ID: 946348780

View in Genome Browser
Species Human (GRCh38)
Location 2:219133868-219133890
Sequence TCCCCTTGGCTCAACTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946348775_946348780 6 Left 946348775 2:219133839-219133861 CCACAAATCCCACAGAAAGAACT 0: 1
1: 0
2: 2
3: 45
4: 449
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146
946348771_946348780 24 Left 946348771 2:219133821-219133843 CCCATCCCTTCATGACATCCACA 0: 1
1: 0
2: 2
3: 11
4: 213
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146
946348772_946348780 23 Left 946348772 2:219133822-219133844 CCATCCCTTCATGACATCCACAA 0: 1
1: 0
2: 0
3: 18
4: 306
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146
946348773_946348780 19 Left 946348773 2:219133826-219133848 CCCTTCATGACATCCACAAATCC 0: 1
1: 0
2: 0
3: 21
4: 314
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146
946348776_946348780 -2 Left 946348776 2:219133847-219133869 CCCACAGAAAGAACTAATCCTTC 0: 1
1: 0
2: 3
3: 30
4: 296
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146
946348774_946348780 18 Left 946348774 2:219133827-219133849 CCTTCATGACATCCACAAATCCC 0: 1
1: 0
2: 1
3: 17
4: 236
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146
946348777_946348780 -3 Left 946348777 2:219133848-219133870 CCACAGAAAGAACTAATCCTTCC 0: 1
1: 0
2: 8
3: 59
4: 432
Right 946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG 0: 1
1: 0
2: 2
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946348780 Original CRISPR TCCCCTTGGCTCAACTCCAC AGG Intronic
902322681 1:15679656-15679678 TCCCCTTGGCTTCATTGCACTGG + Intergenic
904497433 1:30895090-30895112 TCCCCCTGCCTCAGCTCCAGGGG - Intronic
904616649 1:31753650-31753672 TCCCCTTGTCTCCTCCCCACTGG - Intronic
906743547 1:48205906-48205928 TCTCCTTGGCTCAATTCCTATGG + Intergenic
907958962 1:59260558-59260580 TCCCATTGGCTGAACTCAACTGG - Intergenic
909055955 1:70821441-70821463 TCCCCTTGGCTCAATTCCCCAGG + Intergenic
916989906 1:170231788-170231810 TCCCTTTGGCCCAACCCAACTGG - Intergenic
921637365 1:217512212-217512234 TCCCCTGGCCTCAGCTCCACAGG - Intronic
1063881685 10:10538281-10538303 TGCCATTGGCTGAACTCAACTGG + Intergenic
1065916455 10:30357953-30357975 TCCCCTTGGCTGAACAGCATAGG - Intronic
1067429158 10:46231472-46231494 TCACATTGGCTAAACTCCAAAGG + Intergenic
1069753223 10:70758083-70758105 CCCCTCTGGCTCACCTCCACAGG - Exonic
1070153230 10:73818112-73818134 TTCCCACTGCTCAACTCCACAGG + Intronic
1070396982 10:76019989-76020011 TCCCCTTGATTCCACTCCAGAGG + Intronic
1071106697 10:82106297-82106319 TGCCCTTGGCTCAGCAACACTGG - Intronic
1075829654 10:125396810-125396832 TCACCTTGGCCTAATTCCACTGG - Intergenic
1078558560 11:12351311-12351333 TGCCCCTGGCTGAACCCCACTGG - Intronic
1083163536 11:60869835-60869857 CCACCCTGGCTCAACCCCACTGG + Exonic
1083286437 11:61662145-61662167 TCCCCTAGGCGCCACTCTACAGG - Intergenic
1088469715 11:110179084-110179106 TCCCCCTGGCTGAACCCCTCTGG - Intronic
1088561683 11:111121828-111121850 TCCCACTGGCTGAACTCCATAGG + Intergenic
1090042647 11:123304194-123304216 TCCACTTGCTTCATCTCCACTGG - Intergenic
1091057984 11:132436676-132436698 TCCCCATGGCTGAATTCCAGTGG - Exonic
1093097150 12:14984508-14984530 TCCCATTGGCTAAACCCAACTGG + Intergenic
