ID: 946352014

View in Genome Browser
Species Human (GRCh38)
Location 2:219161291-219161313
Sequence GGTTGTACAAAGTCCAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946352014_946352016 -3 Left 946352014 2:219161291-219161313 CCTATCTTGGACTTTGTACAACC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 946352016 2:219161311-219161333 ACCCATGGCTTTGCTCAAGCTGG 0: 1
1: 0
2: 2
3: 15
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946352014 Original CRISPR GGTTGTACAAAGTCCAAGAT AGG (reversed) Intronic
900146953 1:1162640-1162662 GGTTGAACAAAAGCCAGGATGGG - Intergenic
903133786 1:21296086-21296108 GGCTGAACAAAGGCCAAGACTGG - Intronic
909119845 1:71588430-71588452 TGTTGTAAAAAGTACAAAATTGG - Intronic
916841992 1:168610086-168610108 GGTTTAGGAAAGTCCAAGATGGG - Intergenic
1065379097 10:25071152-25071174 GGTAGAACGAAGACCAAGATAGG + Intergenic
1067860020 10:49836535-49836557 TGATGTATAAAATCCAAGATTGG + Intronic
1072204616 10:93192108-93192130 AGTTGTACAAGTTCCAACATTGG + Intergenic
1075676202 10:124297267-124297289 GCTTGTTCAAAGGCCCAGATGGG - Intergenic
1080678997 11:34456121-34456143 GGATGTAAAAAGTCCAGGAGGGG - Exonic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1087193392 11:95280306-95280328 GATTGCACAAAATTCAAGATGGG + Intergenic
1089094493 11:115907713-115907735 TGTTTTACAAAGTCCAGGAATGG - Intergenic
1099263647 12:80416383-80416405 GGAAGTAGGAAGTCCAAGATGGG + Intronic
1100311927 12:93403617-93403639 GGATGTAAAAACACCAAGATAGG - Exonic
1109167716 13:59056734-59056756 CGATGTACAAGGTCCCAGATAGG + Intergenic
1111757377 13:92415421-92415443 GCTTGTATATAGTCCAAAATTGG + Intronic
1112209460 13:97361421-97361443 TGTTGTACAAAGGCAGAGATGGG + Intronic
1127529007 15:59823964-59823986 GGATCAACAAAGTCAAAGATTGG + Intergenic
1138403134 16:56765417-56765439 GGTTGTTTTAAGTCCAGGATGGG - Intronic
1143145882 17:4775075-4775097 GGTAGTACAAAGCCTAAGGTGGG + Intronic
1143932499 17:10444322-10444344 GGTTGTAGAATGTTCTAGATAGG + Intronic
1146553212 17:33799919-33799941 GGTTGTACTAAGTACAAAACAGG + Intronic
1147368720 17:39976668-39976690 GGCTGTTCAAAGACCCAGATGGG + Intronic
1159578173 18:70205463-70205485 GTTTACACAAAGTCCGAGATGGG + Intronic
1167177719 19:47877175-47877197 GGTGGTACAAAATCCAATGTTGG + Intronic
1167822516 19:51941488-51941510 GGGGGCACAGAGTCCAAGATAGG - Intronic
925002381 2:415924-415946 GATTGTGCAAAGTCCAGGACAGG + Intergenic
927566102 2:24114486-24114508 GGTTCTACACAGGCCAAGATAGG - Intronic
930808856 2:55519883-55519905 TGTTCCACAAAGTCCAAGATGGG - Exonic
931059077 2:58505965-58505987 GGGTGTAAAAAGTCCAGAATGGG - Intergenic
931986647 2:67748464-67748486 GTCTGTACAAATTCCAAGCTGGG + Intergenic
933053373 2:77630193-77630215 GGTTTTAAAAAGTACAAAATAGG - Intergenic
936582649 2:113716951-113716973 AGTTGTACAATGTTCTAGATAGG + Intronic
938164643 2:129016201-129016223 GGATGGACAAAGTACAAAATAGG - Intergenic
942832320 2:180251781-180251803 GGTGGTTGGAAGTCCAAGATAGG + Intergenic
945177339 2:207055764-207055786 GGTTGTAGAAACACAAAGATGGG - Intergenic
