ID: 946361081

View in Genome Browser
Species Human (GRCh38)
Location 2:219219661-219219683
Sequence TCCCATGTGCAGGTGATGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 0, 2: 1, 3: 43, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946361073_946361081 -10 Left 946361073 2:219219648-219219670 CCAGCCCGGTCTGTCCCATGTGC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG 0: 2
1: 0
2: 1
3: 43
4: 227
946361070_946361081 3 Left 946361070 2:219219635-219219657 CCAAGGTCACCCTCCAGCCCGGT 0: 1
1: 0
2: 1
3: 29
4: 256
Right 946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG 0: 2
1: 0
2: 1
3: 43
4: 227
946361072_946361081 -7 Left 946361072 2:219219645-219219667 CCTCCAGCCCGGTCTGTCCCATG 0: 1
1: 0
2: 2
3: 25
4: 286
Right 946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG 0: 2
1: 0
2: 1
3: 43
4: 227
946361071_946361081 -6 Left 946361071 2:219219644-219219666 CCCTCCAGCCCGGTCTGTCCCAT 0: 1
1: 0
2: 1
3: 12
4: 178
Right 946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG 0: 2
1: 0
2: 1
3: 43
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946361081 Original CRISPR TCCCATGTGCAGGTGATGGG GGG Exonic
900107420 1:989793-989815 CCCCATGTGGAAGTGTTGGGAGG - Intergenic
902123842 1:14191821-14191843 TCACACAGGCAGGTGATGGGTGG + Intergenic
902231342 1:15029638-15029660 TGCCATGTTGAGGTGCTGGGGGG + Intronic
906819423 1:48913611-48913633 TCCCATCTGGGGGTGATGGGAGG - Intronic
907311922 1:53543761-53543783 TCCGAGATGCAGGTGAGGGGTGG - Intronic
908151544 1:61307505-61307527 TCCCATTTTCTGGTGTTGGGTGG - Intronic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
908801700 1:67887379-67887401 TCCCATCTGGATGTGCTGGGAGG + Intergenic
909479446 1:76115735-76115757 ACCAATTGGCAGGTGATGGGTGG - Intronic
910296474 1:85650917-85650939 CCCCATGTGCTAGTGTTGGGAGG - Intronic
914848151 1:151294128-151294150 TTCCCTTTCCAGGTGATGGGCGG - Exonic
915517926 1:156423948-156423970 TCCCAGGTGCTGGTGAGGGGAGG - Intronic
915744618 1:158146364-158146386 TCCCATCTGCAGGGGAGGTGGGG + Intergenic
917204804 1:172561245-172561267 TCCCAGGTCCAGGTAATGGTGGG + Intronic
917987182 1:180332604-180332626 TCCCATCTAGGGGTGATGGGAGG - Intronic
918094663 1:181324923-181324945 TCCCAGATGCAGGAGATGGAAGG - Intergenic
919398430 1:197080166-197080188 TCCAATGTAAAGGTGTTGGGAGG + Intergenic
923891882 1:238224921-238224943 TCCCATATGGGAGTGATGGGAGG + Intergenic
1063065489 10:2604173-2604195 CCCCAAGTCCAGGTGCTGGGAGG + Intergenic
1063378746 10:5570875-5570897 TCCTGTGTGCAGGTGCTGGCTGG - Intergenic
1063454910 10:6176273-6176295 TCCCTTGAGGTGGTGATGGGAGG + Intronic
1064103947 10:12485492-12485514 TCCCAGGTGGAGGAGAGGGGAGG + Intronic
1064774463 10:18760353-18760375 TCCCATCTGGGGGTGAGGGGAGG + Intergenic
1064823432 10:19366230-19366252 TCCCATCCGGGGGTGATGGGAGG + Intronic
1065094979 10:22271705-22271727 TCCCTCGTGCAGGTGGTGGGAGG + Intergenic
