ID: 946360366

View in Genome Browser
Species Human (GRCh38)
Location 2:219216037-219216059
Sequence TCCGCAGCACCTCCCCTGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946360362_946360366 -10 Left 946360362 2:219216024-219216046 CCCCGATCCGCGATCCGCAGCAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG 0: 1
1: 0
2: 1
3: 13
4: 164
946360360_946360366 9 Left 946360360 2:219216005-219216027 CCCTGTGACACTGGATGTGCCCC 0: 1
1: 0
2: 1
3: 11
4: 136
Right 946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG 0: 1
1: 0
2: 1
3: 13
4: 164
946360361_946360366 8 Left 946360361 2:219216006-219216028 CCTGTGACACTGGATGTGCCCCG 0: 1
1: 0
2: 1
3: 12
4: 72
Right 946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG 0: 1
1: 0
2: 1
3: 13
4: 164
946360358_946360366 18 Left 946360358 2:219215996-219216018 CCTGAGCAGCCCTGTGACACTGG 0: 1
1: 0
2: 1
3: 28
4: 299
Right 946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG 0: 1
1: 0
2: 1
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946360366 Original CRISPR TCCGCAGCACCTCCCCTGTG CGG Exonic
900101650 1:964598-964620 CCCGCAGCACATCCCCACTGCGG - Intronic
900322888 1:2093755-2093777 TACACAGCACGTCCTCTGTGAGG - Intronic
901405329 1:9041309-9041331 TCCTCACCACCTCCCCCATGGGG + Intronic
903287499 1:22285997-22286019 TCACCAGCAGCTCCCCTCTGGGG - Intergenic
904093756 1:27962034-27962056 CCTCCAGCCCCTCCCCTGTGTGG + Intronic
904772122 1:32886380-32886402 CCCGGAGCCCCTCCCCTGGGGGG - Intronic
906158068 1:43625787-43625809 TCTGCAGGACCTGGCCTGTGTGG + Intergenic
909982265 1:82116781-82116803 TCCCCTGCACCTCCCCTGGGAGG - Intergenic
910275431 1:85444591-85444613 TTCTCAGGACCTACCCTGTGGGG - Intronic
912373052 1:109188378-109188400 TCTGCAGCACATCGACTGTGTGG + Intronic
915346995 1:155202613-155202635 TCCCCAGCTCCTTCCCTGTATGG + Intronic
916608594 1:166367485-166367507 TCCCCAGCACCTTACCTTTGAGG + Intergenic
922653576 1:227361550-227361572 TCTGCACCACCTCCACTGGGAGG - Intergenic
1063520598 10:6737345-6737367 TTTGCAGTTCCTCCCCTGTGGGG + Intergenic
1067043938 10:42974179-42974201 TCCTCAGCACATCCCCTGCCAGG - Intergenic
1067794194 10:49308873-49308895 TCCTCAGCATCTCCCATGTGGGG - Intronic
1069620270 10:69833204-69833226 CCCTTAGCACCTGCCCTGTGAGG + Intronic
1071085328 10:81862818-81862840 TCCCTAGCCCCTGCCCTGTGGGG + Intergenic
1073426442 10:103458191-103458213 TCCGCTGCATCTCCCAGGTGAGG - Exonic
1075775639 10:124984260-124984282 TTCTCACCACCTCCCCTGTCTGG - Intronic
1076994803 11:292670-292692 CACGCAGCACCTCACCTGGGTGG - Exonic
1077002734 11:332733-332755 TCTCCAGCACCCACCCTGTGCGG + Intergenic
1079089771 11:17472719-17472741 TCAGCAGCCCCTCCTGTGTGTGG - Intronic
1079241017 11:18722027-18722049 TCCTCACGACCTCCTCTGTGGGG + Exonic
1080683391 11:34496181-34496203 CCAGCAACACCTCCCCGGTGTGG - Intronic
1083376778 11:62229943-62229965 TCTGCATCATCTCCCCCGTGAGG - Intergenic
1083565869 11:63715692-63715714 TAAGCTGAACCTCCCCTGTGGGG + Intronic
1084409387 11:68997576-68997598 TCCGTGTCACCTGCCCTGTGAGG + Intergenic
1084623737 11:70292342-70292364 TCCACTCCGCCTCCCCTGTGTGG + Intronic
1091219610 11:133922315-133922337 TGAGCAGCTCCTTCCCTGTGCGG - Intronic
1091406219 12:211120-211142 CCCGCAGCCCCTCACCTCTGAGG + Intronic
1099973510 12:89524592-89524614 TCCGCCGCCCTTCCCCTGCGTGG - Exonic
