ID: 946362855

View in Genome Browser
Species Human (GRCh38)
Location 2:219229462-219229484
Sequence AGGGCTCCGCAGGCACCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 199}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362845_946362855 8 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362851_946362855 -6 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362836_946362855 29 Left 946362836 2:219229410-219229432 CCCCGCCCCGCCGGCGGCGCCCC 0: 1
1: 1
2: 10
3: 155
4: 1155
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362852_946362855 -9 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362844_946362855 9 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362842_946362855 19 Left 946362842 2:219229420-219229442 CCGGCGGCGCCCCTTCCTCCGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362843_946362855 10 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362840_946362855 23 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362837_946362855 28 Left 946362837 2:219229411-219229433 CCCGCCCCGCCGGCGGCGCCCCT 0: 1
1: 0
2: 4
3: 72
4: 601
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362846_946362855 4 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362847_946362855 1 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362835_946362855 30 Left 946362835 2:219229409-219229431 CCCCCGCCCCGCCGGCGGCGCCC 0: 1
1: 0
2: 4
3: 139
4: 1174
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362850_946362855 -5 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362838_946362855 27 Left 946362838 2:219229412-219229434 CCGCCCCGCCGGCGGCGCCCCTT 0: 1
1: 1
2: 1
3: 27
4: 275
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362839_946362855 24 Left 946362839 2:219229415-219229437 CCCCGCCGGCGGCGCCCCTTCCT 0: 1
1: 0
2: 0
3: 27
4: 206
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199
946362841_946362855 22 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG 0: 1
1: 0
2: 0
3: 51
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362855 Original CRISPR AGGGCTCCGCAGGCACCCCT GGG Intronic
900673972 1:3872598-3872620 AGGGCCCTGCAGGCACTCGTGGG - Intronic
900965386 1:5953737-5953759 AAGGCTCCCCAGGCAGCCCAGGG - Intronic
902372192 1:16013849-16013871 TGGGCTCCCCAGACCCCCCTGGG - Intergenic
902803420 1:18845714-18845736 AGGACTCACCAGGCAACCCTGGG + Intronic
903668664 1:25022770-25022792 TGGGCTCCCCTGGCACCCATGGG + Intergenic
905441091 1:37997005-37997027 AGGACTTCCCAGGCACCCATAGG + Exonic
912093728 1:106114070-106114092 AAGGGTCTGCAAGCACCCCTTGG + Intergenic
912482053 1:109990419-109990441 AGAGCTACGGAGGCACTCCTTGG - Intronic
915367596 1:155324438-155324460 GGGGCTCCGCAGGCAGGACTGGG + Intronic
918143646 1:181737878-181737900 AGGGCTCTGCAGCCACCCATGGG + Intronic
920370650 1:205477418-205477440 ACAGCTTCGCAGGCACACCTGGG - Intergenic
920685356 1:208105103-208105125 AGGTCTCCGCAGCCTGCCCTAGG + Intronic
920697919 1:208195730-208195752 TGAGCTCAGCAGACACCCCTGGG - Intronic
921675189 1:217968587-217968609 ATGGGTCTGCAGGCACCCCTTGG + Intergenic
922109734 1:222545424-222545446 AGAGATTCGCAGGCTCCCCTCGG + Intronic
922732101 1:227954033-227954055 TGGGCTCAGCAGACGCCCCTGGG - Intergenic
923779779 1:237011920-237011942 AGGGCTCCAGAGTCACCCCCAGG + Intergenic
