ID: 946339758

View in Genome Browser
Species Human (GRCh38)
Location 2:219059736-219059758
Sequence GAAACTTTTCGGCACCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946339758_946339763 7 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339763 2:219059766-219059788 AAGGGGCACAGCTGTGCAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 297
946339758_946339767 20 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339767 2:219059779-219059801 GTGCAGAAGGTTAGGCCGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 161
946339758_946339768 21 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339768 2:219059780-219059802 TGCAGAAGGTTAGGCCGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 156
946339758_946339762 -10 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339762 2:219059749-219059771 GAAAAGTTTCAAAATGAAAGGGG 0: 1
1: 0
2: 6
3: 82
4: 747
946339758_946339766 17 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339766 2:219059776-219059798 GCTGTGCAGAAGGTTAGGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 195
946339758_946339764 12 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339764 2:219059771-219059793 GCACAGCTGTGCAGAAGGTTAGG 0: 1
1: 0
2: 1
3: 24
4: 201
946339758_946339765 16 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339765 2:219059775-219059797 AGCTGTGCAGAAGGTTAGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 217
946339758_946339769 30 Left 946339758 2:219059736-219059758 CCTCAGGGGTGCCGAAAAGTTTC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 946339769 2:219059789-219059811 TTAGGCCGGGAGGGACTGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946339758 Original CRISPR GAAACTTTTCGGCACCCCTG AGG (reversed) Intronic
902227175 1:15003792-15003814 GACATTTTACGGCACACCTGGGG - Intronic
908309451 1:62862978-62863000 GTAACTTTTCGGAATTCCTGTGG + Intronic
911583506 1:99662775-99662797 GACACTGTTCTGCACCCCCGGGG - Intronic
920044244 1:203123327-203123349 TAAACTTTTGTGCACCCGTGAGG + Intronic
920567057 1:206982424-206982446 GAAACATATGGTCACCCCTGGGG + Intergenic
1067938262 10:50629892-50629914 GAAACTTTGCTGCAGCTCTGAGG - Intergenic
1069633511 10:69911900-69911922 GAAACCTTCCTGCACCCCTCCGG + Intronic
1070328825 10:75404031-75404053 GAAAGTTCTCGGTACCCGTGCGG - Intergenic
1071472711 10:85995391-85995413 GAAACTCTTCCTCACCCCTAAGG - Intronic
1084645932 11:70457892-70457914 GAAAATTTTCATCACCCCAGAGG + Intergenic
1085266423 11:75240594-75240616 CAAACTTCTCGGCAGCCCGGAGG + Intergenic
1087614347 11:100471192-100471214 CCAACTTTTAGGCATCCCTGAGG + Intergenic
1088931330 11:114353519-114353541 GAAAGATTTCTGCACCCTTGAGG + Intergenic
1101337640 12:103810449-103810471 GAAACTTTTCACCACCCAAGGGG + Intronic
1102514864 12:113439707-113439729 GACACTTTGCTGCCCCCCTGTGG - Intergenic
1108837529 13:54570660-54570682 CAAACTTTTTGGCACCAGTGTGG + Intergenic
1111238208 13:85437003-85437025 GAAGCTCTTCAGCACCTCTGAGG + Intergenic
1112336663 13:98522300-98522322 GAAACTACCGGGCACCCCTGGGG - Intronic
1112662101 13:101521701-101521723 GATGCTCTTCGGCACTCCTGTGG - Intronic
1125452785 15:39826409-39826431 GTGACTTTTAAGCACCCCTGGGG - Intronic
1136745580 16:32587477-32587499 GAAACTTTTCCCCACCTTTGTGG + Intergenic
1137601099 16:49756796-49756818 GACACTTGTGAGCACCCCTGAGG + Intronic
1203047707 16_KI270728v1_random:846682-846704 GAAACTTTTCCCCACCTTTGTGG + Intergenic
1149495404 17:57114269-57114291 GAAAGTGTTCGACACCCCTGTGG - Intronic
1157035539 18:43968605-43968627 GGAGATTTTTGGCACCCCTGTGG + Intergenic
1166393628 19:42423786-42423808 GACGCTTTTCGCCACCCCCGGGG - Intronic
946339758 2:219059736-219059758 GAAACTTTTCGGCACCCCTGAGG - Intronic
947983122 2:234426693-234426715 GAAACTTTTGGGGACTTCTGGGG - Intergenic
948985850 2:241522729-241522751 GACACTTCTCCCCACCCCTGGGG + Intergenic
1172052862 20:32132476-32132498 CAAACCTTTCTGCACCCCTCAGG - Intronic
1175432080 20:58912384-58912406 GCTACTTTTCTGCACCCCCGTGG - Intergenic
1177713240 21:24807202-24807224 CAAACTTTTTGCCATCCCTGTGG + Intergenic
959849802 3:111072314-111072336 GAAACTTTTCGCCGCGCCCGGGG + Intronic
975258401 4:72267747-72267769 GAAACTTTCCAGGATCCCTGAGG + Intergenic
980110617 4:128633373-128633395 GAATCTTTTCCCCAACCCTGAGG - Intergenic
987509967 5:18824780-18824802 GATACTTTTTGGCAGCACTGGGG + Intergenic
994760736 5:103849831-103849853 GAAAATTTTCAGAACCACTGAGG + Intergenic
997377334 5:133406460-133406482 GAAAACTCTCGGCACCCCTCAGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1011495394 6:87932369-87932391 GAAGCTCTTTGGCTCCCCTGTGG - Intergenic
1020528074 7:9289822-9289844 GAAACATTTTTGCATCCCTGGGG + Intergenic
1021676601 7:23086273-23086295 GACATGTTTCAGCACCCCTGGGG + Intergenic
1030531816 7:110720454-110720476 GAAACTGTTCACCACCCCAGGGG + Intronic
1032982362 7:137299013-137299035 GAAAATATTCGTTACCCCTGGGG + Intronic
1052689510 9:31799765-31799787 GAAAATTTTCTGCACTCTTGGGG - Intergenic
1055120647 9:72656792-72656814 GAAACTTATCTGCATCCCGGAGG - Intronic
1058937241 9:109780402-109780424 GAAACTGATGGGCACCCCGGGGG - Exonic
1059484335 9:114615328-114615350 GATCCTTTGCGGCAACCCTGTGG + Intronic
1197088338 X:122506752-122506774 GAAAATTTGCAGCTCCCCTGGGG + Intergenic
1198427472 X:136534263-136534285 GAACCTTTCCAACACCCCTGAGG + Intronic
1200822864 Y:7606003-7606025 GAAATTGTTTGGCACCCATGTGG + Intergenic
1202237191 Y:22725086-22725108 GAAATTGTTTGGCACCCATGTGG - Intergenic