ID: 946359905

View in Genome Browser
Species Human (GRCh38)
Location 2:219213056-219213078
Sequence AGTCTCCCGCCTGCAAGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946359902_946359905 9 Left 946359902 2:219213024-219213046 CCAGGCATCACAGTGAAAGACAC 0: 1
1: 0
2: 3
3: 15
4: 173
Right 946359905 2:219213056-219213078 AGTCTCCCGCCTGCAAGGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 108
946359901_946359905 26 Left 946359901 2:219213007-219213029 CCAGGGCAAGTGTCTGTCCAGGC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 946359905 2:219213056-219213078 AGTCTCCCGCCTGCAAGGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946359905 Original CRISPR AGTCTCCCGCCTGCAAGGAA AGG Exonic
900916187 1:5640421-5640443 ACTCTGCCGCCTGCAAAGACAGG - Intergenic
903882439 1:26520634-26520656 ATTCTTCCCCCTGCAAAGAAGGG - Intergenic
906308937 1:44739194-44739216 AGTCTACCACCTGCTAGGCATGG - Intergenic
908110557 1:60893311-60893333 TTTCTCCCGCCTCAAAGGAACGG + Intronic
911107153 1:94142724-94142746 AGTTTCCCTGCTCCAAGGAAAGG - Intergenic
911375389 1:97044761-97044783 AGGCTCCCCACTGCAGGGAAAGG - Intergenic
912652137 1:111449083-111449105 ATGCGCCCGCCTGCATGGAACGG - Exonic
912795213 1:112689239-112689261 AGTCCCCCTCCTTCAGGGAATGG + Intronic
913971265 1:143420067-143420089 AGACTCCGTCCTGCAAGGTAAGG - Intergenic
914065642 1:144245680-144245702 AGACTCCGTCCTGCAAGGTAAGG - Intergenic
914113509 1:144720674-144720696 AGACTCCGTCCTGCAAGGTAAGG + Intergenic
914244218 1:145873666-145873688 AGTCTCCGGCCTGGAGGGGATGG - Exonic
916426186 1:164682859-164682881 AGGATCCCATCTGCAAGGAAGGG - Intronic
917701598 1:177587264-177587286 AGTATCAGGCCTGCATGGAAAGG - Intergenic
920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG + Intergenic
921402907 1:214746105-214746127 AGTCTCTGGGCTGCAAGGAAGGG - Intergenic
1066254199 10:33662812-33662834 AGACCCCCGATTGCAAGGAAGGG + Intergenic
1070056774 10:72942735-72942757 TTTCTTCCTCCTGCAAGGAAAGG - Exonic
1070857262 10:79615796-79615818 AGTCTCAGGTCTGCATGGAATGG + Intergenic
1072881795 10:99235673-99235695 TGTCTCCAGCCTGGGAGGAAAGG + Exonic
1075121801 10:119669893-119669915 AGGCTGCCGCCTGCTAGGGAAGG + Exonic
1076742384 10:132493135-132493157 AGTCTTCCTTCTGCAAGGAAGGG + Intergenic
1076771940 10:132670555-132670577 ACTCTCCCCCCAGCAAGGAGGGG - Intronic
1077053071 11:576357-576379 AGACCCCCGGCTGCAAGGAGTGG + Intergenic
1077177519 11:1197455-1197477 TGTGGCCCACCTGCAAGGAAGGG - Intronic
1077310492 11:1886850-1886872 AGACTCCGTCCTGCAAGGTAAGG + Exonic
1077593469 11:3511167-3511189 GGTCTCCTGGCTGGAAGGAATGG + Intergenic
1082997290 11:59264143-59264165 AGTCTACTGCCTGCCAGGCAGGG - Intergenic
1083933716 11:65859656-65859678 GGTCTCCAGCCTGCGAGGAAGGG - Intronic
1086339660 11:85835803-85835825 AATCTCCTGCCTGCAGGGGAGGG + Intergenic
1088011126 11:105002113-105002135 GATCACCTGCCTGCAAGGAATGG - Exonic
1089527788 11:119108131-119108153 AGTCCCTCCCCTGGAAGGAAAGG - Exonic
1090785408 11:130043853-130043875 AATCTCCCGCCTGCAAAGCCAGG + Intergenic
