ID: 946362840

View in Genome Browser
Species Human (GRCh38)
Location 2:219229416-219229438
Sequence GAGGAAGGGGCGCCGCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362840_946362848 3 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362848 2:219229442-219229464 TACCCGCCGCGAGCTCACTTAGG 0: 1
1: 0
2: 0
3: 1
4: 14
946362840_946362855 23 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362840_946362849 4 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362849 2:219229443-219229465 ACCCGCCGCGAGCTCACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 12
946362840_946362854 22 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146
946362840_946362853 13 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362840_946362856 28 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362840 Original CRISPR GAGGAAGGGGCGCCGCCGGC GGG (reversed) Intronic