1100339564 12:93665419-93665441 TCCTCTTGGCTGAACCCAACTGG - Intergenic
1101904847 12:108816897-108816919 TCCCAGTGGCTCGACTCCCCAGG + Intronic
1103882294 12:124175472-124175494 AACGCTTGGCTCAACACCACGGG + Intronic
1104904752 12:132207240-132207262 TCCCCATGGCTCAGCTCCGCAGG + Intronic
1108279305 13:48845150-48845172 TTCCCTTGGCTCAACTCAGAGGG + Intergenic
1112242530 13:97695983-97696005 CCTCCTTGGTTCTACTCCACAGG + Intergenic
1113089085 13:106598198-106598220 TCCCCTTGGCTGAACCCTGCAGG - Intergenic
1113521903 13:110947361-110947383 TCACCTTCACTCACCTCCACTGG - Intergenic
1113705990 13:112433338-112433360 TCACCTTCACTCACCTCCACTGG + Intronic
1113813006 13:113153637-113153659 TCCCCTGGGCTCAGCTACCCGGG + Intergenic
1114521565 14:23341785-23341807 GTCCCTTGGCTCAACTCCCTGGG + Intergenic
1115312361 14:31992384-31992406 TCCCCAAGGCTCTACTCCTCTGG - Intergenic
1116176705 14:41479790-41479812 TCCTATTGCCTCAACTCCCCAGG - Intergenic
1116292391 14:43060359-43060381 TCCCATTGGCTGAACTCAACAGG + Intergenic
1117289733 14:54320831-54320853 TCCCGTTGGCTGAACTCAGCTGG - Intergenic
1117659338 14:57987676-57987698 TCCCATTAGCCCAACTCAACTGG - Intergenic
1119643942 14:76335093-76335115 TCCCCTTAGTTCACCACCACTGG + Intronic
1121660396 14:95631078-95631100 TCTCCTTGGCCCAGCTGCACTGG - Intergenic
1124929981 15:34109945-34109967 TCCCATTGGCTGAACCCAACAGG - Intergenic
1125911050 15:43439426-43439448 TCCTCCTGCCTCAACCCCACAGG - Intronic
1127369220 15:58321580-58321602 TCCCCATGGCTCAACTTTAATGG - Intronic
1128617093 15:69118698-69118720 TCCCCTAGACTCAACTCATCTGG + Intergenic
1129403724 15:75300956-75300978 TCCCCTTGGCTGAATAGCACAGG + Intergenic
1129479484 15:75811656-75811678 TCCACTTGGCTCAAGGCCTCTGG + Intergenic
1129727491 15:77909043-77909065 TCCCCTTGGCTGAATAGCACAGG - Intergenic
1129840387 15:78739930-78739952 TCCCCTTGGCTGAATAGCACAGG + Intergenic
1130258512 15:82337063-82337085 TCCCCTTGGCTGAATAGCACAGG - Intergenic
1130596414 15:85252897-85252919 TCCCCTTGGCTGAATAGCACAGG + Intergenic
1130932382 15:88438759-88438781 TCACTTGGCCTCAACTCCACAGG + Intergenic
1130993195 15:88889004-88889026 TCCCATTGGCTCAATCCCACTGG - Intronic
1131350144 15:91692399-91692421 TCCTCTGGGCTCTACTCCGCTGG + Intergenic
1131761147 15:95624003-95624025 TCCCTTTGTCTCAAATCCAGAGG + Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1140280734 16:73553043-73553065 TCCCCTTGGATCCAATTCACAGG - Intergenic
1143906806 17:10215852-10215874 TCCTCATGGCTCAACTTCCCAGG + Intergenic
1145398329 17:22512771-22512793 TCCCCTGGGGGCAACACCACAGG + Intergenic
1147121227 17:38336297-38336319 TACCCCAGGCTCAACTCCACTGG + Intronic
1152666162 17:81570821-81570843 TCCCCATGCCTCACTTCCACAGG + Intronic
1157220458 18:45825509-45825531 TCCACATGACTAAACTCCACGGG + Exonic
1157593587 18:48850689-48850711 GGCCCTTGGCACAACTCCACAGG - Intronic
1157963349 18:52181332-52181354 TCCTCATGGCTCACCTTCACAGG + Intergenic
1159082658 18:63752975-63752997 TCCCTTTGGCTCAACTCCCAAGG - Intronic
1159398927 18:67904486-67904508 TCCCCTTGCCTCAGCTTCCCCGG + Intergenic
1162192298 19:8956525-8956547 TCCTCTTGGCTCTACATCACAGG - Exonic
1162721581 19:12665984-12666006 TCCACTTTGCACAACCCCACAGG + Intronic
