ID: 946362845

View in Genome Browser
Species Human (GRCh38)
Location 2:219229431-219229453
Sequence TCGCGGCGGGTAACGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362845_946362859 23 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362845_946362861 24 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362845_946362864 30 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362845_946362863 25 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362845_946362853 -2 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362845_946362854 7 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146
946362845_946362855 8 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362845_946362856 13 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362845 Original CRISPR TCGCGGCGGGTAACGGAGGA AGG (reversed) Intronic