ID: 946359932

View in Genome Browser
Species Human (GRCh38)
Location 2:219213169-219213191
Sequence CAGAGCACTGAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 3, 3: 78, 4: 568}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946359921_946359932 15 Left 946359921 2:219213131-219213153 CCCTCCCCTGCCCAGGCTCTTTT 0: 1
1: 0
2: 5
3: 81
4: 794
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359927_946359932 4 Left 946359927 2:219213142-219213164 CCAGGCTCTTTTCCAAAAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 338
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359930_946359932 -8 Left 946359930 2:219213154-219213176 CCAAAAGCAGGGATTCAGAGCAC 0: 1
1: 0
2: 0
3: 13
4: 168
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359924_946359932 10 Left 946359924 2:219213136-219213158 CCCTGCCCAGGCTCTTTTCCAAA 0: 1
1: 0
2: 7
3: 45
4: 622
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359922_946359932 14 Left 946359922 2:219213132-219213154 CCTCCCCTGCCCAGGCTCTTTTC 0: 1
1: 1
2: 4
3: 64
4: 700
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359919_946359932 20 Left 946359919 2:219213126-219213148 CCTGCCCCTCCCCTGCCCAGGCT 0: 1
1: 5
2: 29
3: 239
4: 1924
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359918_946359932 21 Left 946359918 2:219213125-219213147 CCCTGCCCCTCCCCTGCCCAGGC 0: 1
1: 2
2: 29
3: 276
4: 2002
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359923_946359932 11 Left 946359923 2:219213135-219213157 CCCCTGCCCAGGCTCTTTTCCAA 0: 1
1: 0
2: 5
3: 45
4: 409
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359920_946359932 16 Left 946359920 2:219213130-219213152 CCCCTCCCCTGCCCAGGCTCTTT 0: 1
1: 0
2: 7
3: 87
4: 902
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359926_946359932 5 Left 946359926 2:219213141-219213163 CCCAGGCTCTTTTCCAAAAGCAG 0: 1
1: 0
2: 4
3: 24
4: 315
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568
946359925_946359932 9 Left 946359925 2:219213137-219213159 CCTGCCCAGGCTCTTTTCCAAAA 0: 1
1: 0
2: 2
3: 33
4: 281
Right 946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946359932 Original CRISPR CAGAGCACTGAGAAGCAGGA AGG Intronic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900503516 1:3017989-3018011 CAGAGCCAGAAGAAGCAGGAAGG - Intergenic
900588087 1:3443226-3443248 CAGAGCCCAGAGTTGCAGGACGG - Intergenic
900588095 1:3443263-3443285 CAGAGCCCAGAGTTGCAGGACGG - Intergenic
900588103 1:3443300-3443322 CAGAGCCCAGAGTTGCAGGACGG - Intergenic
901260009 1:7864371-7864393 CAGAGGATTGAGAGACAGGAGGG - Intergenic
901636971 1:10674990-10675012 CTGAGCACAGAAAAACAGGAGGG - Intronic
901902823 1:12380591-12380613 CAGGGGTCTGAGAAGTAGGAAGG + Intronic
902140372 1:14348737-14348759 CAAAGCCATGAGAATCAGGATGG + Intergenic
902581967 1:17413500-17413522 CAGAGCACTGATAAGCCAGGGGG + Intronic
902930277 1:19726245-19726267 CAAAGCACTGAGAGGGAGCAGGG + Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904157690 1:28498286-28498308 AAGAGCACTGAGAAGAAGAGGGG - Exonic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
904296499 1:29522623-29522645 AAGGGCCGTGAGAAGCAGGATGG - Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
905864258 1:41368157-41368179 GAGAACACTGAGAACCAGAATGG - Intronic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
906265948 1:44429614-44429636 CAGAGAGCTGAAAAGAAGGAGGG + Intronic
906860814 1:49357193-49357215 GAGGACACAGAGAAGCAGGAGGG - Intronic
907319894 1:53595576-53595598 CAGCCCCCTGGGAAGCAGGATGG - Intronic
907974997 1:59423069-59423091 CAGAGGATTGTGTAGCAGGAGGG + Intronic
908783818 1:67715576-67715598 CACAGGACTGAGAAGCTGCATGG + Intronic
909334472 1:74455633-74455655 CAAAGTCCTGAGAATCAGGAGGG + Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910433842 1:87185159-87185181 AAGAACAATGAGAAGCAGAAGGG - Intergenic
910514077 1:88037973-88037995 CAGAGCACTGAGAGGGAGCACGG + Intergenic
912822450 1:112878886-112878908 GAGAAGGCTGAGAAGCAGGAAGG - Intergenic
913149714 1:116028791-116028813 CACAGCACTGAGTAGCAGCATGG - Intronic
913272872 1:117111311-117111333 CAGAGCTGTGAGAAGGATGAAGG + Exonic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
914448628 1:147771737-147771759 CAGAGCAGAGAGTACCAGGAGGG - Intronic
915189451 1:154136544-154136566 TAGTGAACTGAGTAGCAGGAGGG + Intronic
915935270 1:160086966-160086988 CAGAGGACTGTGAAGTGGGAGGG + Intronic
915982081 1:160426507-160426529 CAGAGCTCAGAGAATCAGGCAGG - Exonic
916175567 1:162035385-162035407 GAGAGGAGTGGGAAGCAGGAGGG + Intergenic
916183292 1:162106269-162106291 GACAGCAAAGAGAAGCAGGATGG - Intronic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916271137 1:162942889-162942911 GAGAGCAGTGAGAAGCAGCATGG - Intergenic
916490420 1:165297524-165297546 CTCAACACTGAAAAGCAGGATGG + Intronic
916891646 1:169117520-169117542 CAGAGACCTGATAAGTAGGAAGG + Intronic
916911971 1:169360528-169360550 AAGAGATCTGAGAGGCAGGAAGG - Intronic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
918586539 1:186194685-186194707 CAGTGCACTTAGAAGCAAGCAGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919166769 1:193905510-193905532 GAGATGACTGAGAAGCAGGATGG + Intergenic
919320842 1:196035675-196035697 CAGACCACTGAAAAGGAAGATGG - Intergenic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920401509 1:205679519-205679541 CAGAGCTCTGAGAAGCTGCACGG + Intronic
920649216 1:207824254-207824276 CAGAGCAGTGAGGTGCAGGAGGG - Intergenic