1065158390 10:22894234-22894256 TTCCATGGGCTGGTGGTGGGTGG + Intergenic
1065438817 10:25728217-25728239 TCCCATGTGCAAGTGACTGGGGG - Intergenic
1065874700 10:29987025-29987047 TACATTGTTCAGGTGATGGGTGG - Intergenic
1069372266 10:67760827-67760849 TCCCATCTGGGGGTGATGGGAGG - Intergenic
1073225357 10:101913812-101913834 TCCCAGGTGCAAATAATGGGTGG + Intronic
1075831643 10:125417128-125417150 TCCCATGTGCAGTTCGTGGTAGG - Intergenic
1075993453 10:126857591-126857613 CCCCATCTGGGGGTGATGGGAGG - Intergenic
1076245972 10:128948171-128948193 TACAATGTGGAGGTGATGGCAGG - Intergenic
1076374408 10:129973428-129973450 TCCCGTGGGCAGGAGATGGCTGG + Intergenic
1078860795 11:15244495-15244517 TGCCATGTCCAGGTAATGAGTGG + Intronic
1079405766 11:20144356-20144378 TCCCATCTGGGGGTGATGGGAGG + Intergenic
1080470250 11:32538528-32538550 TCTCATCTGGGGGTGATGGGAGG + Intergenic
1084261741 11:67983560-67983582 TCCAATGTGCAGGGCAGGGGAGG + Intergenic
1084810904 11:71610550-71610572 TCCAATGTGCAGGGCAGGGGAGG - Intergenic
1085014039 11:73160689-73160711 TCCTGTGTGCAGGTGCTGGCTGG + Intergenic
1088502636 11:110497927-110497949 TCCCAACAGCAGGTGTTGGGTGG + Intergenic
1089440479 11:118512014-118512036 TCTCATTTGCAGGTAATGGCTGG + Exonic
1091642798 12:2250295-2250317 TCCCAACTCCAGGTGCTGGGAGG - Intronic
1091791923 12:3276887-3276909 GCCCATGGGAAGGTGAGGGGAGG - Intronic
1093318209 12:17678279-17678301 TCCCCAGTGCAAGTGTTGGGAGG - Intergenic
1093734246 12:22601951-22601973 TCCAACGTGGAGGTGTTGGGAGG + Intergenic
1093980648 12:25471720-25471742 TCCCATCTGATGTTGATGGGAGG + Intronic
1094254855 12:28411954-28411976 TCCAATGTGGTGGTGTTGGGGGG - Intronic
1101819050 12:108169125-108169147 TCCCATCTGGAGGTGATGGAAGG - Intronic
1102517086 12:113456956-113456978 ACCCATCAGCAGGTGCTGGGGGG + Intergenic
1104297907 12:127534960-127534982 TCCCATGTGGGGGTGGTGGGAGG - Intergenic
1106287336 13:28329217-28329239 TCCCAGGAGGAGGTGATGTGGGG - Intronic
1106300074 13:28456150-28456172 ATCCATGTGCAGGTTTTGGGTGG - Intronic
1106810614 13:33355230-33355252 TCAGATGTGTAGGTGGTGGGTGG - Intergenic
1107544793 13:41425677-41425699 TCCAATGTGCAGGGCAAGGGAGG + Intergenic
1109459199 13:62632417-62632439 TCCCATGTGCATTGGATGGATGG - Intergenic
1110715657 13:78700997-78701019 TCCCATCTTCAGGTGTAGGGAGG + Intergenic
1112222666 13:97506869-97506891 TCCCATCTGGGGGTGATGGGAGG - Intergenic
1112862628 13:103851294-103851316 TCCCAAGTGCAAGTGTTGGGAGG - Intergenic
1115251647 14:31355033-31355055 TCCAATGTGCAAGTCAGGGGTGG + Intronic
1116419188 14:44713405-44713427 TCCCATCTGGGGGTGATGGGAGG + Intergenic
1118779118 14:68994543-68994565 TCCCATGTGCTGGGAAGGGGAGG + Intergenic
1119729432 14:76941753-76941775 TCCCAGCTGCGGGTGAGGGGAGG - Intergenic
1119921990 14:78455185-78455207 TCCCAAGTCCTGGTGATGGAAGG - Intronic
1120705402 14:87740226-87740248 TCCCATGTGCAGGGACTGTGTGG - Intergenic