1101398916 12:104371717-104371739 ATAGCAGCACCTCCCTTGTGTGG + Intergenic
1102595934 12:113992621-113992643 TCAACAGCACATCCCCTATGTGG - Intergenic
1103014542 12:117483783-117483805 TCAGCAGCAGCTACCCTTTGCGG + Intronic
1105508827 13:21034412-21034434 TCCCCAACACCTCCCCGGTCAGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1108690060 13:52851502-52851524 TCCGCAGCAACTCCCCGGGAAGG + Intergenic
1109220672 13:59638071-59638093 TCCTCAGAACATCCCCGGTGGGG + Intergenic
1118822404 14:69353908-69353930 TCCGCAGCACCTGCTCTGGAGGG + Exonic
1121242360 14:92439990-92440012 TTTGCAGCACCTCCTGTGTGTGG + Intronic
1122122189 14:99560575-99560597 TGCGCAGCCCCTTCCCTGTGAGG - Intronic
1124351310 15:28957652-28957674 TGTGGAGCACCTCTCCTGTGTGG + Intronic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1130293366 15:82624246-82624268 TACCCAGCCCCTCCCATGTGTGG - Intronic
1130939407 15:88495242-88495264 TCAGCAGCAATGCCCCTGTGAGG + Intergenic
1132293113 15:100716881-100716903 TCTGCAGCACCTCCTCTGCTGGG - Intergenic
1132381652 15:101370495-101370517 TCCGCAGCACCTGCACTAAGGGG + Exonic
1133102417 16:3487460-3487482 TCCCCAGCAGCTGCCCTGTCTGG + Intergenic
1133804510 16:9114437-9114459 TCCCCAGCACCTCCCTTATGAGG - Intronic
1134013694 16:10873842-10873864 TCAGCAGCACCTCTCCTGACAGG + Intergenic
1137773120 16:51034005-51034027 TCCGCAGCATCCCCACAGTGGGG + Intergenic
1138336632 16:56258627-56258649 TCCCCAGCAGCTTCCCTGTGGGG + Intronic
1140990741 16:80209017-80209039 GCTTCAGCACCACCCCTGTGAGG + Intergenic
1141426264 16:83946572-83946594 TCCGCAGCCTCACCCCTGTGCGG + Intronic
1141460948 16:84178629-84178651 TCCGCTGCGCCTCAGCTGTGGGG - Exonic
1141895911 16:86958738-86958760 TCCGACTCACCTCCCCTGTGGGG + Intergenic
1143733532 17:8894717-8894739 TCCCCAGCCCCTGCTCTGTGAGG - Intronic
1144738735 17:17569379-17569401 TGTGCAGCTCCTCCCCTCTGAGG - Intronic
1144946267 17:18971140-18971162 TCCACGGCAGGTCCCCTGTGTGG - Exonic
1147176447 17:38658957-38658979 GCAGCAGCACCTCCTCTCTGGGG - Intergenic
1148681003 17:49473405-49473427 TCCACCCCAACTCCCCTGTGTGG - Intronic
1151607391 17:75147156-75147178 TTCGCAGCACACCCCCTGGGGGG + Intronic
1151679175 17:75614765-75614787 ACCTCTGGACCTCCCCTGTGGGG - Intergenic
1152568169 17:81109515-81109537 ACCCCAGCACCTTCCCTGTCCGG - Intronic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG + Intronic
1157312796 18:46564908-46564930 TCCACAGCAGCTTCCCTGAGAGG - Intronic
1158305327 18:56099197-56099219 TCTGCAGCACTGCCTCTGTGGGG + Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1160162349 18:76483332-76483354 TCCCCAACACCTCCTCTTTGTGG + Intronic
1160843287 19:1155852-1155874 TCAGCAGCCCCTCCCCTGCAGGG + Intronic
1160984799 19:1833609-1833631 TCCGCAGCCCTCCCCCTGGGTGG - Intronic
1161217111 19:3100053-3100075 TCCACAGCACCTGGCGTGTGTGG + Intronic
1161220335 19:3115504-3115526 CCCACAGCTCCTTCCCTGTGTGG - Intronic
1161334964 19:3708183-3708205 TCCTAAGCACCTACCATGTGCGG + Intronic
1161455887 19:4369564-4369586 TCCCCAGCCCCTCCCCTCAGAGG - Intronic
1161887391 19:7007473-7007495 GCTGCAGAACATCCCCTGTGCGG - Intergenic
1161887818 19:7010431-7010453 GCTGCAGAACATCCCCTGTGCGG + Intergenic
1161982602 19:7637618-7637640 TCCCCTACACCACCCCTGTGGGG - Intronic
1162095966 19:8310077-8310099 TCCTCAGCACCTTCCCACTGAGG - Intronic
1162165051 19:8746855-8746877 TCGCCAGCACCTTCCATGTGGGG + Intergenic
