ID: 946342523

View in Genome Browser
Species Human (GRCh38)
Location 2:219080086-219080108
Sequence TAGGTTCCACATTTAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946342523_946342529 21 Left 946342523 2:219080086-219080108 CCTGGGTCTAAATGTGGAACCTA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 946342529 2:219080130-219080152 TTCCCCTTCTCAGAGAGATCTGG 0: 1
1: 0
2: 3
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946342523 Original CRISPR TAGGTTCCACATTTAGACCC AGG (reversed) Intronic
901857929 1:12056088-12056110 TAAGTTCCAGATTCAAACCCAGG - Intergenic
916139757 1:161685389-161685411 TACTTTCCACATTTAAACCCAGG + Intergenic
916848337 1:168676427-168676449 GAGGTTTCACACTTAGCCCCTGG + Intergenic
918877052 1:190061256-190061278 TAAGTTTTAAATTTAGACCCTGG + Intergenic
919769488 1:201148162-201148184 TAGGTTCCACATCTAAAAACAGG + Intronic
921393860 1:214647628-214647650 TAGGTGCCACATTAAAAACCTGG - Intronic
921654892 1:217723037-217723059 AATCTTCCACATATAGACCCAGG + Intronic
1063444298 10:6099690-6099712 CAGGTTCCACATCTAACCCCAGG - Intronic
1066930280 10:41749870-41749892 TAGGCTCCACATTTGGAGGCAGG + Intergenic
1080220907 11:29902326-29902348 TGGGTTCCAAATTTGTACCCAGG + Intergenic
1082949337 11:58794263-58794285 TTGGTGCCAATTTTAGACCCAGG + Intergenic
1086498103 11:87424827-87424849 TAGAATCCAGATTTAAACCCAGG + Intergenic
1090612554 11:128484382-128484404 TAGGATCTACAGTCAGACCCAGG + Intronic
1091519043 12:1217538-1217560 TCTGTTCCACATTTAGAGGCAGG - Intronic
1092081580 12:5720821-5720843 TAACTTCCTAATTTAGACCCTGG + Intronic
1092107259 12:5930647-5930669 TAGAATCAACATTTACACCCAGG + Intronic
1095376818 12:41540107-41540129 TAGGTTCTACATTTTGTCACTGG - Intronic
1096473262 12:51892304-51892326 TAGGTCCCACAGCTAGACACTGG + Intergenic
1102015411 12:109644953-109644975 TGGGGGCCACATTTAGGCCCTGG + Intergenic
1109761330 13:66833776-66833798 TAGTTTCCAGATTTAAACCTTGG + Intronic
1109828655 13:67756919-67756941 TAGGTTTAGCATTTAGATCCTGG + Intergenic
1116568759 14:46487732-46487754 CCGGGTCCACATTTGGACCCTGG + Intergenic
1117377028 14:55126347-55126369 CAGTTTTCACATTTGGACCCTGG - Intronic
1119392619 14:74301458-74301480 TAGGCTCTAGATTTAGATCCTGG - Intronic
1124093196 15:26625141-26625163 GAGCTTCCACATTGAGAGCCAGG - Intronic
1136687625 16:32004329-32004351 TAGGTTCCACCTCCAGACCTGGG - Intergenic
1136788234 16:32947880-32947902 TAGGTTCCACCTCCAGACCTGGG - Intergenic
1140764320 16:78141936-78141958 TAGTTTCCATTTCTAGACCCTGG + Intronic
1140852450 16:78947772-78947794 TAGGTTTCCAATTTAGCCCCTGG - Intronic
1143926544 17:10376430-10376452 CAGTTTCCCCATTTAGACCGTGG - Intergenic
1145923796 17:28631031-28631053 TAGGTTGCAGATTAAGTCCCTGG - Intronic
1149165711 17:53749581-53749603 TGGTTTCCACATTCAGTCCCTGG - Intergenic
1149526755 17:57362191-57362213 TTGGTTCCACATTCATTCCCTGG - Intronic
1160076337 18:75680998-75681020 TGTGTTCCACATTTAGAAGCTGG - Intergenic
1166809310 19:45506478-45506500 TTAGTTCCACATTTACACACGGG - Intergenic
925885553 2:8391419-8391441 CAGGTGCTCCATTTAGACCCAGG - Intergenic
929625567 2:43403385-43403407 GAGGTACCACATATAGAGCCTGG - Intronic
934764922 2:96875307-96875329 GAGAATCCACATTTAGTCCCCGG - Intergenic
941224024 2:162822475-162822497 TATGTTCCAGATTTGGACCTAGG + Intronic
944049158 2:195447342-195447364 GATGTTCCACATTTACACACAGG - Intergenic
944416633 2:199485844-199485866 TAGATTCCACATGTAGAACCTGG + Intergenic
945559946 2:211327533-211327555 TAGATTCCACATACACACCCAGG - Intergenic
946342523 2:219080086-219080108 TAGGTTCCACATTTAGACCCAGG - Intronic
947109851 2:226707176-226707198 TACAGTCCAGATTTAGACCCAGG + Intergenic
1172702096 20:36860001-36860023 TATGGTCCACATTTAGTCTCTGG + Intronic
950725870 3:14916641-14916663 AATGTTCCACATCTCGACCCAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955976280 3:64483465-64483487 TATGTTCAACATTTGGATCCTGG - Intergenic
