ID: 946349324

View in Genome Browser
Species Human (GRCh38)
Location 2:219138807-219138829
Sequence CAGGGTAAACTCTATTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946349324 Original CRISPR CAGGGTAAACTCTATTGGGA AGG Intronic
906872074 1:49494037-49494059 CAGAGTAAGCTCTAGAGGGAAGG - Intronic
909554556 1:76939124-76939146 CACTGTCAACTCTAATGGGATGG + Intronic
910162865 1:84292617-84292639 CAGGGTAAACTTCATTGAGAAGG - Intergenic
910918747 1:92320149-92320171 CAAGGAAAACTTTATTGGGCTGG + Intronic
912071787 1:105819627-105819649 CAGGGGAAACTGTATTGTTATGG + Intergenic
913329267 1:117653726-117653748 CAGGGGAAACTCTGCAGGGAAGG - Intergenic
914963493 1:152228896-152228918 CAGGGTAGGCTTTATTGAGAAGG - Intergenic
922630223 1:227099776-227099798 CAGGGAAAACTATACTGAGAAGG - Intronic
922641503 1:227236729-227236751 CATGGTTAACTCCATTGGAAAGG - Intronic
924656717 1:245979232-245979254 CAGGGTAAAAACAACTGGGATGG + Intronic
1064039680 10:11949330-11949352 AAGGGTATTCTCTATTGAGAAGG - Intronic
1065256692 10:23876580-23876602 CAGGGTCAATTTTACTGGGATGG + Intronic
1070523779 10:77277238-77277260 CAGGCCAAACTCTAATGAGAAGG + Intronic
1071031565 10:81190207-81190229 CAAGGAAAAATCTGTTGGGAAGG + Intergenic
1072093074 10:92148577-92148599 AATTGTAAACTCTATTAGGATGG + Intronic
1088136320 11:106559981-106560003 CAGTATGAAATCTATTGGGAGGG + Intergenic
1090286261 11:125502048-125502070 CAGGGTAGATTGTAGTGGGATGG + Intergenic
1093294264 12:17368225-17368247 CAGTGAAAACTATATTAGGAAGG - Intergenic
1096194912 12:49643480-49643502 GAGGGTAGACTGGATTGGGAGGG + Exonic
1097995476 12:65883089-65883111 CATTTTAAACTCTGTTGGGAAGG - Intronic
1099651636 12:85435539-85435561 CTGGATAAACTGTATTGTGATGG - Intergenic
1100983844 12:100186430-100186452 CTGAGTCAACTTTATTGGGATGG - Intergenic
1103811092 12:123614520-123614542 CAGGGTGAACTTTATTAGAAGGG + Intronic
1106320679 13:28635321-28635343 CAGGGTGAACCCTAATGGGAAGG + Intergenic
1110662034 13:78067611-78067633 AAGGGTAAGCTTTATTGGGAGGG + Intergenic
1114578051 14:23731128-23731150 CACTGTAAACTCCCTTGGGAAGG - Intergenic
1116017665 14:39426787-39426809 CAGGGAAACCTCTTTTGAGAAGG - Intronic
1116179111 14:41513345-41513367 CAGGGCAAAGTCCAGTGGGAAGG - Intergenic
1126652557 15:50938947-50938969 GAGAGTAAACTCTATTCTGAGGG + Intronic
1127133408 15:55892718-55892740 CAGAGAAAACTCTAAAGGGATGG - Intronic
1127503732 15:59578500-59578522 CTGGGGAAACTCCATTGGAAAGG + Intergenic
1132469170 16:92349-92371 CAGGGTGGGCTCTATGGGGAGGG + Intronic
1140851214 16:78936311-78936333 CAGGGAAAACTCGCTTGGGATGG - Intronic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1142006696 16:87692651-87692673 CAGGGTAAAGTCCCTTAGGATGG + Intronic
1143414898 17:6739471-6739493 CAGGATATACTCTATCAGGAAGG - Intergenic
1145017827 17:19410644-19410666 CAGAGTGAAAGCTATTGGGAGGG + Intergenic
1149591318 17:57831846-57831868 CAGGGTAAAATAAAGTGGGAGGG + Intergenic
1155238621 18:23845457-23845479 CAGGGTACCCTCCACTGGGAAGG + Intronic
1155531040 18:26766782-26766804 CAGCTTACACTCTATGGGGAGGG + Intergenic
1156333738 18:36150144-36150166 CAGGGCAGACTCTGGTGGGAAGG - Intronic
1157385095 18:47253684-47253706 CAGGGTAACCTGGAATGGGAGGG - Intergenic
1158930686 18:62323318-62323340 CAGGTTATATTCTATTGGCATGG + Intergenic
1164638021 19:29805676-29805698 CAGGGCAAGCTCTAGTGGGCTGG - Intergenic
