ID: 946362853

View in Genome Browser
Species Human (GRCh38)
Location 2:219229452-219229474
Sequence GAGCTCACTTAGGGCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362844_946362853 -1 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362840_946362853 13 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362836_946362853 19 Left 946362836 2:219229410-219229432 CCCCGCCCCGCCGGCGGCGCCCC 0: 1
1: 1
2: 10
3: 155
4: 1155
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362845_946362853 -2 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362839_946362853 14 Left 946362839 2:219229415-219229437 CCCCGCCGGCGGCGCCCCTTCCT 0: 1
1: 0
2: 0
3: 27
4: 206
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362838_946362853 17 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362847_946362853 -9 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362842_946362853 9 Left 946362842 2:219229420-219229442 CCGGCGGCGCCCCTTCCTCCGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362841_946362853 12 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362846_946362853 -6 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362837_946362853 18 Left 946362837 2:219229411-219229433 CCCGCCCCGCCGGCGGCGCCCCT 0: 1
1: 0
2: 4
3: 72
4: 601
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362843_946362853 0 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60
946362835_946362853 20 Left 946362835 2:219229409-219229431 CCCCCGCCCCGCCGGCGGCGCCC 0: 1
1: 0
2: 4
3: 139
4: 1174
Right 946362853 2:219229452-219229474 GAGCTCACTTAGGGCTCCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362853 Original CRISPR GAGCTCACTTAGGGCTCCGC AGG Intronic