956821336 3:72956997-72957019 TAGGTTCAACTTTCAGTCCCTGG + Intronic
958133375 3:89457954-89457976 AAGGCTCCACATTCAGAACCTGG - Intronic
961056044 3:123789579-123789601 TCATTTCCACCTTTAGACCCAGG - Intronic
961269790 3:125680279-125680301 CAGGTTCCACATGGACACCCAGG + Intergenic
963347992 3:144118890-144118912 CAGGGTCCAAATTTAGACCCAGG - Intergenic
964640111 3:158900196-158900218 CAGTTGCCACAGTTAGACCCTGG + Intergenic
967573151 3:191054986-191055008 TAGGTAGCACATTTAGATCATGG + Intergenic
967575844 3:191091209-191091231 TAGGTTACACATTGAGAGACAGG - Intergenic
968309650 3:197673042-197673064 TAGGTCCCAGATTCAGACCCAGG - Intronic
972849675 4:43033754-43033776 TAGCTTCAACATTTAGATCAGGG - Intergenic
973581910 4:52352422-52352444 TTGGTACCACTTTTAGACCCAGG + Intergenic
975190677 4:71457622-71457644 TAAGTTCCACATTAATACTCTGG + Intronic
978325478 4:107548949-107548971 TAGGTTGCAAATTTGGACCCTGG + Intergenic
978393963 4:108258268-108258290 TAGGATCCATATTTAGGGCCTGG - Intergenic
987913225 5:24177603-24177625 TAGTTTCCACATTTAACACCAGG + Intronic
988673732 5:33409731-33409753 TGGGTTCCACATTTTGACCTAGG + Intergenic
990271302 5:54142890-54142912 TAGGTTTTAAATTTAGACCTTGG + Intronic
995832877 5:116373155-116373177 CAGGTGCCACACTAAGACCCAGG + Intronic
998297744 5:140987724-140987746 CAGCTTCAAAATTTAGACCCAGG + Intronic
999313086 5:150565440-150565462 TAGGATAGACATATAGACCCTGG + Intergenic
999697644 5:154200603-154200625 TAGGTACCAAATTTAGAAACTGG - Intronic
1000408776 5:160916686-160916708 TAGATGCCAGATTTAAACCCAGG + Intergenic
1002895779 6:1379386-1379408 CAGGTTCCACTTTCAGAGCCAGG + Intergenic
1017976783 6:159365260-159365282 AAGGTTCCTCATTCAGAACCTGG + Intergenic
1022155550 7:27658953-27658975 TAGGGTCAACTTTTAGGCCCCGG + Intronic
1026502137 7:70951920-70951942 TAGCTCCCACATTTAGCTCCTGG - Intergenic
1030223508 7:107123679-107123701 TAGGTTGGACTTTTTGACCCTGG - Intronic
1031027037 7:116690726-116690748 TAGGTTGCACATTTAGATTTCGG + Intronic
1034303001 7:150032504-150032526 GAGATTTCACATGTAGACCCTGG + Intergenic
1034803046 7:154064764-154064786 GAGATTTCACATGTAGACCCTGG - Intronic
1046014329 8:108587841-108587863 TAGGATCCTTATTCAGACCCTGG + Intergenic
1047014086 8:120703852-120703874 TACTTTACACATTTAGAGCCAGG - Intronic
1047231982 8:123005329-123005351 AAGGTTCCACTTGGAGACCCAGG - Intergenic
1051246152 9:15113870-15113892 TAGATTTCACATTTAGTCCTCGG + Intergenic
1052643926 9:31207581-31207603 TAGGTTCCACATTTCTTCCCTGG - Intergenic
1053442348 9:38126853-38126875 TATGTTCCACATTTAAACAAAGG + Intergenic
1056558372 9:87708324-87708346 TGGTTTCCACATTTAGATCCTGG + Exonic
1057057721 9:91976786-91976808 AAGGTGACACATTTAGACCATGG - Intergenic
1060361570 9:122963691-122963713 AACGTTCCACCTTAAGACCCTGG + Intronic
1186120334 X:6354294-6354316 TAGGTTCTAGATTTAGATTCAGG + Intergenic
1187856575 X:23642615-23642637 TAGCCTCCACATGTAGACACTGG - Intergenic
1188103768 X:26123828-26123850 TAGATGCCACAGTTAGCCCCTGG + Intergenic
1194499511 X:94662949-94662971 TTGTTTCAAGATTTAGACCCTGG + Intergenic
1195687011 X:107596700-107596722 TACTTTACACATTCAGACCCCGG + Intronic
1196360986 X:114857841-114857863 TAGCTTTCACATTTAGGTCCAGG + Intronic
1198110595 X:133499502-133499524 GAGGTTCAACATTTAGATCTAGG + Intergenic
1200692379 Y:6319397-6319419 TAGCTTCCAAAGTTATACCCTGG - Intergenic
1201042893 Y:9855330-9855352 TAGCTTCCAAAGTTATACCCTGG + Intergenic
1202114056 Y:21453154-21453176 TAGCTTCCACAGATATACCCTGG + Intergenic
1202162959 Y:21954574-21954596 TAGCTTCCAAAATTATACCCTGG - Intergenic
1202228397 Y:22631794-22631816 TAGCTTCCAAAATTATACCCTGG + Intergenic
1202314760 Y:23564382-23564404 TAGCTTCCAAAATTATACCCTGG - Intergenic
1202556041 Y:26106211-26106233 TAGCTTCCAAAATTATACCCTGG + Intergenic