921004799 1:211082851-211082873 AAGAGCACTGACAAGCAGCAGGG - Exonic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921358788 1:214311566-214311588 CAGAGTGCTGTCAAGCAGGAGGG - Intronic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922975532 1:229780478-229780500 CAGAGCACTGGGTGGCAGGCAGG + Intergenic
923402342 1:233627525-233627547 CAGAGCACTGGGTGGCAGGTAGG - Intronic
923549736 1:234954072-234954094 CAGAGACCTTAGAAGCAGAAAGG + Intergenic
923765473 1:236889098-236889120 CAGAGCAGTGAGGAGCTGGCAGG + Intronic
924322744 1:242865906-242865928 CAAAGCACATAGAGGCAGGAGGG - Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063288892 10:4720788-4720810 CAGAGCACTAAGAAGAATAAAGG - Intergenic
1063486861 10:6428269-6428291 CAGAGCACTGATCAACAGCATGG - Exonic
1064321553 10:14310008-14310030 CCCAGCACTGAGATGCACGAGGG - Intronic
1065500162 10:26373263-26373285 CAGAGCACTGCAAAGAAGGGTGG - Intergenic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067382905 10:45791550-45791572 CACAGCACTGAAAACAAGGAAGG - Intronic
1067789741 10:49278644-49278666 CATAGCACTGGGGAGCAGGAGGG + Intergenic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069624571 10:69859931-69859953 CAAAGCCCTGAGAAGGAAGAAGG + Intronic
1069720566 10:70547160-70547182 CTGAGAACTGAGGAGCAGGCAGG + Intronic
1070326869 10:75395460-75395482 CAGAGCCCGGCGGAGCAGGAAGG - Intergenic
1070648011 10:78214871-78214893 CAGAGCTCTGAGATACATGACGG - Intergenic
1071498924 10:86189958-86189980 CTGAGCACAGAGAAGCACGAGGG - Intronic
1071584996 10:86811456-86811478 CAGATAAATGAGAGGCAGGAAGG - Intronic
1071598003 10:86942153-86942175 CACACCCCTGAGAAGCAGGTGGG + Intronic
1072549254 10:96464858-96464880 CTGAGCTCTGAAAAGCAGAAAGG + Intronic
1073783854 10:106866610-106866632 CAGAGCACTGAGAGGGAACAAGG + Intronic
1074870329 10:117571043-117571065 CAGAGCACAGAGAAGCTTGTGGG - Intergenic
1075136602 10:119791995-119792017 CAGAGCACTGGGGAGAGGGACGG + Exonic
1075345268 10:121677387-121677409 TAGTGCTCTGAGGAGCAGGAAGG - Intergenic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1077078314 11:711105-711127 CTGAGCCCTGAGAAGCAGCCCGG - Intronic
1077737822 11:4809821-4809843 TAGAGCTCCCAGAAGCAGGAAGG - Intronic
1078100649 11:8328612-8328634 CAAAGCACTGAGAATGTGGATGG - Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078532269 11:12145864-12145886 CAGACTACTGAGAGCCAGGAAGG + Intronic
1078869557 11:15330718-15330740 CTAAGGCCTGAGAAGCAGGAGGG - Intergenic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079829079 11:25238519-25238541 AATAGCAGTGAGAAGCAGAAAGG - Intergenic
1080296344 11:30733479-30733501 TAGAGCACTCAGAAACAAGATGG - Intergenic
1080558437 11:33438807-33438829 CTGATCACAGAGAAGCAGAAAGG - Intergenic
1080666009 11:34337067-34337089 CAGTAAACTGAGAAGCAGTAGGG - Intronic
1081615625 11:44589297-44589319 GAGAGCTGTGAGCAGCAGGATGG - Intronic
1081769880 11:45643404-45643426 CTGAGCACTGGAAAGCAGGTTGG - Intergenic
1082615830 11:55357663-55357685 CAGAGCACTGAGAGGAAGCATGG + Intergenic
1082804780 11:57440878-57440900 CAGGGCAGTGAGGAGCAGAAAGG - Intergenic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1084565973 11:69929253-69929275 GGGAACACTGAGAAGGAGGATGG - Intergenic
1084792029 11:71481068-71481090 CACAGCACGGGGAAGCAGCAGGG - Intronic
1085319697 11:75566357-75566379 GAAGGCGCTGAGAAGCAGGAGGG - Exonic
1086259073 11:84916047-84916069 CAGAGGATTAAGAAGCAGGCCGG + Intronic
1086303768 11:85458805-85458827 CAAAGCACTGAGAAGAAGCATGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086497732 11:87421586-87421608 AGGAGGACAGAGAAGCAGGATGG - Intergenic
1087534062 11:99421372-99421394 CAGAGAACTGGGAAGAAGAATGG + Intronic
1087868123 11:103258634-103258656 CACAGCACTGAGTAGATGGATGG + Intronic
1088312716 11:108477019-108477041 GAGAGCACTGAGAAGATGGGAGG + Intronic
1088696258 11:112368591-112368613 CAGAGCACAGAGAATCAGGGTGG + Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089693459 11:120200948-120200970 GGGAGCACTGAGAGGCAGGTAGG + Intergenic
1089786938 11:120914520-120914542 CAGAGCACTGAGGATCAAGAAGG + Intronic
1089809536 11:121120473-121120495 GAGAGGGCTGGGAAGCAGGAAGG + Intronic
1090166067 11:124548873-124548895 GAGAACACTGAGCAGCTGGAAGG - Intergenic
1090185224 11:124734622-124734644 TAGAGCTCTGAGGAGCAGCAGGG + Intergenic
1090431958 11:126653679-126653701 CAGGGCAATGAGAAACGGGAGGG + Intronic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1091196185 11:133732742-133732764 CAGGGCTCAGAGCAGCAGGAGGG - Intergenic
1091240149 11:134046697-134046719 CAGAGCGCTGAGGAGTAGCATGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091836732 12:3591377-3591399 CCGTGCACAGAGAAGCAGGCAGG + Intronic
1092579422 12:9821765-9821787 CAGAGCATTGAGAGGCAGCATGG + Intergenic
1092623756 12:10303188-10303210 AAGAGGTCAGAGAAGCAGGACGG - Intergenic
1093065680 12:14655803-14655825 CTGAGCACTGTGAAGTAGCAGGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096596317 12:52697985-52698007 CAGACCTCAGAGAATCAGGATGG + Intronic
1098018403 12:66130515-66130537 CAGTGCACTCGGAAGCCGGAGGG + Intronic
1098199382 12:68038824-68038846 CACAGCTCTGATAAGCAGGAAGG + Intergenic
1098451367 12:70621860-70621882 CAAATGACTGAGAAGCAGGGTGG - Intronic
1099161026 12:79242038-79242060 CAGAGCATTCAGAAACAGTATGG + Intronic
1099465880 12:82987606-82987628 CAGAGCAGTGAACAGCAGGCAGG + Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101734207 12:107450787-107450809 TGGAGGACTGAGAGGCAGGAGGG + Intronic