1121327408 14:93029286-93029308 CCCCAGGTGGAGGTGAGGGGCGG - Intronic
1121584753 14:95055581-95055603 TACAAGGAGCAGGTGATGGGAGG + Intergenic
1122001718 14:98662730-98662752 CCCCATGTGGAGGTGTTGGGAGG - Intergenic
1122915367 14:104855898-104855920 ACCCAAGTGCAGCTGAGGGGTGG - Intergenic
1123756311 15:23400099-23400121 TACCATGTGCAGCAGAAGGGAGG + Intergenic
1124240391 15:28023512-28023534 TCCCCTGTGCATGAGATGTGTGG - Intronic
1126811794 15:52414000-52414022 CCCAATGTGAAGGTGCTGGGAGG + Intronic
1127111060 15:55671258-55671280 TGCCCTGTGAAGGTGAGGGGAGG - Intronic
1128392823 15:67194369-67194391 TCCCATGGGGAGGTGATGGTGGG + Exonic
1133909321 16:10050555-10050577 TCCCATCTGGGGTTGATGGGAGG - Intronic
1134647401 16:15880905-15880927 TCCCATCTGGGGGTGATGGGAGG - Intronic
1134787287 16:16956140-16956162 TCACATCTGGAGGTGATGGGAGG - Intergenic
1135235272 16:20749501-20749523 TCCCCTGTGAAGGTGAGAGGTGG + Intronic
1138193420 16:55034761-55034783 TCCCATGTGCAGGTCCCTGGAGG + Intergenic
1138208563 16:55143612-55143634 CCCAATGTGCTGGTGTTGGGAGG + Intergenic
1138225803 16:55293271-55293293 TCCCATTCACAGGTGAGGGGTGG - Intergenic
1141510097 16:84506268-84506290 TCTCAGGTGCAGGTACTGGGGGG + Intronic
1141648021 16:85377824-85377846 CCACATGTGCAGGAGCTGGGGGG + Intergenic
1143032619 17:3976372-3976394 TCCTGTGTGCAGGGGCTGGGGGG + Intergenic
1143554628 17:7652374-7652396 GCACAGGTGCAGGTGAGGGGTGG + Intronic
1143949894 17:10624090-10624112 GCCCAGGAACAGGTGATGGGAGG - Intergenic
1144747400 17:17625088-17625110 TCCCATGTGCATGACAGGGGAGG - Intergenic
1144898121 17:18558261-18558283 TGCCATGTGCAGGTGCCGGTGGG - Intergenic
1145134250 17:20387453-20387475 TGCCATGTGCAGGTGCCGGTGGG + Intergenic
1148105676 17:45117597-45117619 TCCCATCAGCAAATGATGGGAGG - Intronic
1148328159 17:46796051-46796073 TCCCATCCGCAGGTGGTAGGTGG + Intronic
1148356894 17:46981294-46981316 CCCAATGTGGAGGTGTTGGGAGG + Intronic
1149139876 17:53419190-53419212 TCACATGTGCAGTTCATGGTAGG - Intergenic
1149389178 17:56172582-56172604 TCCCAAGAGCAGGACATGGGAGG + Intronic
1151254616 17:72866295-72866317 TCCCATCTGGGGGTAATGGGAGG - Intronic
1151267368 17:72967050-72967072 TCCCATCTAGGGGTGATGGGAGG - Intronic
1151404765 17:73879100-73879122 TCCCTCGTGCAGGTCATGTGTGG - Intergenic
1151985205 17:77538301-77538323 TGCCAGCAGCAGGTGATGGGAGG + Intergenic
1152562076 17:81083600-81083622 TCCCATGTGGTGCTGATGGGGGG + Intronic
1152665835 17:81568827-81568849 TCCCATGGCTAGGTGATGGACGG - Intronic
1153845233 18:9043433-9043455 TCCCATCTGGGGGTGATGGGAGG - Intergenic
1155839028 18:30625240-30625262 GCCCATGTGGAGCTGATGGTGGG + Intergenic
1159108825 18:64032652-64032674 TTTCATGTGCAGGTGAGTGGTGG + Intergenic
1160412127 18:78682261-78682283 TCCCATCTGGGGGTAATGGGAGG - Intergenic
1161192787 19:2968410-2968432 TCCCAGGTACAGGGGATGGAGGG - Intergenic
1161453717 19:4360189-4360211 TCCCAGGTGCAGGGGCTGAGGGG - Intergenic