1091582006 12:1795990-1796012 TGTCTCCAGTCTGCTAGGAAAGG - Intronic
1095507040 12:42908920-42908942 AGTCTGCCTCCTGTGAGGAAAGG + Intergenic
1096457910 12:51802496-51802518 AGTGGCTGGCCTGCAAGGAAAGG - Intronic
1103697656 12:122829880-122829902 AGTCTCCTTCCTGGAAGGTATGG - Intergenic
1104374115 12:128249095-128249117 AGCCTCATGCCTGCAAGGGAGGG + Intergenic
1105742347 13:23340387-23340409 GGGTTCCAGCCTGCAAGGAAAGG - Exonic
1108272204 13:48772309-48772331 TGTCCCCTGCCAGCAAGGAAGGG + Intergenic
1115556524 14:34548732-34548754 AGACTCACGCCTCAAAGGAAGGG - Intergenic
1118302903 14:64631073-64631095 AGTCTCCCTCCTCTATGGAATGG + Intergenic
1121379565 14:93451391-93451413 AGTCTCCAGCCTGAAGGGTAAGG + Intronic
1127326068 15:57896373-57896395 AGTCTCACTCTTGCAATGAAAGG - Intergenic
1131740480 15:95385014-95385036 AGCTTACAGCCTGCAAGGAAAGG - Intergenic
1132592221 16:731043-731065 AGGCTCCTGCCTGCCTGGAAGGG + Intronic
1133255429 16:4513346-4513368 TGTCTCCAGCATGCAAGGACAGG + Intronic
1133533904 16:6681809-6681831 AGTATCCCGGCTGAAAAGAAAGG - Intronic
1145023878 17:19453270-19453292 AGCCTCCTGCCCCCAAGGAAGGG + Intergenic
1145263876 17:21370208-21370230 CGTCTCCCGCCTGCAATGGGTGG + Intergenic
1148957635 17:51366674-51366696 ACTCTCCCTCCTGCGAGGAGTGG + Intergenic
1152598278 17:81248892-81248914 AGACGCCTGCCTGCAGGGAAAGG + Intronic
1152642610 17:81455443-81455465 AGTCTGCTACCTGCCAGGAAGGG - Intronic
1153050007 18:893245-893267 AGTCTCCTGCCTGCATGCATAGG - Intergenic
1153675922 18:7455474-7455496 AGCCCCCCGCCTGAGAGGAAGGG - Intergenic
1155886156 18:31211181-31211203 AGTCTCTAGCCTTCGAGGAAGGG - Intergenic
1157656966 18:49399849-49399871 AGTCTCCAGCCCTCAAGGCAAGG + Intronic
1159285369 18:66342818-66342840 AGTCTGCAGCCTGTTAGGAATGG - Intergenic
1161229116 19:3163638-3163660 AGCCCCCAGCCTGCAAGGGATGG - Exonic
1167149357 19:47699821-47699843 AGTCTCCTGTCTGCAGGAAACGG + Intronic
926061335 2:9806973-9806995 AGTCTCCCGGCTGCATGGAATGG - Intergenic
927888785 2:26735370-26735392 AGTCTCCCAGCTGCAGGGGAGGG + Intergenic
928017604 2:27672852-27672874 AATCTCCTGCCTGAAACGAAAGG + Intronic
930538930 2:52680521-52680543 AGTCTCCCAATTGCAAGGAAAGG + Intergenic
934175960 2:89581000-89581022 AGACTCCGTCCTGCAAGGTAAGG - Intergenic
934286271 2:91655362-91655384 AGACTCCATCCTGCAAGGTAAGG - Intergenic
936088808 2:109488057-109488079 GGTCTCCTGCCTGCCAGGAGGGG + Intronic
946359905 2:219213056-219213078 AGTCTCCCGCCTGCAAGGAAAGG + Exonic
948696297 2:239734720-239734742 AGTTTCCTGCTTGCCAGGAAAGG - Intergenic
948991327 2:241555958-241555980 GGTCTCCTGCCTGCAAGTACAGG + Intergenic
1178487552 21:33028292-33028314 AGTCTCCCACCCGCCAAGAAAGG - Exonic
1178920102 21:36733085-36733107 ATTCTCCTGCCTCCATGGAAGGG - Intronic
1180021844 21:45133559-45133581 TTCCTCCCGCCTGCAAGGCAGGG + Intronic
1180144784 21:45913014-45913036 AGGCTGCCCCCTGCCAGGAACGG + Intronic
1181576123 22:23796278-23796300 AGTATCCAGCCTTTAAGGAAAGG + Intronic
1183226115 22:36551030-36551052 ACTCTCCCTCCTACAAGGAGAGG - Intergenic