1103185443 12:118953164-118953186 CAGAGGACTCAGAATAAGGAAGG + Intergenic
1104482879 12:129123850-129123872 CAAAGGCCTGAGAATCAGGAGGG - Intronic
1104993059 12:132637225-132637247 CTTATCACTGAGAAGTAGGAAGG - Intronic
1105284762 13:18994932-18994954 CGGAGCACCAAGAAGCAAGAAGG + Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106100339 13:26689858-26689880 CTGAGCTCTGGGAGGCAGGAAGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106417156 13:29555527-29555549 GAGAGCACCGAGAACCATGAAGG + Intronic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1107225827 13:38045874-38045896 CAGAGCACTGAGAGGGAGCATGG + Intergenic
1107594285 13:41946509-41946531 AATAGCACTGAGGAGCTGGAAGG + Intronic
1109308210 13:60663290-60663312 CACAGTGCTGAGAAGCAGAAGGG + Intergenic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1111420064 13:88000043-88000065 CAGAGCCCTGAGGAGAAGCATGG - Intergenic
1111604610 13:90520721-90520743 CAGAGCATTGAGAGGTAGCATGG + Intergenic
1112130097 13:96514050-96514072 CAGTGCGATGAGAAGCAGTAGGG + Intronic
1112438600 13:99408917-99408939 CAGGGCACTGAAGACCAGGAGGG + Intergenic
1112737163 13:102433433-102433455 CACATCACTGAGAAGCCAGAAGG + Intergenic
1113168014 13:107465449-107465471 CAGAGCACAGAGACCCAGGCAGG - Intronic
1114529665 14:23387974-23387996 TGGGGCACTGGGAAGCAGGAGGG - Intronic
1115797696 14:36957524-36957546 CATAGAACTGTGAAGCAGAAAGG - Intronic
1115875402 14:37855773-37855795 CCATGCACTGAAAAGCAGGAAGG - Intronic
1116021943 14:39471870-39471892 CAGAGCACAGAGGATCTGGAGGG - Intergenic
1116243873 14:42383016-42383038 GAGAGGAATGAGAAGCAGGCTGG - Intergenic
1117292538 14:54347562-54347584 CAGAGGACTGAGAAATGGGAAGG + Intergenic
1117317227 14:54583391-54583413 CAGTGCCCCGAGAAGCAGCAGGG + Intronic
1117448362 14:55826811-55826833 GAGTTCACTGAGAGGCAGGAAGG - Intergenic
1117482290 14:56159787-56159809 CAAAGTACTGGGAATCAGGAAGG - Intronic
1118371615 14:65141963-65141985 TAGGGGACTGAGAACCAGGAAGG - Intergenic
1118384335 14:65243275-65243297 GAGAGGACTGAGAAGTAGGCAGG + Intergenic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119076245 14:71642345-71642367 CAGAGCACAGAGAATCAGGGAGG + Intronic
1119177941 14:72583183-72583205 CAAAGGCCTGAGAAGCAGGAGGG - Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119477753 14:74940998-74941020 CAAAGCACTGAGGAGGAAGACGG + Intergenic
1119663706 14:76469037-76469059 CAGAGCACAGAAGGGCAGGAGGG - Intronic
1120106442 14:80500982-80501004 CTGAGCACTTAGAAGCAAGATGG - Intronic
1120401436 14:84037444-84037466 CTGAGCTCTGGGAAGCAAGAGGG - Intergenic
1120843677 14:89108238-89108260 AAGAGGATAGAGAAGCAGGAAGG - Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121811434 14:96894537-96894559 CACAGAACAGAGAAGCTGGAGGG - Intronic
1122122738 14:99563240-99563262 GAGTGGACGGAGAAGCAGGAGGG - Intronic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1122501352 14:102202150-102202172 GAGAGCACAGGGAAGCAGGGTGG - Intronic
1122753820 14:103961183-103961205 CATAGCACTGAGAAGAGGAATGG + Intronic
1123520944 15:21072808-21072830 CAGAGCAGCGGGAAGCAGCATGG - Intergenic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124200709 15:27676770-27676792 CTCAGCACTGAGAAGACGGACGG - Intergenic
1125117546 15:36112982-36113004 CAGAGGAGTGAGAAACAGGTTGG + Intergenic
1125355605 15:38814570-38814592 GAGAACACTTGGAAGCAGGAAGG + Intergenic
1125501475 15:40242447-40242469 CTGAGACCTGAGCAGCAGGAAGG + Intronic
1126357577 15:47812613-47812635 AAGAGAACTGAGAAGGGGGATGG + Intergenic
1126653696 15:50953480-50953502 CAGAGCAGGATGAAGCAGGATGG - Intronic
1126781555 15:52143329-52143351 CATTGCTATGAGAAGCAGGAAGG + Intronic
1127215623 15:56820475-56820497 AGGAGGCCTGAGAAGCAGGAGGG - Intronic
1127364854 15:58279249-58279271 CAGTGCTCAGAGCAGCAGGATGG - Intronic
1127882805 15:63173005-63173027 CAGACAACAGAGGAGCAGGAAGG - Intergenic
1128334964 15:66779867-66779889 CACAGCTCTGAGAAGCAGGCAGG - Intronic
1128474048 15:67981945-67981967 CACAGGACTGGGAATCAGGAAGG + Intergenic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1129246979 15:74285308-74285330 CAGAGCTTTCAGAAGCAGCATGG + Intronic
1129393929 15:75234200-75234222 CAGAGCTGAGGGAAGCAGGAGGG + Intergenic
1130036170 15:80363375-80363397 CAGAACAGTGAGGAGCAGCAGGG - Intronic
1130560639 15:84955645-84955667 CAGAGCACAGAGCCCCAGGAGGG + Intergenic
1131432779 15:92400135-92400157 CAGAGCAGTGAGAGAAAGGAAGG - Intronic
1131502026 15:92977556-92977578 CTGAGCACTCAGACGCAGGCAGG + Intronic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131997174 15:98144039-98144061 CAAAGGCCTGAGAACCAGGAGGG + Intergenic
1132104252 15:99051367-99051389 CAGGGGTCTGAGAACCAGGAGGG - Intergenic
1132195686 15:99913149-99913171 CAGAGCACTGAGGTGCAGGCTGG + Intergenic
1132882048 16:2166762-2166784 GATAGGACTGAGAAGCAGCAGGG - Intronic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133862620 16:9610422-9610444 CAGAGCTCAGAGAGGCAGGAAGG + Intergenic
1134806979 16:17134426-17134448 AGGAGAGCTGAGAAGCAGGAGGG - Intronic
1135964041 16:27021306-27021328 CACAGCAGTGAGAGGAAGGATGG - Intergenic
1136514927 16:30762350-30762372 CAGAGCCCTCACCAGCAGGAGGG - Exonic
1136859690 16:33691003-33691025 TAGAGCACAGAAAACCAGGATGG + Intergenic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1138020034 16:53470464-53470486 CTGAGCACTGAGGGGCTGGATGG - Exonic
1139963115 16:70729278-70729300 AAGAGCCCAGAGAAGCAAGAGGG + Intronic