923786262 1:237071787-237071809 GCAGCTCGGCAGGCACCCCTCGG - Intronic
924511416 1:244731298-244731320 GGGGCTGCGCAGCCTCCCCTGGG + Intergenic
1063116162 10:3073425-3073447 ACACCTCCGCAGGCTCCCCTAGG - Intronic
1070833703 10:79435388-79435410 ACGGCCCCACAGGCATCCCTGGG + Intronic
1071488393 10:86118943-86118965 AGGTCTCCTTAGGCACCTCTTGG - Intronic
1072656477 10:97333934-97333956 CGGGCCCCGCAAGCGCCCCTGGG - Exonic
1073100485 10:101003881-101003903 AGGGCCCAGTAGGGACCCCTCGG - Exonic
1073250935 10:102120028-102120050 AGGGGTCCGCAGGGACGGCTGGG + Intronic
1074401042 10:113141379-113141401 AGGCCTCCACAGGAACCCCAGGG + Intronic
1074446599 10:113525906-113525928 AGGTGGCAGCAGGCACCCCTCGG + Intergenic
1076568295 10:131413554-131413576 AGGGCTCTGTAGGCCCCTCTGGG - Intergenic
1077145085 11:1041066-1041088 AGGGCTCCCCGGGCACCCACTGG + Intergenic
1077185629 11:1234241-1234263 ACAGCTCGGCGGGCACCCCTGGG + Exonic
1077318321 11:1928972-1928994 AGGGCCCCGCAGGCACACCCTGG + Intronic
1077360808 11:2139477-2139499 AGGGCTCCGCGGGCGCCCATTGG - Intronic
1081745819 11:45471550-45471572 AGTCCTCCCCAGGCATCCCTGGG - Intergenic
1084098909 11:66932450-66932472 AGGGTTCCACAGAGACCCCTTGG + Intronic
1084374413 11:68766258-68766280 AGGGGTCCCCAGGCTCTCCTAGG + Intronic
1085310473 11:75513780-75513802 AGGGTTCCCCTGGCACCCATAGG + Intronic
1088786652 11:113188321-113188343 GGGGCTCCTCAGTCACCCCCAGG + Intronic
1088828538 11:113515890-113515912 AGGGCTACGGAGGCTCCCCTTGG + Intergenic
1089202569 11:116733233-116733255 AGGGCTCCTCAGAAACCCCCTGG + Intergenic
1089247582 11:117133459-117133481 TGTGATCCGCAGCCACCCCTCGG - Intergenic
1089612895 11:119679483-119679505 AGGCCTCCGCTGGCTCCCCATGG + Intronic
1090815952 11:130295789-130295811 AGGACTCCGCATGCATTCCTGGG - Intronic
1091205259 11:133816623-133816645 AGCGCTCAGCAGCCTCCCCTGGG + Intergenic
1091284980 11:134403447-134403469 AGGGCTGCCCAGGCACCCTGTGG - Intronic
1091564650 12:1639570-1639592 ACGGCTCTGCTGACACCCCTGGG - Intronic
1094847664 12:34368420-34368442 AGGGATGCGCAGGGTCCCCTGGG + Intergenic
1094851412 12:34383944-34383966 AGGGGCCCTCAGGGACCCCTGGG + Intergenic
1094854223 12:34395778-34395800 AGGGATGCGCAGGGACCCCTGGG - Intergenic
1096355562 12:50938150-50938172 AGGGGCCTGCAGGCACCCCTTGG - Intergenic
1096500137 12:52059786-52059808 AGGGCCCTGCAGTGACCCCTGGG - Intergenic
1097536184 12:60873157-60873179 ATGGGCCTGCAGGCACCCCTTGG - Intergenic
1104981058 12:132573315-132573337 AGGGCCCAGCACGCACCCCTGGG + Intronic
1106196266 13:27496921-27496943 AGGCCCCCTAAGGCACCCCTGGG + Intergenic
1107166392 13:37286072-37286094 AGGGCTCCCTAGGAGCCCCTGGG + Intergenic
1109837417 13:67877691-67877713 GTGGGTCTGCAGGCACCCCTTGG + Intergenic
1111474304 13:88725414-88725436 ATGGGCCCCCAGGCACCCCTTGG + Intergenic
1113910907 13:113840829-113840851 AGGGCTCCGTGGGGAACCCTGGG + Intronic
1113926121 13:113942718-113942740 AGGGCGCGGTAGGAACCCCTGGG + Intergenic
1116159778 14:41253695-41253717 ATGGATCTGCAGGCACACCTTGG - Intergenic
1119538871 14:75426154-75426176 AGGCCTCCCAAGTCACCCCTTGG + Intergenic
1119688635 14:76653296-76653318 AGGACTCCAAAGCCACCCCTGGG + Intergenic
1122312550 14:100806431-100806453 AGGGCTCTTCAGGGACCCCCAGG - Intergenic
1122557667 14:102590463-102590485 AGGGCTCCACACACAGCCCTGGG - Intergenic