1163861908 19:19747289-19747311 TCCCCTTGGCTCTTCCCCAGAGG + Intergenic
1164519626 19:28968744-28968766 TGCCCCTAGCTTAACTCCACTGG + Intergenic
1164638971 19:29811527-29811549 TCCCCTTGGCTCAGCCCTGCCGG + Intergenic
1165323657 19:35101268-35101290 TCCCCTGGGCCCATCACCACAGG - Intergenic
925888447 2:8413368-8413390 TCCCCTTGCCTCAGCACCAAAGG + Intergenic
927192583 2:20526903-20526925 TCTCCTTGGCTCAACTCCAGAGG + Intergenic
927199513 2:20569733-20569755 TCCCCTGTGCCCAACTCCAAGGG - Intronic
927694097 2:25228919-25228941 GCTCCCTGGCTCAGCTCCACTGG - Exonic
929558888 2:42943280-42943302 TGCCCTGGTCCCAACTCCACGGG - Intergenic
931940025 2:67241743-67241765 TCTCCTTTACTCAAGTCCACAGG + Intergenic
935966316 2:108480031-108480053 TGTCCTTGGCTCACCTCCGCAGG - Intronic
936325071 2:111498063-111498085 ACCCATTGGGTCTACTCCACAGG - Intergenic
936902865 2:117503826-117503848 TCACCTTGCTTCAACTCCCCCGG - Intergenic
937666389 2:124492338-124492360 TCCACTTTTCTCAACACCACTGG + Intronic
939644314 2:144677827-144677849 TCCCCTTGCCTGAGCTCGACAGG - Intergenic
945779107 2:214145688-214145710 TCCACTTGGCTAAATTCTACTGG + Intronic
946348780 2:219133868-219133890 TCCCCTTGGCTCAACTCCACAGG + Intronic
948649486 2:239431641-239431663 ACCCCATGACTCAAGTCCACAGG - Intergenic
1169819194 20:9690196-9690218 TGCCCTCTGCACAACTCCACTGG - Intronic
1172695271 20:36818044-36818066 ACCCCTTGCCTCAGCTCTACAGG + Intronic
1172765909 20:37350654-37350676 TCCCCGTGGCTCAAATCTACTGG + Intronic
1174085895 20:48006908-48006930 TCCCCTTGGCTGAACATAACTGG + Intergenic
1174820825 20:53725179-53725201 TCCCGTTGGCTAAACCCAACTGG - Intergenic
1175996019 20:62812684-62812706 TCCCCCTGGCTCCTCTCCAGGGG - Exonic
1177942423 21:27427563-27427585 CCCCCTAGCCTCAACTCCTCAGG + Intergenic
1179617608 21:42592319-42592341 TCCCCTAGACTCGACTCCATGGG - Intergenic
1180673513 22:17571303-17571325 TTCCCTTGGCTTGACTCCTCTGG - Intronic
1185058548 22:48593574-48593596 TCCCCTTGGCCCAGCACCCCAGG + Intronic
1185099148 22:48828328-48828350 CCCCCTTGGCTGAACTCAGCTGG - Intronic
1203291968 22_KI270736v1_random:3347-3369 TTCCCATTGCACAACTCCACTGG - Intergenic
950727117 3:14923708-14923730 TTCCCTGGCCTCCACTCCACGGG + Intronic
951038023 3:17954997-17955019 TCCCTCTGGCTCAACCCAACTGG + Intronic
952305059 3:32138163-32138185 TCCCATTGGCTGAAGCCCACTGG + Intronic
953059255 3:39413699-39413721 TCCCATTGCCTCAGCACCACCGG - Intergenic
953614682 3:44478917-44478939 TCCCATTGGCCCAACTCAACTGG + Intergenic
954627903 3:52032754-52032776 ACCTGTAGGCTCAACTCCACTGG + Intergenic
964170581 3:153765511-153765533 TCCCATTTGCTGAACTCAACTGG + Intergenic
964454178 3:156842758-156842780 TCCCCTGGTCTCATCTCCTCAGG + Intronic
968627401 4:1632593-1632615 TCCCCGTGGCTCTACTCTAAGGG - Intronic
969328436 4:6458023-6458045 TCACCTTCACTCAACTCCTCTGG + Intronic
969342862 4:6553257-6553279 TCCCACTGGCCAAACTCCACGGG + Intronic
970441093 4:16082158-16082180 TACTCTGAGCTCAACTCCACCGG + Intronic
971254055 4:24997785-24997807 TCACCTTGTCTCTATTCCACTGG - Intergenic
977410711 4:96658651-96658673 TCCTGTTGCCTCAACTCCCCAGG - Intergenic
982238537 4:153275289-153275311 TCTCCTTGTCTCTACTCAACAGG - Intronic
988159482 5:27501653-27501675 TCCTCTTGTTGCAACTCCACAGG - Intergenic