1141273995 16:82568503-82568525 CAAGGCACTGAGCAGCAAGAAGG - Intergenic
1141523452 16:84596650-84596672 CAGTGCTCTGAGAACCAAGATGG - Intronic
1141741902 16:85899036-85899058 CAGAGCACTTCGAAGAAGGCGGG + Exonic
1142066346 16:88065179-88065201 CAGCCCACTGAGACCCAGGATGG - Intronic
1142191776 16:88721424-88721446 CATAGCACTGAGGGGCGGGAGGG + Exonic
1203121196 16_KI270728v1_random:1539182-1539204 TAGAGCACAGAAAACCAGGATGG + Intergenic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1143477014 17:7208583-7208605 TAGAGCTCTGAGAAGCTGGAGGG - Intronic
1143653494 17:8279026-8279048 GACAGCAGTGAGATGCAGGAGGG + Intergenic
1143771497 17:9171828-9171850 CAGAGCACTGGAAGGCTGGAAGG + Intronic
1143876497 17:9995060-9995082 CTGAGCACTGGGGAGCAGCAGGG + Intronic
1143923564 17:10349994-10350016 TAGAGCACAGGGCAGCAGGAAGG - Intronic
1144387801 17:14766055-14766077 TAGAGCACTGAGTATGAGGAAGG - Intergenic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146243287 17:31251229-31251251 CAGAACACAGAAGAGCAGGAAGG - Intronic
1147036957 17:37688827-37688849 AAGAGTACTGAGGAGCAGCAGGG - Intronic
1147542812 17:41375092-41375114 CAAAGGACTGAGAATCAGGAAGG - Intronic
1148528162 17:48363030-48363052 CAGAGTACTAAAAAGAAGGAAGG + Intronic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150282672 17:63938481-63938503 GAGGGCAGTGAGAAGCAGAAAGG - Intergenic
1150960488 17:69906835-69906857 CAGATCCCAGAGAAGCAGGGCGG - Intergenic
1151842043 17:76625834-76625856 AAGGGCAGTGAGCAGCAGGAGGG + Exonic
1151892720 17:76960200-76960222 CAGAGGAATGAGATACAGGAAGG - Intergenic
1151990165 17:77569708-77569730 CAGGGCCCTGGGAAGCAGGCTGG + Intergenic
1152003598 17:77662904-77662926 CACAGCCCTGAGTAGCAGGCAGG + Intergenic
1152264123 17:79283772-79283794 CAAAGCACAAAGAAACAGGATGG - Intronic
1152278175 17:79370076-79370098 CAGAGCAGGGAGCATCAGGAAGG - Intronic
1152445166 17:80338270-80338292 CACCGCACTGAGAAGGAGGTTGG + Intronic
1152753418 17:82077124-82077146 GAGAGCCGGGAGAAGCAGGAGGG + Intergenic
1152896469 17:82914217-82914239 CAGAGCACCGAGAACCCGGATGG - Intronic
1153409847 18:4781520-4781542 TAGAGCACAGAAATGCAGGATGG + Intergenic
1153424439 18:4946287-4946309 CAAAGCACTGAGAAGGAGCATGG + Intergenic
1153785460 18:8529803-8529825 CAGAGCACTGAGAAGGAACACGG + Intergenic
1153963441 18:10159562-10159584 CAGAGCACTTGGATGGAGGAGGG + Intergenic
1153978362 18:10288927-10288949 AAGAGCACAGGGAATCAGGATGG - Intergenic
1156278631 18:35610281-35610303 CAGGGCAATGAGAAGCAGCCTGG - Intronic
1156823103 18:41396396-41396418 CAAAGGCCTGAGAACCAGGAGGG + Intergenic
1156842324 18:41623754-41623776 CAGAGATGTGAGAAGCAGCATGG - Intergenic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1158396196 18:57079937-57079959 AACAGCCCTGAGAAGCAGAAGGG + Intergenic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1160783654 19:889850-889872 CAGAGCACTGCGTTGCAGGACGG + Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1161027572 19:2043563-2043585 CAGATCATTGAGAAGCAGCCAGG - Exonic
1161434846 19:4257076-4257098 CACAGCACTGGGAAGCAGCCAGG + Intronic
1162104499 19:8362214-8362236 CAGAGCACTGGCAAGGAGAAGGG - Intronic
1162206198 19:9058094-9058116 CAGAGGTCAGAGTAGCAGGAAGG + Intergenic
1162994978 19:14328909-14328931 CAGAGTGCTGACAAGAAGGAGGG + Intergenic
1163682551 19:18691635-18691657 CAGAGCCCCCAGAAGCTGGAAGG + Intronic
1163724248 19:18913512-18913534 CACAGAACTGAGGAGCAAGAGGG + Intronic
1163785215 19:19271558-19271580 CAGAGCACTGACACCCAGGCTGG + Intronic
1164215215 19:23138709-23138731 GAGAGCTCTGAGATTCAGGAAGG - Intronic
1164239537 19:23372443-23372465 GAGAGCTCTGAGATCCAGGATGG + Intronic
1164253195 19:23503027-23503049 AAGAGCTCTGAGATCCAGGAAGG + Intergenic
1164436565 19:28235702-28235724 CACAGCACTGAGAAGCTCAAAGG - Intergenic
1164622680 19:29706564-29706586 CTGAGCACTGAGATGGAGGTGGG + Intronic
1164798171 19:31053385-31053407 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1164916066 19:32053199-32053221 GAGAGCTGTGAGAAGCAGGTTGG - Intergenic
1166090653 19:40506552-40506574 CAGTGCCCTGAGTGGCAGGATGG + Intronic
1166157454 19:40924569-40924591 CAGAGCATAGTGAAGCATGATGG + Intergenic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167022376 19:46887640-46887662 TAGAGCACTGAGTTGAAGGAGGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
925045086 2:766890-766912 CAGGGCACTGAGGATCAGGGAGG + Intergenic
925128089 2:1476090-1476112 CTGGGCACTGAGGAGTAGGAAGG - Intronic
925542324 2:4979303-4979325 CTGGGCTCAGAGAAGCAGGAAGG - Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925701938 2:6647566-6647588 CAGAAAACTGAGACACAGGAAGG - Intergenic
925819690 2:7787837-7787859 CAGATGACTGAGAAGCAGCCAGG + Intergenic
925827919 2:7868508-7868530 CAGAGCTCAGAGAAGCTGAAGGG - Intergenic
925974791 2:9134494-9134516 CAGAGGATTGAGAAGCGAGAGGG + Intergenic
926149137 2:10415092-10415114 CAGAGCACTGAGACTCAAGCTGG - Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926578001 2:14603879-14603901 CAGAGCATTTAGAAGCACGTGGG + Intergenic
926925168 2:17980116-17980138 CATAGCCCTGAGAAGGATGATGG - Intronic
927066915 2:19480917-19480939 CAGAGCACTTGGAAGAAGAAGGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927466941 2:23343973-23343995 CACAGCTCTGAGCATCAGGATGG - Intergenic
927872711 2:26633774-26633796 CACAGCCCAGAGAGGCAGGAGGG + Intronic
928514616 2:32034078-32034100 CAGAGCACTGAAGAGAAGAAAGG + Intronic
928738036 2:34315434-34315456 CAGAGGATTGAGAAACAGGAGGG - Intergenic
928844368 2:35651988-35652010 CAGAGGCCTGAGAAGCAGGAGGG - Intergenic