1163288340 19:16363391-16363413 TCCCAGGCTCAGGTGGTGGGCGG - Intronic
1163833388 19:19558683-19558705 TCCCATGTGCAGCTGGGGGACGG + Intergenic
1164291630 19:23874604-23874626 TCCCATCTGGGGGTGATGAGAGG + Intergenic
1164301861 19:23969661-23969683 TCCCATCTGGAAGTGATGAGGGG + Intergenic
1165362303 19:35344484-35344506 TCCCATGTGGAATTGCTGGGTGG + Intronic
1166198948 19:41223775-41223797 TCCCATGAGAAGGGGAGGGGAGG + Intronic
925216213 2:2097830-2097852 TCCCAGGTGGAGGTGATGCCTGG + Intronic
925892978 2:8451033-8451055 TCCCATATGGGGGTGACGGGAGG + Intergenic
926562223 2:14430283-14430305 TCCCATGTGCAGTTCATGGTAGG - Intergenic
932279020 2:70473370-70473392 TCCCCTGGGCAGGTGGGGGGAGG + Intronic
933817713 2:86081462-86081484 CTCCAGGTGCAGGTGGTGGGAGG - Intronic
936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG + Intronic
937095496 2:119232793-119232815 TCCCAGGGGTAGGTGGTGGGGGG - Intronic
937749806 2:125461681-125461703 TCCAATGTGGAGGTGATGAGAGG - Intergenic
940515872 2:154683561-154683583 TCCCATGGGCAGTTGAGAGGAGG - Intergenic
940645418 2:156387697-156387719 TCCCATCTGTAGAAGATGGGTGG - Intergenic
941832542 2:169978271-169978293 TTCCAGGTGCAGGTGCTTGGAGG + Intronic
942098711 2:172557018-172557040 TCCCATGTGAAGGCGATGAGGGG + Intronic
942797194 2:179835492-179835514 TTCGATGTGCTGGTGGTGGGGGG + Intronic
943169408 2:184377662-184377684 TCCAATGTGGAGGTGTTGGGAGG - Intergenic
944581830 2:201138323-201138345 TCCCATGAGCAGCTGCTGGGCGG - Intronic
946021116 2:216640778-216640800 TGCCATGTGCAGGTGATGTATGG + Intronic
946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG + Exonic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
947929926 2:233956002-233956024 TCTCATCTGGGGGTGATGGGTGG - Intronic
948119441 2:235518020-235518042 CCCCATTTGCAGGTGAGAGGTGG + Intronic
1169501541 20:6165522-6165544 TCCCATTTTCAGGTGAAGGCTGG + Intergenic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1170944104 20:20874622-20874644 TCCCAGGTAAAGGTGAAGGGAGG + Intergenic
1171456050 20:25273027-25273049 TCCCATGAAAAGGGGATGGGAGG - Intronic
1173910066 20:46661622-46661644 TCCCAGGTGCAGGAAATGGGGGG - Intronic
1173978020 20:47201985-47202007 TACCAAATGCAGCTGATGGGTGG - Intergenic
1177471339 21:21564063-21564085 ACCCCTGGGCAGGTGATGGGAGG + Intergenic
1178777517 21:35566244-35566266 TCCCATGAGCAGGGGATGTGGGG - Intronic
1178800617 21:35791771-35791793 GCCCACCTGCAGGTGCTGGGAGG + Intronic
1179222951 21:39425858-39425880 TGCCATGCTCAAGTGATGGGAGG + Intronic
1181000647 22:19986511-19986533 TCCGAGGCGCACGTGATGGGAGG - Intronic
1181115343 22:20629407-20629429 TCCTATGAGCAGGTCATGGCAGG + Intergenic
1181171409 22:21012248-21012270 TCCCATGTGCAGGGCAGGGCAGG + Intronic
1181570626 22:23766237-23766259 CCCCATCTGCAGGGGCTGGGGGG + Exonic
1182118955 22:27774651-27774673 TCCCAGGTGCAGGTCATTGCTGG + Intronic
1182686285 22:32123277-32123299 TATCAGGTGCTGGTGATGGGGGG + Intergenic
