ID: 946362851

View in Genome Browser
Species Human (GRCh38)
Location 2:219229445-219229467
Sequence AGCCCTAAGTGAGCTCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362851_946362856 -1 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362851_946362864 16 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362851_946362863 11 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362851_946362854 -7 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362854 2:219229461-219229483 TAGGGCTCCGCAGGCACCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 146
946362851_946362861 10 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362851_946362859 9 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362851_946362865 17 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362851_946362855 -6 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362851 Original CRISPR AGCCCTAAGTGAGCTCGCGG CGG (reversed) Intronic