946352014 2:219161291-219161313 GGTTGTACAAAGTCCAAGATAGG - Intronic
947825418 2:233102935-233102957 TGTTATACAAAGTGCAATATGGG - Intronic
1169934953 20:10873424-10873446 TGATGTATAAAGTACAAGATGGG + Intergenic
1173839404 20:46147593-46147615 GGTTGTCTTAAGTCCAAGATAGG + Intergenic
954145744 3:48633461-48633483 GGTTGCAGTAAGGCCAAGATTGG - Exonic
954854677 3:53633779-53633801 GGTTGTAAAAAGTGTAAGACTGG + Intronic
957281226 3:78154041-78154063 GGTTGAAAAAAGTCCTAAATGGG + Intergenic
958870232 3:99550060-99550082 GGTTATACAAAGTCCCAGCTTGG - Intergenic
964883789 3:161456394-161456416 AGCAGTACAAAGTCCAGGATTGG + Intergenic
967934826 3:194718563-194718585 TCTTGTACAAAATCCAAGATAGG - Intergenic
970403639 4:15741582-15741604 GGTTGTACAAAAGCCAGAATGGG - Intergenic
972187751 4:36551964-36551986 ATTTGAACAAAGTCTAAGATGGG + Intergenic
977009557 4:91620179-91620201 GGTTATACCAAGTCCAGCATTGG - Intergenic
979556574 4:122054658-122054680 GGAAGTAGAAAGGCCAAGATAGG - Intergenic
989471596 5:41825806-41825828 GTGGGTACAAAGTCCAAGACTGG - Intronic
993563510 5:89443079-89443101 GTATGCAAAAAGTCCAAGATTGG + Intergenic
999215505 5:149930889-149930911 GGTTGTAGAAAGTCTTACATAGG - Intronic
1003213276 6:4087151-4087173 GCTTCTACAAAGTACCAGATGGG + Intronic
1011968303 6:93188801-93188823 TGTTGGCCAAAGGCCAAGATAGG - Intergenic
1015600130 6:134903616-134903638 GGTTGCAGAAAGGCCAAGCTAGG + Intergenic
1027585095 7:80047367-80047389 TGTTCTAAAAAATCCAAGATAGG - Intergenic
1028097352 7:86777831-86777853 AGCTGTACAAAATCCCAGATTGG - Intronic
1030527128 7:110667739-110667761 GGATGTCAAAAGTCCAATATGGG - Intronic
1031787400 7:126050523-126050545 TGTAGTTAAAAGTCCAAGATTGG - Intergenic
1031837831 7:126700153-126700175 GGTTGTATTATGTCTAAGATTGG + Intronic
1033682247 7:143605932-143605954 TGCTGTATAAAGTGCAAGATGGG - Intergenic
1033702642 7:143855981-143856003 TGCTGTATAAAGTGCAAGATGGG + Intronic
1036992159 8:13610256-13610278 GGTAATACAAACTCCAAAATAGG + Intergenic
1043883467 8:85570970-85570992 GGTTATACAACTTACAAGATGGG + Intergenic
1047640610 8:126817412-126817434 GGTGGTACACAGTTCCAGATGGG - Intergenic
1055311816 9:74990702-74990724 GGTCAGACAAAGTACAAGATGGG + Intronic
1056030478 9:82548200-82548222 GGTTGGACTAAGTCCATGTTTGG - Intergenic
1060212091 9:121716765-121716787 GATTGGCCAAAGACCAAGATGGG + Intronic
1186340202 X:8636994-8637016 GGTTGTACAAATTTCAAGTTTGG - Intronic
1187510732 X:19915922-19915944 GATTGTACACAGTACAAGACAGG + Exonic
1188044302 X:25408150-25408172 GCTTGTATAAACTCAAAGATGGG + Intergenic
1188251389 X:27899608-27899630 TTATGTACAAATTCCAAGATGGG - Intergenic
1188399403 X:29726570-29726592 TGCTGTACAAAGTACAAGACAGG + Intronic
1188810312 X:34646113-34646135 GGTTGTCCAAAATGCCAGATGGG + Intronic
1194188568 X:90807265-90807287 GGTTGTTGAAAATCCCAGATGGG + Intergenic
1194280407 X:91945830-91945852 GGGTATAGAAAGTCCAAGATGGG - Intronic
1200535156 Y:4389160-4389182 GGTTGTTGAAAATCCCAGATGGG + Intergenic
1200597884 Y:5169358-5169380 GGGTATAGAAAGTCCAAGATGGG - Intronic