929441927 2:41971522-41971544 CAGAGCACTGAGGATCATCAAGG + Intergenic
929539773 2:42810704-42810726 CAGAGCAGTTAGAAACAAGAAGG - Intergenic
929951370 2:46412082-46412104 GAGAGCCCTGAGAAGGAGGTTGG - Intergenic
931007412 2:57867653-57867675 TACAGCAGTGAGAAGCAGTAGGG + Intergenic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
933021849 2:77204191-77204213 CATAGCACTGAGTAGCTGGGTGG + Intronic
933438322 2:82277344-82277366 CAGAGCATTGAGAGGGAGCACGG - Intergenic
933639053 2:84740448-84740470 CAGGGCACTGAGAAGAAGGGTGG + Intronic
933727597 2:85435558-85435580 CCGAGCAGTGGGGAGCAGGAGGG + Intronic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
936108805 2:109648234-109648256 CAGAGAACTCAAAGGCAGGAAGG + Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
937284759 2:120743293-120743315 CAAAGGACAAAGAAGCAGGAAGG - Intronic
937801861 2:126090017-126090039 CAGAACACTTAGACACAGGAAGG + Intergenic
938576015 2:132605529-132605551 CAGGCCAGCGAGAAGCAGGAAGG - Intronic
939323498 2:140655598-140655620 CAGAGCACAGAGAAGTAGCTAGG + Intronic
939401994 2:141706526-141706548 CAGAGGACTTGGAAGCAGGTTGG - Intronic
940728079 2:157358185-157358207 CAGAGAAGTGAGAAAAAGGATGG + Intergenic
941344231 2:164348098-164348120 CAGAGCACTGAGAAGAAACATGG - Intergenic
941747569 2:169103375-169103397 CAGAGCCCTGAGCAGCTGGGAGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942644532 2:178095934-178095956 CAGAGCACAGAGCAGCAGTGGGG + Intronic
943671878 2:190671683-190671705 CATGGAACTGAGAAGCGGGAAGG - Intronic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
943768405 2:191688423-191688445 GAGAGCACTAGGAAGGAGGAAGG - Intronic
943799150 2:192035888-192035910 CTGAGCACTGAGAAGAATAATGG - Intronic
945672653 2:212820682-212820704 CAGAGGATTGAGAGACAGGAAGG - Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946130015 2:217599478-217599500 AAGAGCTCTGGGAACCAGGATGG + Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946367693 2:219259830-219259852 CAGTGCTGTGAGAAGGAGGATGG - Intronic
946431923 2:219630810-219630832 CAGGGCACTGATAAGATGGAAGG - Intronic
946700271 2:222405355-222405377 CAAAGGCCTGAGAACCAGGAAGG - Intergenic
947047179 2:226001085-226001107 CAGAGCACTAAGTTACAGGAAGG + Intergenic
948205994 2:236163282-236163304 CAGCGCCCCGAGGAGCAGGAGGG + Intergenic
948916829 2:241038779-241038801 GAGAGCACTGAGCAAGAGGAAGG - Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1172068904 20:32241936-32241958 AAGAGCACTGAGAAGCAGTGAGG + Intergenic
1172457674 20:35090792-35090814 CAGAACACTGATTATCAGGATGG + Intronic
1172608687 20:36233092-36233114 CAGAGCACTCAGCACTAGGAAGG + Intergenic
1172955580 20:38755827-38755849 CAGAGCAGTCACAAACAGGAAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174052525 20:47777009-47777031 CCCAGCACTGAGAACCAGGGTGG - Intronic
1174734617 20:52954211-52954233 ATGAGCACTGAGGAGCAGGAGGG - Intergenic
1175213365 20:57375673-57375695 CAGAGCACAGGGAACCAAGAGGG - Intronic
1175408633 20:58751775-58751797 CAGGGCACCGAGATCCAGGAAGG + Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1178339365 21:31773037-31773059 TAGAGGCCTGAGAAGCAGGGAGG - Intergenic
1178976746 21:37227129-37227151 GTGAGCGCTCAGAAGCAGGAAGG - Intronic
1179050488 21:37884903-37884925 CAGAAGGTTGAGAAGCAGGAGGG - Intronic
1179111234 21:38447197-38447219 CACGGCACTGAGAATCAGCAAGG + Intronic
1180015820 21:45082938-45082960 CAGGGCTCTGAGTGGCAGGAAGG - Intronic
1181358160 22:22314316-22314338 CAGAGCACAGAAAACCAGGACGG - Intergenic
1181520545 22:23446920-23446942 CAGAGCTCTGAGAACCAGGGTGG + Intergenic
1181602436 22:23960466-23960488 CACAGCCCTGAGAAACAGCAAGG + Intronic
1181606077 22:23980841-23980863 CACAGCCCTGAGAAACAGCAAGG - Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182088836 22:27580335-27580357 CAAAGCCCAGAGAAGCAGGGAGG - Intergenic
1182263828 22:29096486-29096508 GAGAGCAGTGAGAGCCAGGAGGG + Intronic
1182768725 22:32777949-32777971 CATACCTCTGAGACGCAGGATGG - Intronic
1183589263 22:38770381-38770403 CAGTGCAGTGAGAAGCAAGGGGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184735205 22:46393949-46393971 CAGAGCACGGGGGAGCAGCAAGG + Intronic
1184747795 22:46466079-46466101 CAGAGCACCTCGGAGCAGGAAGG + Intronic
949967009 3:9365403-9365425 CAGAGCAATGAAAATCAGAAAGG - Intronic
950185032 3:10939596-10939618 GAGAGAACTGAGAGGGAGGATGG - Exonic
950495781 3:13333493-13333515 CAGAGCACAGAGGAGCTGGGAGG - Intronic
950600916 3:14035054-14035076 CAGAGCATTGAGAGGGAGCATGG - Intronic
950684098 3:14604065-14604087 CACAGCCCTGAAAAGGAGGACGG + Intergenic
951197132 3:19836642-19836664 CAGAGCACTGAGAAGGAACATGG + Intergenic
951268826 3:20601651-20601673 CAGAGCACTGAAAGGGAGCATGG - Intergenic
951278021 3:20713206-20713228 CAGAGATCTGAGAAGGAGGTTGG + Intergenic
951948758 3:28174040-28174062 CAGAACACTGAGAAGTTGAATGG - Intergenic
952416098 3:33092764-33092786 CAAACCACTCTGAAGCAGGATGG + Exonic
952441237 3:33331496-33331518 CAGAGCCCTGAGAAGAAACAGGG - Intronic
953139080 3:40210826-40210848 CAGAGCACTGACAATGGGGAGGG - Intronic
953405837 3:42659382-42659404 GAGAGCTCTGAGGAGGAGGAGGG + Exonic
953430663 3:42837154-42837176 CAAAGGCCTGAGAAGCAGGGGGG + Intronic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
954293122 3:49660239-49660261 CAGAGCTTTGGGAAGCAGGAGGG - Intronic
954324583 3:49856436-49856458 CAGAGCACGGATAGGCATGATGG + Exonic