1122938343 14:104970195-104970217 TGGGCTCCGCCGGCACCCCAGGG + Intronic
1126242375 15:46460039-46460061 AGGCCCATGCAGGCACCCCTGGG + Intergenic
1127113783 15:55703355-55703377 AGGGCTCTTCAGCTACCCCTTGG + Intronic
1129407312 15:75328122-75328144 CAGGCTCTGCAGGCACACCTGGG - Intergenic
1130903218 15:88222908-88222930 CGGGTTCCTCAGGGACCCCTTGG - Intronic
1130976370 15:88778652-88778674 AGGGCTCACCAGGCACCCTCTGG + Intergenic
1132588249 16:715444-715466 AGGACCCCCCAGGCGCCCCTCGG + Intronic
1133423496 16:5667000-5667022 AGGACTCCGGAAGCAGCCCTTGG - Intergenic
1135564402 16:23500389-23500411 ACAGCTCCGCAGACCCCCCTGGG - Intronic
1136393847 16:29982344-29982366 ACGGCTCCTCAGGCCCCCATGGG - Intronic
1136515601 16:30766374-30766396 AAGGCTCCGCAGGGCCACCTGGG - Exonic
1138527141 16:57615412-57615434 ACTGCTCCGCAGCCAGCCCTAGG - Intronic
1140663036 16:77206342-77206364 TGGGCTCTGCAGACACCCGTGGG - Intronic
1142642986 17:1295411-1295433 GGGCCTCAGCAGGCAGCCCTGGG - Intronic
1142683176 17:1562183-1562205 ACGGCTCCTCAGGCGCCCCGGGG - Intronic
1143205569 17:5137766-5137788 AGGGCTCCCCAGGCCCCACTGGG - Intronic
1143389091 17:6549570-6549592 AGGCCTCCACAGGCACACGTGGG + Intronic
1144553286 17:16260143-16260165 ATGGGCCTGCAGGCACCCCTTGG + Intronic
1144663628 17:17087519-17087541 AGGGCTCTGCAGGTCACCCTGGG + Intronic
1144876610 17:18400455-18400477 AGGGCTCCCCAGGCCCCACTGGG - Intergenic
1145155616 17:20543965-20543987 AGGGCTCCCCAGGCCCCACTGGG + Intergenic
1145761284 17:27426575-27426597 AGTGCTCCCCAGGCCCCACTGGG - Intergenic
1146161330 17:30560732-30560754 AGTGCTCCCCAGGCCCCACTGGG - Intronic
1146705325 17:34997025-34997047 GGGGCTCCAGTGGCACCCCTGGG + Intronic
1146843057 17:36168029-36168051 AGGGCTCCCCAGGCCCCGCTGGG + Intronic
1146855362 17:36255970-36255992 AGGGCTCCCCAGGCCCCGCTGGG + Intronic
1146865259 17:36332405-36332427 AGGGCTCCCCAGGCCCCGCTGGG - Intronic
1146871268 17:36379881-36379903 AGGGCTCCCCAGGCCCCGCTGGG + Intronic
1146878628 17:36430963-36430985 AGGGCTCCCCAGGCCCCGCTGGG + Intronic
1146882576 17:36452109-36452131 AGGGCTCCCCAGGCCCCGCTGGG + Intergenic
1147068119 17:37932999-37933021 AGGGCTCCCCAGGCCCCGCTGGG - Intronic
1147074154 17:37980505-37980527 AGGGCTCCCCAGGCCCCGCTGGG + Intronic
1147079649 17:38012554-38012576 AGGGCTCCCCAGGCCCCGCTGGG - Intronic
1147085676 17:38060043-38060065 AGGGCTCCCCAGGCCCCGCTGGG + Intronic
1147095590 17:38136496-38136518 AGGGCTCCCCAGGCCCCGCTGGG - Intergenic
1147101623 17:38184009-38184031 AGGGCTCCCCAGGCCCCGCTGGG + Intergenic
1147140104 17:38455860-38455882 TGGGCTCCCCAGGCCCCCATGGG + Intronic
1147536336 17:41325133-41325155 AGGGCTACACAGGTACCCCCAGG + Intergenic
1148343910 17:46890752-46890774 AGGGCTCCTGAGGGACCCCATGG - Intergenic
1149846221 17:60010515-60010537 AGGGCTCCCCAGGCCCCGCTGGG + Intergenic
1150084570 17:62267095-62267117 AGGGCTCCCCAGGCCCCGCTGGG + Intergenic
1154308261 18:13246291-13246313 AGGGCTGCACAGGGACCCCAAGG - Intronic
1155413245 18:25569054-25569076 AGGGCTGAGCAGGCAGCCCAAGG + Intergenic
1156203166 18:34857009-34857031 AGGGCTCTGCAGGGGCACCTGGG + Intronic
1159292406 18:66439815-66439837 GCAGGTCCGCAGGCACCCCTCGG + Intergenic
1159601950 18:70436519-70436541 AGGGCCAGGCAGGAACCCCTAGG + Intergenic
1159950564 18:74479682-74479704 AGGGCACAGCAGCCTCCCCTGGG - Intergenic