1162166117 19:8754306-8754328 TCGCCAGCACCTTCCATGTGGGG + Intergenic
1162167183 19:8761762-8761784 TCGCCAGCACCTTCCATGTGGGG + Intergenic
1162169192 19:8775518-8775540 TCGCCAGCACCTTCCATGTGGGG + Intergenic
1162169872 19:8780829-8780851 TCGCCAGCACCTTCCATGTGGGG + Intergenic
1162170935 19:8788288-8788310 TCGCCAGCACCTTCCATGTGGGG + Intergenic
1163520754 19:17790281-17790303 GCTGCAGCACCTGCCCTGTCTGG + Intergenic
1165229598 19:34378686-34378708 GCCGCAGCTTCTCCCCTGAGGGG - Intronic
1165406867 19:35636484-35636506 TCCTCATCCCCTCCCTTGTGGGG + Intronic
1165841976 19:38793565-38793587 TCCGCCGCACCCACACTGTGGGG + Intergenic
1166376153 19:42328283-42328305 TGCCCAGGACCTCCCCTGTCTGG - Intronic
1166944032 19:46386266-46386288 TGGGCAGGGCCTCCCCTGTGTGG - Intronic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
932763708 2:74457414-74457436 TCAGCAGCATCTCCTCTGTGAGG - Exonic
936094694 2:109522817-109522839 TCAGCAGCACCTGCCCAGGGTGG + Intergenic
942093146 2:172513536-172513558 TCCGCAGCTGGTGCCCTGTGTGG + Intergenic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
946464853 2:219902799-219902821 CCCCTAGCTCCTCCCCTGTGGGG - Intergenic
947633774 2:231669971-231669993 TCCGCACAACCTGCCCTGCGAGG + Intergenic
948807416 2:240459022-240459044 TCCGCAGGTGCTCACCTGTGGGG - Exonic
948902280 2:240962821-240962843 TCCCCAGCACCTACGCTCTGGGG - Intronic
1169339079 20:4782506-4782528 ACAGCAGCACCAGCCCTGTGGGG - Exonic
1170782562 20:19438687-19438709 TCCACACTACCTACCCTGTGGGG - Intronic
1173931245 20:46821179-46821201 TCCCCAGCTCCTTCCCTGGGGGG - Intergenic
1174037817 20:47678946-47678968 ACCTCAGCAGCTCCCCTCTGCGG + Intronic
1176110066 20:63407061-63407083 GCCACGGCACCTCCCCCGTGGGG - Exonic
1176168715 20:63687630-63687652 AGCTCAGCACCTTCCCTGTGGGG - Exonic
1180998998 22:19979264-19979286 TCTGCACCTCCTCCCCTTTGGGG - Intronic
1181864695 22:25846091-25846113 TCCGCAGCTCCTCTCTGGTGGGG - Exonic
1183540777 22:38428186-38428208 TCCCCAGCATCTCACCTGTCCGG - Intronic
1183544287 22:38447438-38447460 TGCCCACCACCTCCCCTGTATGG + Intronic
1183862731 22:40681381-40681403 TCATCAGCATCACCCCTGTGTGG + Exonic
1184455201 22:44606216-44606238 TGAGCAGCACCTCCCCTGCCCGG + Intergenic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185049400 22:48545977-48545999 TCCGGAGCAGCTCCCTTGGGTGG - Intronic
1185154263 22:49183734-49183756 TCCTCTGCACCTCCCCCATGGGG - Intergenic
954604288 3:51896794-51896816 TCCCCAGCCCCAGCCCTGTGTGG + Intronic
959333213 3:105033101-105033123 ACTGCAGCACCTACCCTGTGGGG + Intergenic
960068526 3:113402454-113402476 TCAGCAGGACCTCCCCTGTGAGG + Intronic
960356426 3:116659203-116659225 TTCCCACCACCTCCCATGTGAGG + Intronic
960415848 3:117383738-117383760 CCCTCACCACATCCCCTGTGAGG + Intergenic
968576808 4:1370439-1370461 TCCCCATCACCTGCTCTGTGTGG + Intronic
968644886 4:1735477-1735499 TCTGCAGCACCTCCTCTAAGTGG + Intronic
968800935 4:2742908-2742930 TACTCTGCACCTCCTCTGTGGGG + Intronic
968973459 4:3809065-3809087 TGGGCAGCACCTCCCCTCGGAGG + Intergenic
975493546 4:75014038-75014060 GCTGCAGCCCCTCCCCTGGGTGG + Intronic
978327467 4:107575512-107575534 CCCCCAGCACATGCCCTGTGAGG + Intergenic
979604788 4:122626458-122626480 TCCACAGCACCTTTTCTGTGGGG + Intergenic
980998140 4:139801421-139801443 TCAGCTGCACCACCGCTGTGGGG + Intronic