955097436 3:55813502-55813524 AAGATCACTGAGAAGCAGTGTGG - Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955535087 3:59915085-59915107 CAGAACTGTGAGAAGCAGGTAGG + Intronic
955949244 3:64225532-64225554 CTCAGCACTGGGCAGCAGGATGG - Intronic
957318511 3:78599166-78599188 CAGGGCTCTGAGAAGCGGGAAGG + Intronic
958756661 3:98257845-98257867 CAGAGAGTTAAGAAGCAGGAGGG - Intergenic
959520112 3:107316146-107316168 CAGAGCATTGAGAGGGAGCATGG - Intergenic
960519483 3:118638581-118638603 CAGAGCCCTGTGGAGCTGGAAGG + Intergenic
960936885 3:122909988-122910010 CAGAGCTCTCTGAAGCCGGATGG + Exonic
961041040 3:123678492-123678514 CTGAGCACTGACAAGCATGAGGG - Intronic
961096069 3:124157963-124157985 CAGAGCACTGTTAAGGAGAAAGG + Intronic
961491752 3:127261271-127261293 AAGAGCAGGGAGGAGCAGGAGGG - Intergenic
961551007 3:127670739-127670761 CTTAGCAGAGAGAAGCAGGAGGG - Intronic
961570085 3:127791352-127791374 CAGAGAGCTTTGAAGCAGGATGG - Intronic
962051625 3:131821811-131821833 CAGAGGTCTGGGAAGCAGGAAGG - Intronic
963226349 3:142866364-142866386 CAGAGACCTGAGAACCAGGAGGG - Intronic
963556488 3:146795817-146795839 CAAAGGCCTGAGAACCAGGATGG + Intergenic
963828072 3:149977051-149977073 CTGAGCATTGTGGAGCAGGAGGG + Intronic
964191074 3:154001603-154001625 CAGAACACTGTGAAGCATGGTGG + Intergenic
965321000 3:167251078-167251100 CAGGCCACTGACCAGCAGGATGG + Intronic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
967177188 3:186871805-186871827 CACAGCCCTGAGCAGAAGGAAGG - Intergenic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
969247342 4:5944293-5944315 CAGAGGACTGAGGGGCAAGAAGG - Intronic
969305154 4:6322069-6322091 AGGAGAACTGAGACGCAGGATGG - Exonic
969314407 4:6372812-6372834 CAGACCACGGAGGATCAGGATGG - Intronic
969725947 4:8918123-8918145 CAGTGCCCAGAGAAGCAGGCAGG + Intergenic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971189708 4:24415629-24415651 CAGAACACTGAGAAAGAAGAGGG + Intergenic
974003421 4:56532789-56532811 CAGAGAACTGAGAAGCCAAATGG - Intronic
974157450 4:58092651-58092673 CAGTGCTCTAAGAAACAGGAAGG + Intergenic
974184534 4:58429804-58429826 CAGATCATTGAGAAGCATCATGG - Intergenic
974627814 4:64446248-64446270 CAGAGAACTGGGAATCATGATGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975404192 4:73969803-73969825 CAGAGTGCTGAGAAGGAGCATGG + Intergenic
975716622 4:77211188-77211210 AAGAGCACTGAAAATCAAGATGG + Intronic
976054590 4:81048643-81048665 TAGATCACTGAGAAACATGATGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976629508 4:87222039-87222061 CAAAGAATTGAGAGGCAGGAGGG - Intronic
976648283 4:87408243-87408265 CTGAGCACTGTGAAGAACGAGGG - Intergenic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
977342888 4:95782264-95782286 CAGAGGAGTGAGAAGAAAGATGG - Intergenic
977509112 4:97938747-97938769 GAGAGCAATGAAAAGCAGGGTGG - Intronic
977735349 4:100408610-100408632 CAGAGCACTGAGGGGAAGCATGG - Intronic
977971628 4:103219280-103219302 CAGAGCATAGAGAGGCAGCATGG + Intergenic
978208320 4:106105510-106105532 CAGAGCACTGAGAGGGAACATGG + Intronic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
979500774 4:121437204-121437226 GAGAGAACTGAGAAGGAGAAAGG - Intergenic
980334331 4:131450796-131450818 CAGAGCACTGGGAAGCTGTAGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980965599 4:139517823-139517845 CAGGGCCCTGAGACGGAGGAGGG - Intronic
981279936 4:142945913-142945935 CAGAACACTGAGAAGAATGTGGG + Intergenic
981686212 4:147457794-147457816 CAGTGCACTGGGTAGCAGGCAGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984725266 4:183013999-183014021 CAGTGCACTGAGACGGAGGATGG - Intergenic
984749582 4:183258800-183258822 CAGAGCAGTAAGCAGCAGAATGG - Intronic
984889961 4:184482943-184482965 CAGAGGTCTGGGAAGCAAGAGGG + Intergenic
985291002 4:188387700-188387722 CAGAGAACTGAGAGACTGGAAGG + Intergenic
986496827 5:8350867-8350889 CAGCCCACAGAGAAGCAGGGAGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
987088524 5:14490502-14490524 CAGACCACTGAGCTGCAGGAAGG - Intronic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988110406 5:26812712-26812734 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989335240 5:40308619-40308641 CAGAGCCCTGAGAAGGAAAAAGG + Intergenic
989464485 5:41739168-41739190 CTTAGGACTCAGAAGCAGGAAGG - Intronic
989682674 5:44047104-44047126 GAGAGCAAGGAAAAGCAGGATGG - Intergenic
989741606 5:44779846-44779868 CAGAGGACTAGGAAGCTGGATGG + Intergenic
991034885 5:62119282-62119304 TACAGGCCTGAGAAGCAGGAAGG + Intergenic
991479707 5:67064245-67064267 CAGAAACCTGAGATGCAGGAGGG + Intronic
991940153 5:71843043-71843065 CAGAGCACTGAGGAAAAAGAAGG - Intergenic
993280797 5:85921709-85921731 CAGAGCACTGAGAAAGAGCAAGG + Intergenic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995366343 5:111365645-111365667 CATAGCAATGAGGAGCAAGAAGG + Intronic
995531222 5:113093764-113093786 CAGATGAGTGACAAGCAGGAAGG + Intronic
995808158 5:116077486-116077508 CAGACCTCTGGGAGGCAGGACGG + Intergenic
996112452 5:119581794-119581816 CAGCGCACTGGGATGCATGAGGG + Intronic
997065837 5:130557249-130557271 CAGAGCACTGAGAGGGATCATGG + Intergenic
997389989 5:133506749-133506771 CTGAGCACTGAGAGCCAAGATGG - Intronic
997415447 5:133724376-133724398 CAGAGCACAGAAACCCAGGATGG - Intergenic
997434134 5:133862024-133862046 TGTAGAACTGAGAAGCAGGAGGG + Intergenic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
998064751 5:139148896-139148918 CTGAGCAGTGAGACTCAGGATGG - Intronic
999331406 5:150676042-150676064 AAGAGCACTGAAAATCAGGGGGG - Intronic
