ID: 946345757

View in Genome Browser
Species Human (GRCh38)
Location 2:219109219-219109241
Sequence GGCAACTGGATAATATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946345748_946345757 11 Left 946345748 2:219109185-219109207 CCAGTCTTTTCCTTCTCATTTTG 0: 1
1: 0
2: 5
3: 76
4: 860
Right 946345757 2:219109219-219109241 GGCAACTGGATAATATGCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 93
946345752_946345757 1 Left 946345752 2:219109195-219109217 CCTTCTCATTTTGGGGTTCATTT 0: 1
1: 0
2: 6
3: 32
4: 450
Right 946345757 2:219109219-219109241 GGCAACTGGATAATATGCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946345757 Original CRISPR GGCAACTGGATAATATGCCA GGG Intronic
904374678 1:30073041-30073063 GACAATTGGAGAATATCCCAGGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906823327 1:48951955-48951977 AGAAGCTGGATAATTTGCCAAGG + Intronic
908065561 1:60400251-60400273 TGCAACAGGAAAATATGTCATGG - Intergenic
909682216 1:78304672-78304694 GGATACTTGATGATATGCCAGGG - Intronic
911099531 1:94083998-94084020 GGCAATTGGAGAATCTGCAAGGG - Intronic
912757221 1:112334411-112334433 GGCCACTGGATAATATGCAGTGG - Intergenic
918613587 1:186519062-186519084 GGTAACTGGATAAAATACAACGG - Intergenic
918870298 1:189963892-189963914 GGTAACTGGAACATATGCAATGG - Intergenic
921550711 1:216532242-216532264 AGCAGCTGGTTAAGATGCCATGG + Intronic
1063536805 10:6891506-6891528 GGCAAATGAATAAGCTGCCAGGG - Intergenic
1067221205 10:44345638-44345660 GGCTACTGTAAAAAATGCCATGG + Intergenic
1071212825 10:83364428-83364450 TTCAACTGGATAATATGGGAAGG - Intergenic
1071966233 10:90856295-90856317 GTCAACTGCATAATATTTCAAGG + Intronic
1073989334 10:109244807-109244829 GGAAAATGGATAAAATGCCCAGG - Intergenic
1074559196 10:114519909-114519931 TGAAACTGGATTATGTGCCAAGG + Intronic
1078294046 11:10047514-10047536 GTCCACTGGATTATATGCCAGGG - Intronic
1078567105 11:12425643-12425665 GGTAACTAGATAATATGACAAGG - Intronic
1085820133 11:79783482-79783504 GGAAACTGGAAACCATGCCAGGG - Intergenic
1088075246 11:105840459-105840481 GGGAACTTTATAATATGGCAGGG + Intronic
1089642222 11:119855290-119855312 GGAAACTTAATAACATGCCAGGG + Intergenic
1092784712 12:12016764-12016786 GGCTGCTGGAGAAGATGCCAGGG - Intergenic
1094427526 12:30330536-30330558 GGCAACTGGGTTAGAGGCCATGG + Intergenic
1096392641 12:51241001-51241023 ACCGACTGGATAATAAGCCATGG - Exonic
1097618245 12:61908815-61908837 GAGAACTATATAATATGCCATGG + Intronic
1097941268 12:65308845-65308867 GGAAACTGGACAATGTTCCAAGG - Intronic
1098968505 12:76822021-76822043 GGCAACTTGATATTATAGCAAGG + Intronic
1099351247 12:81571599-81571621 GTCAACTGGTTAATATGCATGGG + Intronic
1100589462 12:96012312-96012334 GGCAACAAGAGAACATGCCATGG + Intronic
1101303067 12:103501559-103501581 AGCAACAGGAAAATATGACATGG - Intergenic
1102755486 12:115336062-115336084 GGCAACTGGAAACTGTGCCAGGG + Intergenic
1106218644 13:27725626-27725648 CGCAACTTGAAAACATGCCATGG - Intergenic
1124803204 15:32855364-32855386 GGAAACTGGATCTTATGACAGGG - Intronic
1125609136 15:40959040-40959062 GTCCACTGGATGAAATGCCAGGG + Intergenic
1129866710 15:78914454-78914476 GACAACTGGAGCACATGCCAGGG - Intergenic
1132252804 15:100346934-100346956 TGAAACTGGATCACATGCCATGG - Intergenic
1133862293 16:9607468-9607490 GGCTACTGGATTCTAAGCCAGGG - Intergenic
1137782203 16:51107210-51107232 GGCCACTGGTGAATATGGCAAGG + Intergenic
1138219721 16:55240394-55240416 TGCACCTGGAAAATATGCCCAGG + Intergenic
1139398548 16:66661050-66661072 GGCAACTGGACACTATCCAAAGG + Intronic
1146464309 17:33074233-33074255 GGCTACTGTAGAAAATGCCAGGG - Intronic
1147938670 17:44029465-44029487 GGCAGCTGGATAACAAGCCTGGG - Intergenic
1148255366 17:46126522-46126544 GGGTTCTGGATAATATGTCAAGG + Intronic
1149243208 17:54675344-54675366 GCCAACTGGATAATCTACAAAGG + Intergenic
1150018901 17:61590338-61590360 GGAAACTGAAGAATAAGCCAGGG + Intergenic
1153710587 18:7794796-7794818 GGCATCTATTTAATATGCCAGGG + Intronic
1158410137 18:57198437-57198459 GGCAACAGGACAATATGGCAAGG - Intergenic
1159009863 18:63048503-63048525 TGCAACGGGATAAAATTCCATGG - Intergenic