1182708309 22:32303762-32303784 ACCCATGTGCAGGTTTTGTGTGG + Intergenic
1183273370 22:36875844-36875866 ACCCATGAGAAGGTGATGTGAGG - Exonic
1183655462 22:39181991-39182013 TTCCATGTGCAGGGGCTGGTTGG - Intergenic
1184396007 22:44241246-44241268 ACCCATGTGCAGGTTTTGTGTGG + Intergenic
1185151449 22:49165800-49165822 TGCCCTGTGCTGTTGATGGGAGG + Intergenic
952435957 3:33272696-33272718 TCCCATCTGGGGGTGATGGGAGG - Intergenic
952979045 3:38720602-38720624 TCCCAGGGGAAGGAGATGGGAGG + Intronic
956390602 3:68769172-68769194 TCCCATGTGCAGTTTACAGGAGG - Intronic
956885718 3:73557149-73557171 TTCCCTGTGCAGCTGCTGGGAGG - Intronic
957076808 3:75609141-75609163 TCCAATGTGCAGGGCAGGGGAGG + Intergenic
961340976 3:126218038-126218060 TCCCTTCTGCAGGGGTTGGGTGG + Intergenic
961351130 3:126304571-126304593 TTCCAGGTGGAGGTGCTGGGAGG - Intergenic
961606450 3:128099016-128099038 TCCCATGTTGAGTTGATGAGTGG - Intronic
961649263 3:128409385-128409407 TCCCGTGTGCACGTGGTGGGTGG + Intergenic
961911450 3:130321044-130321066 TCTCCTGGGCAGATGATGGGAGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962842619 3:139249656-139249678 TCCCATCTAGGGGTGATGGGAGG - Intronic
962956793 3:140274157-140274179 TCCCATGTGCCCCTCATGGGAGG + Intronic
964737963 3:159935423-159935445 TCCCACGTGGAGCTGGTGGGAGG - Intergenic
967420803 3:189270400-189270422 TCCCTTGGGCAGTTGCTGGGTGG + Intronic
969641357 4:8400993-8401015 TCCCATCTGGGGGTGATGGGAGG + Intronic
969718535 4:8880319-8880341 TCACATGTGCAGGTGTGTGGGGG + Intergenic
969733597 4:8971980-8972002 TCCAATGTGCAGGGCAGGGGAGG - Intergenic
973652851 4:53014085-53014107 TGCCATGTGCAGGGGATGCAGGG + Intronic
973850638 4:54958142-54958164 ACCAATGTGAAGGTAATGGGAGG - Intergenic
975417456 4:74121496-74121518 TCCCATGTGCAGGTGATGGGAGG - Intronic
975617258 4:76258604-76258626 CCCAGTGTCCAGGTGATGGGAGG + Intronic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
977754365 4:100649587-100649609 TCCCATGAACAGGAAATGGGAGG + Intronic
980656575 4:135794598-135794620 TCCCATCTGGGGGTGATTGGTGG + Intergenic
981884868 4:149662380-149662402 TTCCATGTGCAGATGTTGGATGG + Intergenic
982556065 4:156866504-156866526 TACCATGTGCAGTGGGTGGGGGG + Intronic
982767892 4:159368870-159368892 TCCCATCTGGGGGTGATTGGAGG - Intergenic
983517558 4:168673731-168673753 TTCCATGTGGAGGCGAGGGGAGG + Intronic
984084949 4:175298107-175298129 TGCCTTGTGCTGGTGGTGGGTGG + Intergenic
985429438 4:189864831-189864853 CCCCATGTGAAGGTCATTGGAGG + Intergenic
985619272 5:945356-945378 GCACATGTGCAGGTCCTGGGAGG - Intergenic
986342358 5:6801595-6801617 TCCCATCTGGGGGTGATAGGAGG - Intergenic
986373452 5:7105396-7105418 TCCCCTCTGGGGGTGATGGGAGG + Intergenic
987835169 5:23151146-23151168 TCCCATGTGGGGATGATGGGAGG - Intergenic
988060334 5:26159319-26159341 TCCAATTTGCAGGGGGTGGGTGG + Intergenic
988095937 5:26610182-26610204 TCCCATCTGGGAGTGATGGGAGG - Intergenic