1000018088 5:157296104-157296126 CACAGAACTGAGAAAAAGGAAGG + Intronic
1000614348 5:163411210-163411232 CAGAGGACGGAGAAGCAGTGTGG + Intergenic
1000698713 5:164421776-164421798 CAGAGCACTGAGAGGGAACATGG - Intergenic
1001294330 5:170488620-170488642 CAGAGCTCCGAGAAGCAAGCAGG + Intronic
1001690016 5:173625945-173625967 CAGAGCACTGAAATGGAGGTAGG - Intergenic
1002187232 5:177460026-177460048 CAGCACACTGAGAAGCGGAACGG + Intronic
1002462038 5:179378755-179378777 CAGGGATCTGAGAAGCAGGCAGG - Intergenic
1002680022 5:180954514-180954536 GACAGCAGTGGGAAGCAGGATGG + Intergenic
1002770935 6:290673-290695 CAGGTGACTGAGAAGCAGGCGGG + Intergenic
1003005811 6:2380491-2380513 CAGCCCATTGAGAAGCAGGAGGG - Intergenic
1003803769 6:9702120-9702142 CAGTTCACTGAGAATCAGCAGGG + Intronic
1005658175 6:27965390-27965412 CAGAGCCCAGAGAAGCAGAGAGG - Intergenic
1005849452 6:29810369-29810391 TACTGCACAGAGAAGCAGGATGG - Intergenic
1006171387 6:32095411-32095433 CAGATCTCTGAGGAGCAGGTTGG - Intronic
1006847156 6:37070578-37070600 CAGAGCACTGAGGGGAAGGCTGG - Intergenic
1007021231 6:38523499-38523521 CAGAGCTCTCTGAAACAGGAGGG - Intronic
1007665912 6:43512868-43512890 CATAGCCCTGGGAAGGAGGATGG + Exonic
1007703021 6:43775278-43775300 GAGACCACTGGGAAGCTGGAAGG - Intronic
1008167025 6:48151185-48151207 CAGAGCACAGAGAGGAAGCATGG + Intergenic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1011145334 6:84208409-84208431 CATCACACTGAGAAACAGGATGG + Intronic
1011995265 6:93578874-93578896 TTGAGCACTCAGAAGCGGGAGGG - Intergenic
1012231718 6:96768259-96768281 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1012572341 6:100744267-100744289 TAGAGCACTGGGAAGGAGAATGG + Intronic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012926439 6:105272876-105272898 CGCAGCACTGAGAAGCAGGCAGG - Intergenic
1012940289 6:105408176-105408198 CAGAAGACTGAGAAGCAATAGGG + Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013480376 6:110547821-110547843 CAAAGAAATTAGAAGCAGGAAGG - Intergenic
1013837047 6:114345010-114345032 AAGATGACTGAGAAGGAGGATGG + Intergenic
1014588583 6:123232507-123232529 AACAGCTCTGAGAAGCAGAAAGG + Intronic
1015197355 6:130537755-130537777 CAGAGAACTGAGAAGGAACATGG + Intergenic
1015291947 6:131547458-131547480 CATAGAACTGAGAAGTATGAAGG + Intergenic
1016157446 6:140829376-140829398 CAGATCACTGAGAAACAAAAAGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017658275 6:156650240-156650262 CAGGACACGGAGAAGCTGGAGGG - Intergenic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018692960 6:166363795-166363817 CACAGCACTGTGGAGCAGGCTGG - Intergenic
1019032332 6:169024200-169024222 CAGTGCACGGAGGAGCAGGGGGG + Intergenic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1019406570 7:887162-887184 CAGAGCACAGCGAGGAAGGAAGG - Intronic
1019532647 7:1511358-1511380 CACCGCACTGAGACTCAGGATGG + Intergenic
1019536699 7:1533206-1533228 CACAGTGCGGAGAAGCAGGAAGG - Intronic
1019590698 7:1829322-1829344 CAGAGCTCTGAGAACCAGGGTGG - Intronic
1019709233 7:2510795-2510817 CATGGAACTGAGATGCAGGAAGG + Intergenic
1020019056 7:4851326-4851348 AAGGACTCTGAGAAGCAGGATGG + Intronic
1020513856 7:9091393-9091415 CAGAGCACTGTGACGGAGCATGG + Intergenic
1021710455 7:23411039-23411061 CAGGCCACTGAGAAGAAGAAAGG + Intronic
1022041271 7:26583804-26583826 GTGAGCACTGCAAAGCAGGACGG - Intergenic
1022237090 7:28472790-28472812 CAGAGCACAGAGAAGCACTGAGG - Intronic
1024002493 7:45199882-45199904 GAGAGCCCTGAGAAGAAGGAGGG - Intergenic
1024595530 7:50932394-50932416 CAGATCACTGTGAAACAGGCTGG + Intergenic
1028053925 7:86220391-86220413 CAGAGCACTGAGAGGGAGCATGG + Intergenic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1028930055 7:96403082-96403104 CAAAGGCCTGAGAACCAGGAGGG - Intergenic
1032854744 7:135825034-135825056 CAGAGCTCAGAGAAGCAGCAGGG + Intergenic
1032943394 7:136822321-136822343 CACAACTCTGGGAAGCAGGAAGG + Intergenic
1034855912 7:154547160-154547182 CTGACCACTGATAACCAGGACGG + Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1036222478 8:6932094-6932116 CAAAGCACTGAGAGGCTGGGAGG + Intergenic
1036561774 8:9904843-9904865 AAGAGCACTGAGGAGGAGAAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036672794 8:10804180-10804202 GAGCGCAGTGAGAGGCAGGATGG + Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037682213 8:21106859-21106881 CAGAGGGCTGAGAAGGAGCAGGG + Intergenic
1037780432 8:21864754-21864776 CAGAGCAGTGGGAAGAAGGTGGG + Intergenic
1038050674 8:23807576-23807598 GAAAGCAAAGAGAAGCAGGAAGG + Intergenic
1038133263 8:24758269-24758291 CAGAGCACAGAAACCCAGGATGG + Intergenic
1038227262 8:25669007-25669029 CAGAGTTCTCAGAAGCAGCATGG + Intergenic
1038233490 8:25728662-25728684 CAGAGCACTGAGAGGGAACATGG - Intergenic
1038440124 8:27565694-27565716 CAGAGCACCGACATGCAGCAGGG - Intergenic
1038707688 8:29910199-29910221 CACAGCAGTGTGTAGCAGGATGG - Intergenic
1038772321 8:30494508-30494530 CAGAGGACTGAGACACAGAAAGG + Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1040513043 8:48112201-48112223 AAGAACGCTGAGAAGCAGGATGG - Intergenic
1040661785 8:49583044-49583066 TTGAGCACTGACAAGCATGACGG + Intergenic
1041165794 8:55090995-55091017 AGGAGCACCCAGAAGCAGGAGGG + Intergenic
1041999028 8:64100014-64100036 CTGAGCACTGGAAACCAGGAGGG + Intergenic
1042515783 8:69657418-69657440 CACAGCACTGACAATGAGGATGG - Intronic
1042813927 8:72857223-72857245 GAGAGCTTTTAGAAGCAGGATGG + Intronic
1043280992 8:78465966-78465988 CAGAGCACTGAGAGGGAACATGG + Intergenic
