ID: 946362850

View in Genome Browser
Species Human (GRCh38)
Location 2:219229444-219229466
Sequence GCCCTAAGTGAGCTCGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362850_946362855 -5 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362850_946362864 17 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362850_946362859 10 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362850_946362856 0 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362850_946362865 18 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362850_946362863 12 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362850_946362861 11 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362850_946362854 -6 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362850 Original CRISPR GCCCTAAGTGAGCTCGCGGC GGG (reversed) Intronic
900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG + Intergenic
902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG + Intergenic
905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG + Exonic
916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG + Exonic
916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG + Intronic
919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG + Intronic
1076649798 10:131980018-131980040 GCCCTGAGTGTCCGCGCGGCAGG - Intronic
1076864954 10:133161924-133161946 GCTCCAAGTGGGCTCGCGCCTGG - Intronic
1083063562 11:59899632-59899654 GCCCTAAGTGAAGACGGGGCAGG + Intergenic
1083355867 11:62065628-62065650 GCCCTTAGTGAGCTGGTGGTGGG + Intergenic
1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG + Intronic
1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG + Intronic
1103393766 12:120592304-120592326 GCCCTAACTGAGCACCCAGCCGG - Intergenic
1112505524 13:99972312-99972334 GCCCTAGGTGAGCGCTAGGCAGG - Intergenic
1132460800 16:53651-53673 GACCAATGTGAGCTCGAGGCGGG - Intronic
1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG + Intronic
1138169541 16:54836001-54836023 GCCCTAAGTGAGGTCAAGTCAGG + Intergenic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140505731 16:75471028-75471050 GCCCTTAGTGAGGCCGAGGCAGG - Intergenic
1143638955 17:8184391-8184413 GCCCTTTGGGAGCTCGAGGCGGG + Intergenic
1146132753 17:30292346-30292368 GCCAAAAGGGAGCTCGAGGCGGG + Intergenic
1151612088 17:75182798-75182820 GCCCAAGGTGAGCTCGCCGCCGG - Intergenic
1156527196 18:37778278-37778300 GCCCTGAGGGAGCTCACTGCAGG - Intergenic
1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
927105418 2:19819513-19819535 GTCCTCAGTGAGCTCGAGGGAGG - Intergenic
930379286 2:50607192-50607214 GTCTGAAGTGAGCTGGCGGCAGG - Intronic
934553204 2:95274640-95274662 GCCCTGAGTCAGCTGGCTGCAGG + Exonic
939334444 2:140807595-140807617 GCACTTTGTGAGCTCGAGGCAGG - Intronic
941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG + Intronic
1173649053 20:44651559-44651581 GCCCAAAGTGAGCGCGCGCGGGG - Exonic
1178824720 21:36005296-36005318 GCCCCAAATGAGCACGGGGCAGG - Intergenic
1179537521 21:42062035-42062057 TCCCCACGTGAACTCGCGGCAGG + Intergenic
964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG + Intergenic
971196073 4:24472309-24472331 GTACCAAGTGAGCGCGCGGCAGG + Intergenic
971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
976800796 4:88989353-88989375 GCACTTAGGGAGGTCGCGGCAGG + Intronic
985128827 4:186722082-186722104 GCCCTATGGGAGGTCGAGGCGGG - Intronic
985620432 5:952171-952193 GCCCTGGGAGAGCTGGCGGCAGG + Intergenic
1000196470 5:158963920-158963942 GCCCTCAAGGAGCTCGCTGCTGG + Intronic
1024604698 7:51013953-51013975 GCCCTCAGTGAGCTCGGGTCTGG + Intergenic
1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG + Intronic
1036136416 8:6165690-6165712 GCCCTAAGTGTGCTCCAGCCTGG + Intergenic
1036464292 8:8982046-8982068 GCACTTAGTGAGGTCGAGGCAGG + Intergenic
1041689892 8:60678672-60678694 GCCCGGAGGGAGCTGGCGGCGGG + Intergenic
1057376959 9:94533733-94533755 GCACTTAGTGAGGTCGAGGCTGG - Intergenic
1191850249 X:65581021-65581043 GCCCTGAGTGAGCTGGCTGCTGG - Intergenic
1200253726 X:154568192-154568214 GCCCTAGGTGAGCGCTCTGCTGG + Intergenic
1200264043 X:154636216-154636238 GCCCTAGGTGAGCGCTCTGCTGG - Intergenic