1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG + Intergenic
930758616 2:55006120-55006142 CAGGGTAATGTGTGTTGGGAGGG - Intronic
932100786 2:68897347-68897369 CAGGTTAAACTCCACAGGGAGGG - Intergenic
938036617 2:128039985-128040007 CAGGGACAAATCTATTAGGAAGG + Intergenic
939073783 2:137575818-137575840 AAGAGTAAACACTATTAGGAAGG - Intronic
942224517 2:173803714-173803736 CAGGGTAAAGTTTAATGGTATGG - Intergenic
944198351 2:197079204-197079226 CAGGGCAACCTCAATAGGGAGGG + Intronic
946349324 2:219138807-219138829 CAGGGTAAACTCTATTGGGAAGG + Intronic
946535701 2:220625690-220625712 CAGAGGAAACTCTTCTGGGAGGG + Intergenic
1168999032 20:2153559-2153581 CTGGGTAAACACTAGTTGGAGGG - Intronic
951593662 3:24294025-24294047 CAGGGTCAGCTCAATTGAGAAGG - Intronic
954946823 3:54433249-54433271 CAGTGTAGACTCTATCAGGATGG + Intronic
962823697 3:139079472-139079494 CAGGGGAAACTCTGAAGGGAGGG - Intronic
964574472 3:158149582-158149604 GAGGGTAAAATATATTTGGAGGG + Intronic
974495478 4:62621107-62621129 CAGGAGAAACTCTTTTGGTAAGG + Intergenic
976743117 4:88377573-88377595 CAAGGTAAACTCTACTGGACTGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
980810558 4:137873186-137873208 CAGGGTAAAATCAAATGAGAAGG - Intergenic
981258772 4:142694656-142694678 CAGGGTAAACTATGCTGGGAAGG + Intronic
981570899 4:146149297-146149319 CATGCTAAACTTTATTGGGAAGG - Intergenic
986341668 5:6794352-6794374 CAGGGTAAACATTATTCTGAGGG - Intergenic
992969402 5:82040522-82040544 CAGGGGAAAAACTATTGGCAAGG + Intronic
993737826 5:91498792-91498814 CAGTGTAAAATCTAGTTGGAAGG + Intergenic
996411199 5:123161491-123161513 CAGGGTAAGCTTCACTGGGAAGG + Intronic
998446515 5:142203048-142203070 CTGGCTAAACTGTCTTGGGAAGG + Intergenic
1001165619 5:169363094-169363116 CAGGGCAGCCTCTATTGGGTTGG - Intergenic
1005483864 6:26280713-26280735 CAGGGAAAAATATAGTGGGAAGG + Intergenic
1005632372 6:27720670-27720692 CAAGATAAACTCTGTTGAGAAGG + Intergenic
1011072487 6:83400988-83401010 AAGGGTAATCTCCATTGAGAAGG - Intronic
1012666204 6:101973915-101973937 TGGGCTAAACTGTATTGGGAAGG - Intronic
1015242705 6:131043485-131043507 CAGGTTAAACTACATAGGGATGG + Intronic
1017702103 6:157084401-157084423 AAGGGCAAACTGTATGGGGATGG + Intronic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1023555891 7:41422678-41422700 GAGTTTTAACTCTATTGGGAAGG + Intergenic
1025622575 7:63187353-63187375 CAGGGTAAACTATGTTGGCCAGG - Intergenic
1032497285 7:132371887-132371909 CTGGGGAAACTTGATTGGGAAGG + Intronic
1040045130 8:42955114-42955136 AAGGGTCAACTGTATTGAGAGGG - Intronic
1041755853 8:61312442-61312464 CAGGGTAAATTTTGTTGTGAAGG + Intronic
1042102404 8:65287535-65287557 CAGTAGAAACTCTATAGGGAGGG + Intergenic
1047577802 8:126177275-126177297 CAGGGAAAAATCTAATGGGCTGG + Intergenic
1048107767 8:131429977-131429999 CAGGGCAAGCTCTGTTAGGAGGG - Intergenic
1048533308 8:135270472-135270494 GAGGGTAAACTCTATCTTGATGG + Intergenic
1054748627 9:68881625-68881647 CAGGGTGAATTTTAATGGGATGG - Intronic
1056444754 9:86655114-86655136 CAGGATAAACAAGATTGGGAAGG - Intergenic
1058946984 9:109866530-109866552 AAGGGTACACTCTAATGGAAAGG + Intronic
1187960126 X:24560167-24560189 CAGGTGAGACTCTCTTGGGAAGG - Intronic
1201447770 Y:14077007-14077029 CAGGATAAAATCTCCTGGGAGGG + Intergenic
1201944668 Y:19498815-19498837 TAGTGTAAACGCTATTGGCAAGG - Intergenic