ID: 946339428

View in Genome Browser
Species Human (GRCh38)
Location 2:219058406-219058428
Sequence GCATGTGGCCCCCCATTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946339428_946339432 -4 Left 946339428 2:219058406-219058428 CCGCCCAATGGGGGGCCACATGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 946339432 2:219058425-219058447 ATGCAACGTCTTCCTCTGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 95
946339428_946339435 7 Left 946339428 2:219058406-219058428 CCGCCCAATGGGGGGCCACATGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 946339435 2:219058436-219058458 TCCTCTGCAAGGCGCAAAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 84
946339428_946339437 29 Left 946339428 2:219058406-219058428 CCGCCCAATGGGGGGCCACATGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 946339437 2:219058458-219058480 GCTGACAATCCCAGACCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 188
946339428_946339433 5 Left 946339428 2:219058406-219058428 CCGCCCAATGGGGGGCCACATGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 946339433 2:219058434-219058456 CTTCCTCTGCAAGGCGCAAAAGG 0: 1
1: 0
2: 0
3: 11
4: 109
946339428_946339434 6 Left 946339428 2:219058406-219058428 CCGCCCAATGGGGGGCCACATGC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 946339434 2:219058435-219058457 TTCCTCTGCAAGGCGCAAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946339428 Original CRISPR GCATGTGGCCCCCCATTGGG CGG (reversed) Intronic
902877994 1:19352575-19352597 CCACGTGGCCCCCCATGGGAGGG - Intronic
903338298 1:22639038-22639060 CCACGTTGCCCCCCATTGGGGGG - Exonic
917576073 1:176323031-176323053 ACATCTTGCCCCCCATAGGGTGG + Intergenic
923289805 1:232533424-232533446 CCAGGTGGCCCACCACTGGGCGG + Intronic
1063789442 10:9425426-9425448 CCAGGTGGCCCCCCATGGTGTGG - Intergenic
1070151281 10:73806725-73806747 GCATGTGGCTCCACATGTGGGGG + Exonic
1072064725 10:91855442-91855464 GCATGGTGCCCCACTTTGGGAGG - Intronic
1073053657 10:100685590-100685612 GGTGGTGGCCCCCCATTGTGTGG - Intergenic
1075664596 10:124221524-124221546 CCATGTGGCTACCCAGTGGGAGG + Intergenic
1078020096 11:7649863-7649885 GCATGTGTCTCCCCAGTGGAGGG - Intronic
1085181597 11:74541285-74541307 GCAGGGGGCCCCCCCATGGGAGG + Intronic
1088726985 11:112647793-112647815 GCATGTGGAGACCGATTGGGTGG + Intergenic
1089667160 11:120027724-120027746 GCTTGGGGCCCCCAAGTGGGTGG - Intergenic
1094474455 12:30830779-30830801 GCATGTGGCATCTCATTAGGGGG - Intergenic
1095943160 12:47739290-47739312 GCATGTGGCCCCTCCTTGGTTGG - Intronic
1096404342 12:51332475-51332497 GAAAGTGGCCTCCCATGGGGTGG + Intronic
1101293354 12:103394820-103394842 GCATGTAGCCCCACACTGGATGG - Intronic
1103514456 12:121498213-121498235 GCATGTGGGCCCCAAATGGCTGG + Intronic
1107293785 13:38888331-38888353 CCATGTGGCCCTCCATGGTGCGG - Intergenic
1107837117 13:44421099-44421121 GAAAGTGGCCCTCCATTGAGCGG - Intergenic
1113017431 13:105843622-105843644 GCATGTGGCATCCAATTTGGAGG + Intergenic
1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG + Intronic
1121251325 14:92501764-92501786 GTAGGTGGCCCCACATTGGAAGG + Intergenic
1122294591 14:100698135-100698157 GCATGTGGCCGGGCATTGAGGGG - Intergenic
1136516743 16:30773095-30773117 GCCTGTGGGACCCCTTTGGGAGG + Intronic
1137718167 16:50611504-50611526 GCATGTGGCAGCCCGTGGGGTGG + Intronic
1141558401 16:84851238-84851260 GCATGTGGACCCTCTTTGGAGGG - Intronic
1142593818 17:1019951-1019973 GCCTGTGGCCCACCTTGGGGAGG - Intronic
1144790091 17:17852955-17852977 GCATGTGGGTCCTCACTGGGGGG + Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150392756 17:64799745-64799767 GCCTGTGGCCCATCAGTGGGAGG + Intergenic
