ID: 946361155

View in Genome Browser
Species Human (GRCh38)
Location 2:219220068-219220090
Sequence AACCTGTGCCAACTGTGGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946361155_946361161 5 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361161 2:219220096-219220118 TGCTTGGCAGCTTCTATCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
946361155_946361166 28 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361166 2:219220119-219220141 CAGCCCTCTGGGGACTTGCAGGG 0: 1
1: 0
2: 3
3: 24
4: 190
946361155_946361167 29 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361167 2:219220120-219220142 AGCCCTCTGGGGACTTGCAGGGG 0: 1
1: 0
2: 1
3: 26
4: 239
946361155_946361160 4 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361160 2:219220095-219220117 CTGCTTGGCAGCTTCTATCGTGG 0: 1
1: 0
2: 0
3: 5
4: 74
946361155_946361162 16 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361162 2:219220107-219220129 TTCTATCGTGGGCAGCCCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 130
946361155_946361163 17 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361163 2:219220108-219220130 TCTATCGTGGGCAGCCCTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 53
946361155_946361165 27 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361165 2:219220118-219220140 GCAGCCCTCTGGGGACTTGCAGG 0: 1
1: 0
2: 2
3: 25
4: 241
946361155_946361164 18 Left 946361155 2:219220068-219220090 CCACTCCACAGTTGGCACAGGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 946361164 2:219220109-219220131 CTATCGTGGGCAGCCCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946361155 Original CRISPR AACCTGTGCCAACTGTGGAG TGG (reversed) Exonic
901678590 1:10900676-10900698 AGCCTGAGGCCACTGTGGAGGGG + Intergenic
903132592 1:21289742-21289764 AAACTGTGCCTTCTGTGGAAAGG + Intronic
904516659 1:31061012-31061034 AATCAGTGACAACTGAGGAGAGG - Intronic
904808250 1:33146691-33146713 TACCTGTGACCACTGTGGACTGG + Exonic
908769224 1:67581249-67581271 AAACTGGGCCAACTGGGGTGGGG + Intergenic
910544457 1:88398300-88398322 AACCTGTGAGAGCTGTAGAGAGG - Intergenic
915806498 1:158858985-158859007 AACGTGTGCCAAATGGGAAGAGG - Intergenic
920422856 1:205847249-205847271 CACCTCTGACAACTTTGGAGGGG + Intronic
920423600 1:205854488-205854510 CACCTCTGACAACTTTGGAGGGG - Intergenic
920852795 1:209640013-209640035 AGGCTGTGCCAGCTTTGGAGAGG - Intronic
922601803 1:226861657-226861679 AACCTTTTCCAACTGGTGAGAGG - Intergenic
1065843582 10:29726449-29726471 AAGCTGTGCTAACTGTGGCCGGG + Intronic
1069034970 10:63636954-63636976 AACCTGTTTGAACTGTGGACAGG + Intergenic
1076411888 10:130257502-130257524 ACCCTGTGGGAACTGTGGAAAGG + Intergenic
1079162461 11:18007938-18007960 TACCTGTGACAACTGCAGAGTGG + Exonic
1080678593 11:34451435-34451457 ATTCTGTGCCAACTGTGGTTAGG + Intronic
1083629289 11:64087489-64087511 AAGGGGTGGCAACTGTGGAGAGG - Intronic
1085532779 11:77201794-77201816 AACCTGTGCCAGGTGGGGAGGGG + Intronic
1085723032 11:78929917-78929939 AACCCGTTGCAATTGTGGAGTGG + Intronic
1089865309 11:121626402-121626424 AACCTATTCCAACTGTGCAGTGG - Intronic
1090426106 11:126608092-126608114 ACCCTGTCCCACCTGTGGGGTGG - Intronic
1091643825 12:2257999-2258021 AACCTCTGCCTACTGCAGAGTGG - Intronic
1092011349 12:5115341-5115363 GCCTTGAGCCAACTGTGGAGAGG - Intergenic
1093867362 12:24244564-24244586 TCCCTCTGCCAACTGTGGTGAGG + Intergenic
1101658995 12:106749383-106749405 ATGCTGGGCCAACTGTGGAAGGG - Intronic
1102434177 12:112907831-112907853 AAGCTGTCTCCACTGTGGAGAGG + Intronic