989425487 5:41291059-41291081 ACCCAGGAGCAGGTGCTGGGAGG + Intergenic
993011894 5:82492496-82492518 TCCCATCTGGGGGTGATGGGAGG - Intergenic
993769887 5:91914170-91914192 CCCCATGTGGAGGTGTTGGGAGG + Intergenic
996092434 5:119364054-119364076 TCCCACCTGGAGGTGCTGGGAGG - Intronic
998606307 5:143638679-143638701 TCCCATCTGGGGGTGATGGGAGG + Intergenic
999146859 5:149402023-149402045 CCCCATGTGCTGGTGATAGCAGG + Intronic
999168610 5:149573242-149573264 TCCCATGTGGTGGTGTTGGGAGG - Intronic
999288606 5:150408781-150408803 GCCAATGTGAAGGTGTTGGGAGG + Intronic
1001538587 5:172520123-172520145 TTCTATGTGCAGGTTTTGGGTGG - Intergenic
1002073829 5:176696535-176696557 TTCCCTGGGCAGGTGGTGGGCGG + Intergenic
1003501355 6:6705609-6705631 TCCTATGTGCAGGTCATGTTGGG + Intergenic
1004036114 6:11925836-11925858 GCCCAGGGGCAGGTGAAGGGTGG - Intergenic
1004151461 6:13124016-13124038 TCCCATGTGCAGATGATCCAAGG + Intronic
1004191794 6:13470518-13470540 TCCCATGTGGGGGTGCTGGAGGG + Intronic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1005468719 6:26141069-26141091 TCCAATGTGCACGTGCTGGATGG - Intergenic
1008248493 6:49207903-49207925 TCCCCTGGGCCTGTGATGGGAGG + Intergenic
1010125045 6:72421662-72421684 TCCAATGTGGAAGTGTTGGGAGG - Intergenic
1012176455 6:96092707-96092729 TCCCATATTCAGGAGATGCGAGG + Intronic
1013171023 6:107636213-107636235 TCACCTTTGCAGGTAATGGGAGG + Intronic
1014756779 6:125310060-125310082 TCCCATGTCCAGGTGAGGCTAGG + Intergenic
1016845003 6:148561094-148561116 TCCCTTCTGGGGGTGATGGGAGG - Intergenic
1018004940 6:159613005-159613027 TCACATGGCCAGGAGATGGGGGG + Intergenic
1018796330 6:167188140-167188162 TCCCATCTGGGGGTGAAGGGAGG - Intronic
1018819985 6:167366919-167366941 TCCCATCTGGGGGTGAAGGGAGG + Intronic
1019292999 7:259322-259344 TCCCTTGTGCAGGTGAGAGGCGG + Intronic
1019422094 7:955173-955195 TCCCATCTGTGGGTGGTGGGCGG - Intronic
1020307677 7:6847465-6847487 TCCAATGTGCAGGGCAGGGGAGG + Intergenic
1021254192 7:18369810-18369832 TCCCATTTGGAGATGATGGCAGG - Intronic
1021508317 7:21409302-21409324 TAGTATGTGGAGGTGATGGGAGG - Intergenic
1023255889 7:38311663-38311685 CCCCATCTGCAGGGGCTGGGGGG - Intergenic
1023530576 7:41149560-41149582 TCCCTGGTGCAGGTGATTGCGGG - Intergenic
1027201062 7:76064223-76064245 TCCCATGCCCTGGTGATGGGAGG + Intronic
1027876679 7:83779062-83779084 TGCTAACTGCAGGTGATGGGAGG - Intergenic
1028174175 7:87634231-87634253 TCCAATGTGATGGTGTTGGGAGG - Intronic
1028563693 7:92204556-92204578 TCCCATCTGGGGGTGATGGGAGG + Intronic
1028883558 7:95907438-95907460 TCCCATGTGCAAGTGAGAGGAGG - Intronic
1029078795 7:97956406-97956428 TCCAATGTGCAGGGCAGGGGAGG + Intergenic
1029166595 7:98595841-98595863 TCCCATGAGCCAGTCATGGGAGG + Intergenic
1029993308 7:104982917-104982939 GACCAGGTGCAGATGATGGGAGG - Intergenic
1034881358 7:154765006-154765028 CCCAATGTGGAGGTGTTGGGAGG - Intronic
1036907014 8:12715619-12715641 TCCAATGTGCAGGGCAGGGGAGG + Intergenic