1043296643 8:78671737-78671759 CAGAGAACTGAGAACCTGAAAGG - Intronic
1043400317 8:79877997-79878019 CAGATGGCTGAGAAGCTGGAAGG - Intergenic
1043524423 8:81081071-81081093 AAGAACACTGAGACGCAGGGAGG - Intronic
1043849707 8:85202288-85202310 CAGAGCACTGAGAAGAAAAAAGG - Intronic
1044751611 8:95421999-95422021 AAGAACTCTGAGAAGCAGAAGGG - Intergenic
1045375451 8:101569058-101569080 CACAGAAATGAGAGGCAGGAAGG + Intronic
1046255618 8:111693622-111693644 CAGAGCACTGAGAGGAAGCATGG - Intergenic
1046419306 8:113958993-113959015 CAGATCACTGAGAAGCAAAGTGG - Intergenic
1047381135 8:124364354-124364376 GAGAGCACTGAGGAGGAGGGAGG + Intronic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1049298374 8:141855822-141855844 AAGAGAACTGGGAACCAGGAAGG - Intergenic
1049516997 8:143065205-143065227 CAGAGTACAGGGAAGCAGCAGGG - Intergenic
1049628405 8:143637050-143637072 CAGAGCCCTGAGCAGCATGCCGG + Intronic
1050005397 9:1124410-1124432 AAGAACACTGAGACACAGGAGGG + Intergenic
1050348185 9:4714489-4714511 CAGTGAATTTAGAAGCAGGAGGG - Intronic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051517739 9:17949596-17949618 CATAGCACTGAGAACTAGGCTGG - Intergenic
1051823562 9:21194090-21194112 CATAGCATTGAGAAGGAGCACGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051975556 9:22943190-22943212 GAGAGCACGGAAAAGCAGGGCGG - Intergenic
1052094540 9:24368934-24368956 CAGAGCACTGAGAGGGAACATGG - Intergenic
1052173985 9:25434314-25434336 CACACCATTGAGAACCAGGAAGG + Intergenic
1052882399 9:33611125-33611147 CTGAGCTCTGAAGAGCAGGAGGG + Intergenic
1052955954 9:34253493-34253515 CAGACCCCTGAGAGGCAGGGTGG + Exonic
1053493886 9:38534284-38534306 CTGAGCTCTGAAGAGCAGGAGGG + Intergenic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055343447 9:75309351-75309373 GAGAGCAAAGAAAAGCAGGATGG - Intergenic
1055373261 9:75623716-75623738 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1055500811 9:76900769-76900791 CTGAGCAGTGAGAAGAATGAGGG - Intronic
1055695689 9:78881753-78881775 CAGAGCACTGAGCACAATGATGG + Intergenic
1055780482 9:79815757-79815779 CAGAGAACTGTGAAGAATGAAGG + Intergenic
1056737187 9:89219971-89219993 CAGAGCAATGAAAAGCCAGAGGG + Intergenic
1056943950 9:90977909-90977931 CAGAGCACAGCAGAGCAGGAGGG + Intergenic
1057164694 9:92916436-92916458 CAGGGCTCAGACAAGCAGGAGGG + Intergenic
1057226407 9:93295645-93295667 CAGAGCACTGTGATGCAACAGGG + Intronic
1057485848 9:95483531-95483553 CAGGGCGCTGAGAGACAGGAAGG - Intronic
1057674631 9:97129129-97129151 CTGAGCTCTGAAGAGCAGGAGGG + Intergenic
1057719026 9:97517693-97517715 CAGAGCCCAGAGAAACAGGTGGG + Intronic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1058056484 9:100454246-100454268 CAGAGAGCTAAGAAGCATGAAGG + Intronic
1058135379 9:101301913-101301935 CACAGCACTGAGAAGAGGCAAGG - Intronic
1058846585 9:108966486-108966508 GAGAGCACTGAGGGGCACGAGGG - Intronic
1058915524 9:109560834-109560856 CAGAGCACAGGCAAGCAGGAGGG - Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059441902 9:114312528-114312550 CTGAGCTTTGAGAAGCAGCACGG - Intergenic
1059926629 9:119216214-119216236 CAGAGCTTTGATAAGCAGGAGGG + Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1061991874 9:134163612-134163634 CGGAGCCCTGAGACGCAGGGAGG - Intergenic
1185724420 X:2407964-2407986 CAGAGCATTGAGAATCTAGATGG + Intronic
1185758889 X:2674084-2674106 CAGAGCCCTGAGAAGGAGAAGGG - Intergenic
1187802131 X:23075659-23075681 CTGAGCGCTGGGAAGCCGGAAGG + Intergenic
1188601542 X:31972146-31972168 CAGAGAGTTGGGAAGCAGGAAGG + Intronic
1188717454 X:33477221-33477243 CAGAGCACTAAGAGGGAGCATGG + Intergenic
1188791839 X:34414625-34414647 CAGAGCATTGAGAGGGAGCAAGG + Intergenic
1189773806 X:44452115-44452137 AAGAACACTGAGATGCAGGAAGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190335193 X:49257797-49257819 CAGAACAGTGAGGATCAGGATGG - Intronic
1190449779 X:50567212-50567234 CACAGAAGTGAGAAGCAGCAGGG + Intergenic
1191611690 X:63122117-63122139 CATATCACTGAGAAGCCTGAGGG + Intergenic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1192240298 X:69323064-69323086 CAGAGCAAGGAAAGGCAGGAGGG + Intergenic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1192696549 X:73422236-73422258 CAGAGCATTGAGAAGAAACATGG - Intergenic
1192756392 X:74050278-74050300 CAGAGCACTTAGAAGAAGCATGG + Intergenic
1192866010 X:75132602-75132624 CAAAGCACTGAGAGGGAGCATGG + Intronic
1192891986 X:75399727-75399749 CAGAGCACTGAGAGGAAATATGG + Intronic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193024537 X:76831198-76831220 CAGAGCGCAGATAATCAGGAAGG + Intergenic
1193190456 X:78564041-78564063 TAGAGCAAGGAAAAGCAGGATGG - Intergenic
1193440455 X:81534812-81534834 CAGAGCACTGAGAGGGTGCAGGG - Intergenic
1194040624 X:88938137-88938159 CAGAGCACTGAGAGGGAGCATGG - Intergenic
1194177145 X:90664990-90665012 GAGAGCAAGGAAAAGCAGGATGG + Intergenic
1194508368 X:94761392-94761414 CAGATAATTGAGAAACAGGATGG + Intergenic
1194773351 X:97931943-97931965 CAGTACTGTGAGAAGCAGGAGGG + Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1199182348 X:144873251-144873273 CAGAGCACTGAGAGGAAGCATGG - Intergenic
1199559781 X:149150657-149150679 CAGAGCACTGAGAGGGAGCATGG - Intergenic
1199794748 X:151183287-151183309 CACAGGAGTGAGAGGCAGGAGGG + Intergenic
1199848753 X:151710413-151710435 CACAGCCCTGAGAAGCTGCATGG - Intergenic
1200252257 X:154559876-154559898 CAGAGCTCTGGGCAGCAGCAGGG + Intronic
1200265511 X:154644540-154644562 CAGAGCTCTGGGCAGCAGCAGGG - Intergenic