901_946337904 -4 Left 946337901 2:219050552-219050574 CCAAACAAAAGAGAGAAGGCTGT No data
Right 946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG No data
946337899_946337904 16 Left 946337899 2:219050532-219050554 CCAGCAGTGAGTGGGGCTTTCCA No data
Right 946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG No data
946337894_946337904 29 Left 946337894 2:219050519-219050541 CCAAAGAGCCATGCCAGCAGTGA No data
Right 946337904 2:219050571-219050593 CTGTAAGGCCAGCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946337904 Original CRISPR CTGTAAGGCCAGCTTGAGGA AGG Intergenic
No off target data available for this crispr