1037241877 8:16786518-16786540 TCCCATCTGGGGGTGATGGGAGG - Intergenic
1037438405 8:18888998-18889020 CCCCATGTGAAGATGGTGGGTGG - Intronic
1037485902 8:19346450-19346472 TCCCATCTGAGGGTAATGGGAGG - Intronic
1037638003 8:20717903-20717925 TCCGAGGTGCAGGTCATGCGTGG + Intergenic
1038514916 8:28179653-28179675 TCCCATCTGGGGATGATGGGAGG + Intronic
1038936756 8:32260413-32260435 CCCCATGTGGAGGTGAAGGGTGG - Intronic
1042062001 8:64828969-64828991 GTCCATGTGCTGGTGATGGCAGG - Intergenic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1045917519 8:107490117-107490139 TCACTTGTGCAGATGATGAGAGG - Intronic
1046938473 8:119908165-119908187 TGACATGTGTAGGTGCTGGGAGG + Intronic
1047150236 8:122252674-122252696 TCCCATTGCCAGGTGATGGAGGG + Intergenic
1047275332 8:123401290-123401312 TCCCATGAGCAGCTGCTGTGTGG + Intronic
1047275360 8:123401454-123401476 TCCCACCTCCAGGTGATTGGGGG + Intronic
1049164841 8:141119311-141119333 GCCCATGTGCGGGGGCTGGGCGG + Intronic
1049245451 8:141560004-141560026 TCCCAGGAGCAGGTGCTGGCAGG + Intergenic
1049605818 8:143528763-143528785 CCCCATGGGCAGGCCATGGGCGG - Intronic
1052479401 9:29003568-29003590 TCCCTTCTGCAGCTGATGGTTGG + Intergenic
1053459264 9:38255952-38255974 TCCCCAGTGCAAGTGTTGGGAGG - Intergenic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1055660762 9:78501783-78501805 TCCCAGGTGCAGGGGAAAGGTGG - Intergenic
1056917815 9:90760294-90760316 TCCAATGTGCAGGGCAGGGGAGG + Intergenic
1057115608 9:92518459-92518481 TCCCATGTGCATATCAAGGGTGG - Intronic
1058754381 9:108070826-108070848 TCCCATGTGGAGTTGATGGGAGG + Intergenic
1059362424 9:113755310-113755332 TCCCACTTCCAGGTGAAGGGTGG - Intergenic
1060940341 9:127539797-127539819 CCCTGTTTGCAGGTGATGGGGGG - Intronic
1060996325 9:127876574-127876596 TCCCATGGGCAGCTGCTGAGGGG - Intronic
1061933591 9:133845699-133845721 TGCCATGGGCAGGGGATGGAAGG - Intronic
1186848251 X:13552985-13553007 TCCCATGTGTAGGTGAAGTGGGG - Intergenic
1187793297 X:22974482-22974504 TCTCATATGCTGGTGAGGGGAGG - Intergenic
1188032142 X:25276113-25276135 TCCCATCTGCATGTCATCGGTGG + Intergenic
1188334579 X:28915011-28915033 TTCCATGGACAGATGATGGGGGG + Intronic
1190971689 X:55356334-55356356 TGCCCTGTGCAGCTGCTGGGTGG - Intergenic
1192781221 X:74295585-74295607 CCCCATGTGGTGGTGTTGGGAGG - Intergenic
1194706141 X:97178101-97178123 TCCCAGCTGCTGGGGATGGGGGG + Intronic
1195219168 X:102730142-102730164 TCCCATCTTGGGGTGATGGGAGG + Intronic
1195778962 X:108439784-108439806 TCCCTTGTGCTGGTGAGGAGGGG + Intergenic
1197137849 X:123083622-123083644 ACCCAGCTGCAAGTGATGGGAGG + Intergenic
1197458565 X:126709269-126709291 TCCCATCTGGGGGTGATGGGAGG + Intergenic
1198236670 X:134742016-134742038 TCACAGGTGCAGGGGCTGGGTGG + Intronic
1198813923 X:140566619-140566641 TCCCATCTGGGGGTGATGCGAGG + Intergenic
1201620616 Y:15953079-15953101 TCCCATCTACAGGTTCTGGGTGG - Intergenic