928862287 2:35873955-35873977 TGCAACTGAATAAGATGACATGG + Intergenic
935726197 2:106026158-106026180 GGCAGCTGGCCAATATCCCACGG - Intergenic
943175629 2:184469703-184469725 TCTAACTGTATAATATGCCAAGG - Intergenic
944696085 2:202201602-202201624 ACCAACTGGATAATAAGCCATGG + Intergenic
945818232 2:214631801-214631823 GGCAACTGTATAATTGTCCAAGG - Intergenic
946345757 2:219109219-219109241 GGCAACTGGATAATATGCCAGGG + Intronic
946618977 2:221540667-221540689 TGCAACTGGATAACCAGCCAGGG + Intronic
946783384 2:223216780-223216802 GGCACATGGATATAATGCCATGG - Intergenic
946944597 2:224807716-224807738 TGCTCCTGGACAATATGCCAAGG - Exonic
1183918102 22:41139827-41139849 GGCTACTTGATACTATGACAAGG + Intronic
1184842322 22:47059218-47059240 GGCACCTGGATTTTCTGCCAGGG + Intronic
953084337 3:39652284-39652306 GGGAAATGGATAAAATTCCAGGG - Intergenic
953704137 3:45218624-45218646 GGCATCTTGATAACATGCCAAGG - Intergenic
954630081 3:52043359-52043381 GGCAGGTGGAGAATATTCCAGGG + Intergenic
958171735 3:89947593-89947615 GGCCACTGGATAATGTTACAGGG - Intergenic
959314313 3:104783092-104783114 GCCAACAGAATAAGATGCCATGG - Intergenic
960160419 3:114344120-114344142 GGCAACAGGATCACATCCCAGGG - Intronic
967353232 3:188538412-188538434 TACAAGTGGATAATATGCCTAGG + Intronic
969067388 4:4497264-4497286 GATTACTGGACAATATGCCAAGG + Intronic
970814524 4:20138411-20138433 TGCAACTGGATAAGAGGCTATGG - Intergenic
972745042 4:41924369-41924391 GGCAACTGGTGAGTCTGCCATGG + Intergenic
974594347 4:63997152-63997174 GGCATCTGGATAAAATCCAACGG + Intergenic
975765921 4:77667455-77667477 GGCAACTGGATACTCTGCCCAGG + Intergenic
977191410 4:94005434-94005456 GGAAACTGGATATTATGCAATGG + Intergenic
977932132 4:102760794-102760816 GGCAACTGGAGCATCTGCAATGG - Exonic
979645615 4:123064277-123064299 GGAAAATGGATAATATGATAGGG + Intronic
981153575 4:141407736-141407758 GGCACCTCCATAATATGACAGGG + Intergenic
984016027 4:174427902-174427924 GGCAACTGGAAACTGTGTCAGGG + Intergenic
987074478 5:14367850-14367872 GGCATCTGTATACTGTGCCAAGG + Intronic
988769041 5:34412507-34412529 ACCAACAGGATAATTTGCCAAGG + Intergenic
990717834 5:58658502-58658524 GCCTACTGGAAATTATGCCATGG + Intronic
991104482 5:62828878-62828900 GGAAGCTGGATCATATGCAAAGG - Intergenic
992565917 5:77995001-77995023 GCCAACTGGCTATGATGCCAGGG - Intergenic
998739245 5:145180117-145180139 GGCAACTAGATAATATGACAGGG - Intergenic
999323103 5:150626718-150626740 GGATACTGGATAAAATGCCACGG - Intronic
999576016 5:152978301-152978323 GGCAACTGGAAACAAGGCCAAGG - Intergenic
1003485941 6:6579755-6579777 GACTCCTGCATAATATGCCAGGG - Intergenic
1007838053 6:44691718-44691740 CAAAACTGGCTAATATGCCATGG - Intergenic
1017462382 6:154663485-154663507 GGCAAATGGAAAATATGGGAAGG - Intergenic
1017541345 6:155406044-155406066 GGCAACTGGAGCATGTGCCAAGG - Intronic
1019037626 6:169074756-169074778 GGCAGCTTGAGAATAAGCCAGGG + Intergenic
1020514853 7:9105749-9105771 GCCCACTGAATAATATTCCATGG - Intergenic
1026445073 7:70477217-70477239 GGCAACTGAAAAATATGGCTGGG - Intronic
1036114996 8:5949411-5949433 TGAAACTGGATAATATGTAAAGG - Intergenic
1037013542 8:13875053-13875075 GACATCTGGATAATGTACCATGG + Intergenic
1037186956 8:16076180-16076202 TTCAACTGCATAATATTCCATGG - Intergenic
1037220392 8:16512562-16512584 GGCAACTGCATGAAATGGCATGG + Intronic
1039263768 8:35802435-35802457 GGCAACTAGAGAATATGTCGGGG + Intergenic
1051714833 9:19971604-19971626 GTCAATTGGATGATATGGCAGGG + Intergenic
1053750701 9:41251532-41251554 GACAACCAGGTAATATGCCATGG + Intergenic
1060871395 9:127044154-127044176 GGTAAATGGATAATAAACCATGG + Intronic
1062572332 9:137191408-137191430 GGCAACAGGTTAACAGGCCATGG + Intergenic
1186164178 X:6809168-6809190 GGCAACTTGAAGACATGCCAAGG - Intergenic
1188351272 X:29134032-29134054 TGCTACTGAATAATATTCCATGG + Intronic
1198135562 X:133746332-133746354 AGCAACTGGCGATTATGCCAAGG + Intronic
1198941898 X:141965332-141965354 TGGAACTGGGTAATAGGCCAAGG + Intergenic
1199412495 X:147540701-147540723 GGCAATTGGATAGTATTCTATGG + Intergenic
1201558302 Y:15288101-15288123 GGCAACTTGAAGACATGCCAAGG - Intergenic