ID: 946362841

View in Genome Browser
Species Human (GRCh38)
Location 2:219229417-219229439
Sequence GGAGGAAGGGGCGCCGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 476}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362841_946362856 27 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362841_946362853 12 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362841_946362849 3 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362849 2:219229443-219229465 ACCCGCCGCGAGCTCACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 12
946362841_946362848 2 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362848 2:219229442-219229464 TACCCGCCGCGAGCTCACTTAGG 0: 1
1: 0
2: 0
3: 1
4: 14
946362841_946362854 21 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146
946362841_946362855 22 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362841 Original CRISPR GGAGGAAGGGGCGCCGCCGG CGG (reversed) Intronic