950772002 3:15319378-15319400 AGTCTCCCCACAGAAAGGAAGGG + Intronic
953890830 3:46750617-46750639 AGTCCCCCGCCTCCAAGGCCAGG + Intronic
955396259 3:58559851-58559873 GGGCTCCCTCCTCCAAGGAAGGG - Intergenic
959518043 3:107291493-107291515 TATCTCCCCTCTGCAAGGAAGGG - Intergenic
961101284 3:124201368-124201390 ATTGTTCCTCCTGCAAGGAAGGG - Intronic
961983405 3:131104909-131104931 AGGCTCCCAGCTGCAAGGAAAGG - Intronic
968234265 3:197022544-197022566 AGTCTCCTGCATCCACGGAAGGG + Intronic
969489389 4:7490550-7490572 CCTCTCCCTCCTTCAAGGAAAGG - Intronic
973642014 4:52912911-52912933 ATTCTCTCGCATGCTAGGAAGGG + Intronic
977263869 4:94831701-94831723 AGTCTGGGGCCTGTAAGGAACGG + Intronic
977846573 4:101773906-101773928 AGGCTCCCTACTGCAAGGAAAGG - Intronic
979067589 4:116157636-116157658 AGTCTCCTTCCTGTAAGGCAAGG - Intergenic
988064669 5:26218902-26218924 AACCTGCCGCCTGGAAGGAAAGG + Intergenic
994072943 5:95621331-95621353 AGTCGCCCGCCTGGAAGAAGAGG - Exonic
994898887 5:105744676-105744698 ACTCTCCCTCTTGCAAGGGATGG + Intergenic
995862068 5:116651462-116651484 AGTCTGCTGCCTGTAAGAAATGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1001126913 5:169027927-169027949 ACTCTCCCTCCTGCCAGTAAAGG - Intronic
1009001705 6:57724551-57724573 AGACTCCCTCTTGCAAGGAGTGG + Intergenic
1014240309 6:119010129-119010151 AGTCTGCTGCCTGGAAGAAAGGG - Intronic
1017877626 6:158537150-158537172 AGGCTCCCGCCTCCCCGGAAAGG + Intronic
1021288027 7:18806374-18806396 AGTCTCACGACCACAAGGAAAGG - Intronic
1024130779 7:46350577-46350599 AGTCTCTGGCCTGCAGGGATGGG - Intergenic
1026925437 7:74189078-74189100 AGACTCCAGACAGCAAGGAAGGG + Intronic
1028822257 7:95225948-95225970 ATTCTCCTGTCTGAAAGGAAGGG - Exonic
1030950141 7:115780769-115780791 AGTTTCCTCACTGCAAGGAATGG + Intergenic
1038395880 8:27245013-27245035 AGTCTCCAGCCAGCACAGAAAGG - Intronic
1039850496 8:41360719-41360741 AGTCTCCAGCCTGGAGGGAGTGG + Intergenic
1047941721 8:129832927-129832949 AGTCTGTGGCCTGCAAGAAATGG - Intergenic
1049767021 8:144359610-144359632 AGGCTCCAACCTGCAGGGAAGGG - Exonic
1051063517 9:13073728-13073750 AGTCTCCAGGCTGCAAGGCAGGG + Intergenic
1055456435 9:76476637-76476659 AGTCTCCTGCCTGAGAGGACAGG + Intronic
1056683602 9:88741404-88741426 AGACTGCCACCTGCAAGGCAAGG + Intergenic
1057703947 9:97384703-97384725 AGGCTCCAGCCAGGAAGGAATGG + Intergenic
1058993906 9:110280922-110280944 AGTCTCCATCCTGAAAGGAATGG + Intergenic
1060084156 9:120681267-120681289 AATCTGCCGCCTTCAAGGGAAGG - Intronic
1061430617 9:130528082-130528104 AGCCTCCCGCCTTCAAGCAGGGG + Intergenic
1062362130 9:136193183-136193205 CGTCTCCACCCTGGAAGGAAGGG + Intergenic
1187701333 X:21966970-21966992 ATTCTCCACCCTGCAAGGAAAGG - Intronic
1190215372 X:48476455-48476477 ACTGTCCCGCCTGCGGGGAAAGG + Intronic
1194673327 X:96763540-96763562 GGCCTCCCGACTGCATGGAAAGG - Intronic
1195736789 X:108019839-108019861 AGTCTTCGGCCAGCAAGGATTGG + Intergenic
1197591163 X:128411967-128411989 AGTCTAGCACCTGCAAGTAATGG - Intergenic
1197710882 X:129666310-129666332 AATCTCCTTCCTGCAGGGAAGGG + Intergenic