ID: 946362843

View in Genome Browser
Species Human (GRCh38)
Location 2:219229429-219229451
Sequence GCGGCGGGTAACGGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 130}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362843_946362861 26 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362843_946362855 10 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362843_946362854 9 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146
946362843_946362853 0 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362843_946362849 -9 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362849 2:219229443-219229465 ACCCGCCGCGAGCTCACTTAGGG 0: 1
1: 0
2: 0
3: 0
4: 12
946362843_946362856 15 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362843_946362859 25 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362843_946362848 -10 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362848 2:219229442-219229464 TACCCGCCGCGAGCTCACTTAGG 0: 1
1: 0
2: 0
3: 1
4: 14
946362843_946362863 27 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362843 Original CRISPR GCGGCGGGTAACGGAGGAAG GGG (reversed) Intronic