985045613 4:185937796-185937818 TCCACAGCACAGCACCTGTGGGG - Intronic
991227774 5:64292754-64292776 TCAGCAGCCCCTCCCCCATGGGG + Intronic
992499461 5:77327677-77327699 TTAGCAGGACCTGCCCTGTGGGG + Intronic
995991549 5:118246129-118246151 TACGCATCTCCTCCACTGTGAGG + Intergenic
998378759 5:141709069-141709091 TCCCCATCACCTCACCTGTTTGG + Intergenic
1002066582 5:176654887-176654909 TCCGCAGCAAGACCACTGTGGGG - Exonic
1003123912 6:3340069-3340091 TAGGAAGCACCTCCCCTGTGGGG - Intronic
1003152997 6:3568564-3568586 TTGGCAGCCCCTCCCCTGGGTGG - Intergenic
1003170614 6:3719154-3719176 TCCCCAGCACTTCCCTTGTGGGG - Intergenic
1007396217 6:41579209-41579231 TGCCCAGCTCCTCCCCTTTGAGG - Intronic
1007556599 6:42771465-42771487 TCTGCATCCCCACCCCTGTGGGG + Intronic
1008090257 6:47286410-47286432 TCTGCAGCAGTTGCCCTGTGGGG - Exonic
1013152474 6:107459639-107459661 TCCAAAGCACCGCCCCTGCGGGG - Intergenic
1016004949 6:139079742-139079764 TCTCCAGCACCCCCCCGGTGAGG - Intergenic
1016838705 6:148504951-148504973 TCCCCAGTACTTCCCCTGAGCGG - Intronic
1018744302 6:166750257-166750279 TCCTCAGCTTCTCCCCTGGGGGG + Intronic
1019351292 7:555209-555231 TCCTCAGCCCCTCCCCAGAGCGG - Intronic
1020039620 7:4992168-4992190 CCTCCAGCCCCTCCCCTGTGTGG + Intronic
1021279689 7:18702381-18702403 TCCGCAGCACCTCCAGAGAGTGG + Intronic
1024544567 7:50506241-50506263 ACCCCAGCATCTCCTCTGTGGGG - Intronic
1027810394 7:82889159-82889181 TCCCCAGCACAACCCCCGTGTGG + Intronic
1031411354 7:121443086-121443108 TCCTCAGCCCCTCCCCTGAAAGG + Intergenic
1032193794 7:129778851-129778873 GCCGCCGCACCTTGCCTGTGGGG + Intergenic
1034266945 7:149785649-149785671 TGCCCAGAACCTGCCCTGTGGGG + Intergenic
1034964329 7:155382346-155382368 CCAGCAGCCCCTGCCCTGTGCGG + Intronic
1035678738 8:1472164-1472186 CCAGCATCACCTCCCCAGTGCGG - Intergenic
1037615899 8:20518846-20518868 TCCAAAGCACCTCCCCTGAATGG - Intergenic
1037805734 8:22057152-22057174 TCCGCCTCTCCTCCCCTCTGTGG + Intronic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG + Exonic
1053238823 9:36479444-36479466 TCTGCATCTCCTCCCATGTGGGG + Intronic
1053253803 9:36597879-36597901 TCTGCAGCAGATCTCCTGTGTGG + Intronic
1057210987 9:93201055-93201077 TGTGCAGCCCCTCCCCAGTGAGG + Intronic
1057352510 9:94311237-94311259 ACCCTAGCACATCCCCTGTGAGG - Intergenic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1057655130 9:96944836-96944858 ACCCTAGCACATCCCCTGTGAGG + Intronic
1058486562 9:105448005-105448027 TCCTCAGCCCCTCCCTTCTGCGG + Intronic
1059760848 9:117336143-117336165 TCCCCAGCACCTCCTGTCTGAGG - Intronic
1060344106 9:122801753-122801775 TCCGCAGAACATGCCTTGTGTGG + Intronic
1060390844 9:123275481-123275503 TCCAAAGCACCTGCCCTGGGAGG + Intergenic
1061330689 9:129890416-129890438 TCCGCAGCCCCATCCCTGCGGGG - Exonic
1061406306 9:130394671-130394693 GCTGAAGCACCTCCTCTGTGTGG + Intronic
1061713648 9:132504977-132504999 TCCCCAACACCTCCTCTGTCGGG - Intronic
1062495572 9:136830019-136830041 TCCGCAGCACCCCCCCGCTGGGG - Intronic
1062540427 9:137039566-137039588 TCCCCTGCACCTCTCCTGTTCGG - Exonic
1062672972 9:137722711-137722733 TCTGCCGCACCACCTCTGTGGGG - Intronic
1195569840 X:106385762-106385784 TCTCCAGCACCTGCCCAGTGAGG + Intergenic
1197754236 X:129983485-129983507 CCCGTCGCACCTCCCCTCTGAGG - Intronic
1199992422 X:152994656-152994678 GCCGCAGGACCTTCCCTCTGTGG - Intergenic