1105723653 13:23140309-23140331 TACCAATGCCAACTGTGGTGGGG + Intergenic
1106535824 13:30641795-30641817 ATCTTGTTCCACCTGTGGAGAGG - Intronic
1107443519 13:40449380-40449402 AACCTGAGGCAACTCTGTAGGGG - Intergenic
1107790533 13:43997934-43997956 AGCCTTTGCCAACTGTGGTGAGG - Intergenic
1108314478 13:49223962-49223984 TTCCTGTGCCAATTGTGGACCGG - Intergenic
1117282933 14:54258307-54258329 ACCCTGGGCCAGCTGTAGAGGGG - Intergenic
1123410385 15:20054102-20054124 ATCCTGTGCACACTGGGGAGGGG + Intergenic
1123519717 15:21060809-21060831 ATCCTGTGCACACTGGGGAGGGG + Intergenic
1129417572 15:75395411-75395433 AATCTGTGCCAGCTCTTGAGGGG + Intronic
1129417579 15:75395457-75395479 AATCTGTGCCAGCTCTTGAGGGG + Intronic
1133071404 16:3249056-3249078 AGCTGGTGCCAACTCTGGAGGGG + Intronic
1133208581 16:4249405-4249427 AACCTGTGCTGACAGAGGAGGGG - Intergenic
1133246800 16:4454648-4454670 ATCCTGTGCCATCTTAGGAGTGG + Intronic
1138586662 16:57974964-57974986 AACCTGTGTCCACTGATGAGTGG - Intergenic
1139302540 16:65957729-65957751 AACATGTGCCCAGTGTGGATTGG + Intergenic
1140458171 16:75116489-75116511 ACCCTGTGGCAACTGTGGGTGGG - Intronic
1140892666 16:79298484-79298506 AACCAGCTCCAACTGGGGAGGGG + Intergenic
1142006975 16:87694009-87694031 AAGCTGTGCCAACGCAGGAGTGG + Intronic
1146720463 17:35119938-35119960 AACCTGTGCAGGCGGTGGAGAGG - Intronic
1148429518 17:47631104-47631126 TAAGTGTGCCAACTCTGGAGTGG + Intergenic
1152572606 17:81127267-81127289 ATCCTGGGCCAACTGGGGGGGGG - Intronic
1152912802 17:83014981-83015003 GACCTGTTACCACTGTGGAGGGG + Intronic
1157330549 18:46700777-46700799 AACCAAAGCCAAATGTGGAGAGG + Intronic
1157907317 18:51581098-51581120 AACCTGTGCAAAATTTGGAAAGG + Intergenic
1158038410 18:53063389-53063411 AGCCTGTGCCCACTGTGAATTGG + Exonic
1163068218 19:14815321-14815343 AACCCATGCCCACTTTGGAGTGG - Intronic
1164619970 19:29689583-29689605 AACCTGTGGAGGCTGTGGAGAGG + Intergenic
1165549828 19:36574128-36574150 AACCTGTGCCCAGGGTGGACGGG + Intronic
1165819208 19:38663911-38663933 AACCTGTGCTAATTCTGAAGAGG - Intronic
1168271628 19:55253100-55253122 ATCCCGTCCCCACTGTGGAGGGG - Intronic
925578593 2:5386006-5386028 GACCTATGCAAAATGTGGAGGGG + Intergenic
925635022 2:5934535-5934557 AACCTTGTCCAACTGTGGGGAGG + Intergenic
925756669 2:7139387-7139409 ATTCTGTCCCACCTGTGGAGGGG + Intergenic
928173950 2:29021811-29021833 AACCTGCCCCATCTGTGGTGGGG - Intronic
930226170 2:48795885-48795907 ATCCTGTGCCCACTGTTGTGTGG + Intergenic
931774676 2:65530384-65530406 CACCTGTGCCAACAGTGGAGAGG + Intergenic
940328511 2:152450966-152450988 GAGCTGTGCCAACTGAGGATGGG - Intronic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
942953089 2:181744111-181744133 AAACTTTGGCAACTGTGGAAGGG + Intergenic
945054625 2:205857654-205857676 ATCCTTTGTCAACTGTGAAGAGG + Intergenic
945974655 2:216260792-216260814 CACCTGTGGCACCTGTGAAGAGG + Intronic
946361155 2:219220068-219220090 AACCTGTGCCAACTGTGGAGTGG - Exonic
948014132 2:234673934-234673956 TCCATGTGCCAACTGTGTAGTGG - Intergenic
949014928 2:241703376-241703398 AGCCTGTGTCAGCTGTGCAGGGG + Intronic
1175714805 20:61248165-61248187 AGCCTGGGCCACATGTGGAGAGG + Intergenic
1178907810 21:36650863-36650885 AACATGTGCCATCTTGGGAGTGG + Intergenic
1179088225 21:38239264-38239286 AACCTGTGGGAACTGAGCAGTGG - Intronic
1182887313 22:33786432-33786454 AACCTGTCTCAGCTTTGGAGAGG - Intronic
1184300435 22:43555681-43555703 GACCCGTGCCCACTGTGGGGAGG - Intronic
1185079313 22:48701033-48701055 AAGCACTGCCAGCTGTGGAGAGG + Intronic