1151539953 17:74759744-74759766 GAATGGGGCAACCCATTGGGAGG - Intronic
1152154285 17:78622723-78622745 GCATGTGGCACCCCAGTGAGGGG - Intergenic
1152321505 17:79610712-79610734 GCATGGGACCCCGCAGTGGGAGG - Intergenic
1152904946 17:82965062-82965084 GCAGGTGCACCCCCATGGGGAGG + Intronic
1152904960 17:82965103-82965125 GCAGGTGCACCCCCATGGGGAGG + Intronic
1152905002 17:82965226-82965248 GCAGGTGCACCCCCATGGGGGGG + Intronic
1156480323 18:37432258-37432280 GCCTGTGCCCCCACATTGGCGGG - Intronic
1161794998 19:6381329-6381351 GCATGTGGCCCCCATATTGGAGG - Intronic
1166494188 19:43286680-43286702 TCATGTGGCCCCCCACTCAGAGG + Intergenic
927108581 2:19848201-19848223 GCAGGTAACCCCCCATTGGGTGG - Intergenic
930640449 2:53849402-53849424 GCATGAGGCCCATCATTGGGAGG - Intergenic
935919053 2:107989662-107989684 GCATGTGGCACAGCATGGGGCGG - Intronic
936639369 2:114294952-114294974 GCATGTGGCCCGACAGTGGAAGG + Intergenic
938072783 2:128317343-128317365 GAAGGTGGTCCCCCATCGGGTGG + Intronic
945100252 2:206256743-206256765 GCATTTAGCCCCACCTTGGGCGG + Intergenic
946339428 2:219058406-219058428 GCATGTGGCCCCCCATTGGGCGG - Intronic
947618982 2:231576570-231576592 GCTTGTGGCCCCTCATTTTGAGG - Intergenic
1180159722 21:45993621-45993643 GGATTTGGCTCCCCAGTGGGGGG + Intronic
1183320729 22:37163669-37163691 CCCTGAGGCCCCCCATTCGGGGG + Intronic
1184646885 22:45900707-45900729 GCATGTGGGACCGCATTTGGTGG + Intergenic
1185399709 22:50609526-50609548 TCATGTGGCTTCCCATTTGGTGG + Intronic
950486387 3:13276435-13276457 GCCTGTGGCCCCGCATTAGGTGG - Intergenic
950495103 3:13329011-13329033 GCAGGTGTCCCCTCCTTGGGAGG - Intronic
950531775 3:13556458-13556480 GGGTGGGGCCCCCCATTAGGAGG - Intronic
950817626 3:15722955-15722977 ACATCTGGCCCCCAATTGTGTGG - Intronic
952881099 3:37986807-37986829 GCATGTGTCCCCACATCTGGTGG - Intergenic
974875758 4:67701083-67701105 GCCTGTGGCCGCCCATCAGGGGG - Exonic
980248191 4:130275329-130275351 GCCTGTGGCTCCACAGTGGGTGG + Intergenic
985122325 4:186656334-186656356 GCATCTGGGCCCTCATTGAGTGG - Intronic
999308281 5:150534931-150534953 GCATGTGGCTCCACATGTGGGGG - Exonic
1006994540 6:38246088-38246110 TCCTGTGGACCCCCAGTGGGAGG - Intronic
1009538905 6:64925845-64925867 GCATGTGGGCCCCTAATGGTGGG + Intronic
1020081096 7:5286051-5286073 GCCTGTGGGACCCCATGGGGTGG + Intronic
1025197817 7:56946122-56946144 GCCTGTGGGACCCCATGGGGTGG - Intergenic
1025254946 7:57378266-57378288 TCATGTGGTCCCCCTTTTGGGGG + Intergenic
1025674131 7:63630816-63630838 GCCTGTGGGACCCCATGGGGTGG + Intergenic
1026019527 7:66696810-66696832 ACATCTGGCCCCCCATCTGGTGG + Intronic
1032501690 7:132404468-132404490 GCAGGTGGCCTCCCACTGGGTGG + Intronic
1036200927 8:6771211-6771233 CCCTGTGGCCTCCCATGGGGTGG + Intergenic
1039943098 8:42108045-42108067 GCATGTGTCCCCCTATGGAGAGG - Intergenic
1040832576 8:51694057-51694079 ACATGTTGCCTCCCATTGGTGGG - Intronic
1048195345 8:132327833-132327855 GCATGAAGCCCCCCATGGTGTGG + Intronic
1049372758 8:142275542-142275564 GCATGTGTCCTTCCTTTGGGTGG - Intronic
1049683566 8:143930419-143930441 GCAGGCGGCCCCGCATGGGGTGG + Exonic
1056294015 9:85173427-85173449 GCAGGTGGCACCCCCATGGGTGG + Intergenic
1056759636 9:89405430-89405452 GGATGTGCACCCCCATTAGGGGG - Exonic
1059607163 9:115845938-115845960 CCATGTGGGCCCCTTTTGGGTGG - Intergenic
1061895854 9:133647118-133647140 GAATGTGGCCCCCCAGGAGGAGG - Intronic
1062166474 9:135110196-135110218 TCATGTGGTCTCCCAGTGGGTGG - Intronic
1062359252 9:136179802-136179824 GCGTGTGTCCCCACACTGGGTGG + Intergenic
1194089472 X:89567203-89567225 TCCTGTGGCCCCCCACTGAGAGG + Intergenic
1200442132 Y:3223257-3223279 TCCTGTGGCCCCCCACTGAGAGG + Intergenic