997309273 5:132866457-132866479 TCCGCTAGGCTCCACCCCACCGG + Intronic
1000776500 5:165426266-165426288 TCCCCATGGCTGAGCTCCCCAGG - Intergenic
1001799247 5:174529084-174529106 TCCCATTGGCTCTACTTCTCTGG - Intergenic
1004166344 6:13260037-13260059 TCCCATGGGCACAACTCCAGGGG + Intronic
1004305658 6:14499828-14499850 GACCCTTGTTTCAACTCCACTGG + Intergenic
1005981642 6:30841341-30841363 ACTCCTTGGCTCAATCCCACTGG + Intergenic
1006263386 6:32895179-32895201 TCCCCTTCTCTCTCCTCCACGGG - Intergenic
1007405126 6:41631038-41631060 TCCCATTGGCTGAACTTAACTGG - Intergenic
1007468956 6:42075682-42075704 TCCCCTTGGCCCATCACCAGGGG + Intronic
1010311223 6:74388315-74388337 TCCCATTGGCCAAACCCCACTGG + Intergenic
1010481411 6:76358764-76358786 TAACAGTGGCTCAACTCCACCGG - Intergenic
1015436839 6:133199529-133199551 TTCCCTTGGTTCCACTCCAAAGG - Intergenic
1018244016 6:161804504-161804526 TCCCCTTCCCTCCCCTCCACTGG + Intronic
1019330783 7:459755-459777 TCCCATTGGCTGACCTCAACAGG + Intergenic
1021378219 7:19935002-19935024 TCCCCTTGGCTCACCCCTTCTGG - Intergenic
1021795383 7:24249213-24249235 TCCCATTGGCTGAACCCAACTGG + Intergenic
1022114819 7:27252216-27252238 TCGCCTGGACTCAACTGCACGGG - Intergenic
1022277795 7:28873024-28873046 TGCCCTTGGCTCAACACCTGTGG - Intergenic
1037561157 8:20075564-20075586 TGCACTTGGCTCAACACCAAGGG + Intergenic
1039490364 8:37942980-37943002 TCCCCTTGGCTCTACTGTCCTGG + Intergenic
1041945440 8:63435725-63435747 TCACCTTAGCTAAATTCCACTGG + Intergenic
1045250065 8:100475600-100475622 TCCCCCTGGCCCCACCCCACTGG - Intergenic
1046447123 8:114337436-114337458 TCCCTTTGGGACAACTCCAGAGG - Intergenic
1050470415 9:5982810-5982832 TCCCCTCAACTCCACTCCACTGG - Intronic
1053366400 9:37525357-37525379 TCCCTATGGCTCAAGTCCACAGG + Intronic
1053473145 9:38361016-38361038 TCCTGTCTGCTCAACTCCACGGG - Intergenic
1056041305 9:82670192-82670214 TCCTTTTGGCTGAACTCAACTGG + Intergenic
1056606903 9:88093378-88093400 TGCCCTTCACTCAACTCCAAAGG + Intergenic
1057289719 9:93797120-93797142 TGCCATTGTTTCAACTCCACCGG - Intergenic
1057872834 9:98731194-98731216 TCACCTTGCCTCATCTTCACAGG - Intergenic
1058498656 9:105588877-105588899 TCCCATTGGCTAAACCCAACAGG - Intronic
1059167422 9:112091969-112091991 TTCCCTTGGCTCAGCTCCCCAGG + Intronic
1060194333 9:121613567-121613589 TCCTCTTAGATCAGCTCCACTGG + Intronic
1060509404 9:124221204-124221226 TCCCCTTGGCCCAACCTAACAGG - Intergenic
1060956436 9:127644336-127644358 TCCTCTTGACTGAACTCCAGGGG - Intronic
1185805052 X:3049498-3049520 TCACCTTGGCTTATCTTCACAGG - Intronic
1186516261 X:10167922-10167944 TCTCCTTGGGTCAGCTCCCCAGG + Intronic
1190192662 X:48290664-48290686 TCACCTAGGCTAAACTCCCCTGG - Intergenic
1191040301 X:56070655-56070677 TCCCCTTGCCCCCACTCAACAGG - Intergenic
1191151765 X:57227540-57227562 GCCCCTTGTGTCACCTCCACTGG - Intergenic
1195876014 X:109541327-109541349 TCCCCTTGCTCCATCTCCACTGG - Intronic
1196820029 X:119694231-119694253 TCCCCGTGGCCCACCTCCGCGGG + Intergenic
1202368055 Y:24180108-24180130 TCCCCTTGGCTGAATAGCACTGG + Intergenic
1202372639 Y:24209074-24209096 TCCCCTTGGCTGAATAGCACAGG - Intergenic
1202498145 Y:25461046-25461068 TCCCCTTGGCTGAATAGCACAGG + Intergenic
1202502730 Y:25490009-25490031 TCCCCTTGGCTGAATAGCACTGG - Intergenic