ID: 946362838

View in Genome Browser
Species Human (GRCh38)
Location 2:219229412-219229434
Sequence AAGGGGCGCCGCCGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362838_946362853 17 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362838_946362854 26 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146
946362838_946362848 7 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362848 2:219229442-219229464 TACCCGCCGCGAGCTCACTTAGG 0: 1
1: 0
2: 0
3: 1
4: 14
946362838_946362849 8 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362849 2:219229443-219229465 ACCCGCCGCGAGCTCACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 12
946362838_946362855 27 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362838 Original CRISPR AAGGGGCGCCGCCGGCGGGG CGG (reversed) Intronic