952558118 3:34557223-34557245 CACCAGTGCTAACTGTGGAAGGG + Intergenic
953613591 3:44469336-44469358 CACCTGTGTAGACTGTGGAGTGG - Intronic
953958221 3:47247516-47247538 AACCTGAGCCCACAGGGGAGTGG + Intronic
960873498 3:122274428-122274450 AAGCAGTGCCATCTCTGGAGTGG + Intronic
961494384 3:127280604-127280626 CACCTCTGCCCACTTTGGAGGGG + Intergenic
961667478 3:128502785-128502807 AACCTGTGCCATCTGGAGAGTGG + Intergenic
967951875 3:194847590-194847612 AACCTGGGGAGACTGTGGAGTGG + Intergenic
968798067 4:2722377-2722399 AACCTGTGGAAGCTGTGCAGTGG + Intronic
970152712 4:13106890-13106912 AACCTGAGCAACCTGGGGAGTGG + Intergenic
970620498 4:17812288-17812310 AACGTGAACCAGCTGTGGAGAGG + Exonic
971301142 4:25443239-25443261 AGCCTGTGGTCACTGTGGAGGGG + Intergenic
974461071 4:62188618-62188640 AAGCTCTGGCCACTGTGGAGAGG + Intergenic
980831265 4:138131596-138131618 AAACTGTGCCAAGTGTGACGGGG + Intergenic
981054373 4:140345089-140345111 AACCAGTGCCAACAGTGGACTGG - Intronic
982009374 4:151092126-151092148 AACCTGTGCCCAATGTGGTCAGG + Intergenic
983869576 4:172809537-172809559 AACCTGTACTCACTGAGGAGTGG - Exonic
985857545 5:2441992-2442014 AACCTGTGTTGACTGTGGGGTGG - Intergenic
985930183 5:3051178-3051200 AACGTGTGTCAACAGTGGTGTGG - Intergenic
986978023 5:13415111-13415133 CAACTGTGCCACCTCTGGAGTGG + Intergenic
990364848 5:55060124-55060146 AACCCTTGCCCACTGTTGAGTGG + Intergenic
991917625 5:71620747-71620769 TGCCTGTGCCTTCTGTGGAGGGG + Intronic
998461069 5:142310601-142310623 AACCTGTGGCAACTTTGTGGTGG + Exonic
1003072984 6:2959165-2959187 TACCTGGGCCATCTGTGCAGCGG + Exonic
1006181480 6:32155757-32155779 ATACTGTCCCATCTGTGGAGAGG - Exonic
1007162561 6:39803746-39803768 AACCTGTGCAGGCTGTGGGGTGG + Intronic
1009577424 6:65484096-65484118 AGCCTGTGCCAAATGTGTACAGG - Intronic
1010812679 6:80317797-80317819 ATCCTGGGCCCACTGTGGTGAGG - Intronic
1012639574 6:101592352-101592374 TACTTGTGACAACTGTGAAGGGG - Intronic
1013165567 6:107588319-107588341 TAACTGTGCAGACTGTGGAGGGG - Intronic
1016274621 6:142334561-142334583 AAGATGTGCCAACAGTGGAATGG + Intronic
1019881344 7:3864041-3864063 AACCTGTGTGCACTGTGGATGGG - Intronic
1021574890 7:22097923-22097945 AAACTGTGCTAACTGGGCAGAGG + Intergenic
1021786482 7:24157566-24157588 AACATGTGCCATCTGTGGGCTGG + Intergenic
1023851473 7:44152585-44152607 CACCAGTGTCAACTGTGGAAGGG + Intronic
1024639828 7:51319417-51319439 CACTTGTGTCAACTGTGGGGAGG + Intergenic
1026653556 7:72236704-72236726 AAACTGTGCTAACTGTTGGGAGG + Intronic
1034274394 7:149817734-149817756 AAGCTGTGGCAACTGGTGAGGGG + Intergenic
1035522581 8:287113-287135 AACCTGCCCCGACAGTGGAGTGG + Intergenic
1042399991 8:68333594-68333616 AACCAGTGCCACCTGTGAAATGG + Intronic
1042807010 8:72781952-72781974 AATCTGTGGCAGCTGGGGAGAGG + Intronic
1051127752 9:13823217-13823239 AAACTGTACCAGCTGTGGTGAGG - Intergenic
1051724981 9:20079681-20079703 AACCTGTAGCAACTGTGAATGGG + Intergenic
1052541640 9:29817761-29817783 AACCTGTGGCAATGGTGGTGTGG - Intergenic
1058136743 9:101316100-101316122 AACCTGTAGAAACTTTGGAGTGG - Intronic
1194213814 X:91103026-91103048 AAACTGTGCAAGTTGTGGAGAGG - Intergenic
1195095858 X:101500421-101500443 AACATATGGCATCTGTGGAGTGG + Intronic
1195458879 X:105101131-105101153 ATCATGTGCCCACTGGGGAGAGG - Intronic
1195708613 X:107756795-107756817 GACCAGTGCCCTCTGTGGAGTGG + Intronic
1198499941 X:137233799-137233821 ATCCTGTCCTAACTGTGCAGGGG + Intergenic
1199881657 X:151978300-151978322 AACCTGTGCCCTGTGTGCAGTGG - Intergenic