1160157133 18:76442551-76442573 AGGGGTCCGCATGCGCCCCGGGG - Exonic
1160700058 19:501828-501850 AGGGCTCCACACACACCCCCAGG + Exonic
1160933291 19:1580880-1580902 AGGGCGAGCCAGGCACCCCTTGG - Intronic
1161349335 19:3783580-3783602 AGGGCCCCCCAGGCACCCCCAGG - Intronic
1163313185 19:16526058-16526080 AGGGCACCCCAGGCACCCATGGG + Intronic
1165712597 19:38022839-38022861 GGGGCTCAGCAGGGAGCCCTGGG + Intronic
1165797143 19:38525957-38525979 AGGGCTCAGCAGGAACCCAGAGG - Intronic
1168008063 19:53507203-53507225 AGGACCCCACAGGCACCTCTAGG - Intergenic
925003775 2:426526-426548 AGGGCTCCGCAGGCACAAAGGGG + Intergenic
925003799 2:426605-426627 GGGGCTCCGCAGGCACGCAGGGG + Intergenic
925003828 2:426704-426726 GGGGCTCCGCAGGCACGCAGGGG + Intergenic
925003840 2:426744-426766 GGGGTTCCGCAGGCACGCCGGGG + Intergenic
925003847 2:426764-426786 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925003872 2:426844-426866 GGGGCTCCGCTGGCACGCCTGGG + Intergenic
925003885 2:426884-426906 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925003892 2:426904-426926 GGGGCTCCGCAGGCACGCAGGGG + Intergenic
925003926 2:427004-427026 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925003959 2:427104-427126 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925003966 2:427124-427146 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925003992 2:427204-427226 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925004026 2:427305-427327 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925004033 2:427325-427347 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925004053 2:427385-427407 GGGGCTCCGCAGGCACGCCGGGG + Intergenic
925004066 2:427425-427447 GGGGCTCCGCAGGCACGCAGGGG + Intergenic
925004079 2:427465-427487 GGGGCTCCGCAGGCACGCAGGGG + Intergenic
925004097 2:427525-427547 GGGGCTCCGCAGGCACGCAGGGG + Intergenic
925997321 2:9304048-9304070 AGGGCTCCGCAGGCTGCCAGTGG - Intronic
926637786 2:15202101-15202123 AGGGCACTGCAAACACCCCTTGG + Intronic
927843188 2:26457942-26457964 TGGGCTCCTCAGGCTCCCCAGGG + Exonic
931557171 2:63518610-63518632 AAAGCTCACCAGGCACCCCTAGG + Intronic
931995677 2:67837157-67837179 AGGACTCCTCAGGGACCTCTGGG - Intergenic
936088824 2:109488112-109488134 TGGGCTCCGCCGGGACACCTGGG + Intronic
939900343 2:147844005-147844027 TGGGCGCCGCAGACGCCCCTTGG + Intergenic
940956989 2:159738903-159738925 ATGGGTCTGCAGGCATCCCTTGG - Intronic
943525304 2:189008922-189008944 AGGGCTCCCCAGGCCACCCAGGG + Exonic
944022827 2:195126186-195126208 AAGGGCCTGCAGGCACCCCTTGG + Intergenic
946078413 2:217095508-217095530 AGGGCTCCACAGCCACCTCCAGG + Intergenic
946362855 2:219229462-219229484 AGGGCTCCGCAGGCACCCCTGGG + Intronic
948462982 2:238139160-238139182 AGGTGTCAGCAGGCACCCCGAGG + Intronic
948598965 2:239097282-239097304 AGCGCTCAGCAGGCATGCCTCGG + Intronic
948648646 2:239424981-239425003 AGGGCTGCGGAGGAACCCCAGGG + Intergenic
1169080699 20:2796426-2796448 AGCGCACCTCAGGCTCCCCTGGG + Exonic
1169216599 20:3797756-3797778 AGATCTCCCCAGGCTCCCCTGGG - Intronic
1172026754 20:31953842-31953864 GGGGCTCACCAGGCATCCCTCGG + Intergenic
1175277149 20:57779931-57779953 TGAGCTCTGCAGGCACCCCCAGG - Intergenic
1176120116 20:63450487-63450509 TGGGCGCTGCAGTCACCCCTGGG + Intronic
1176268339 20:64222348-64222370 AGAGCTCTGCAGGAAGCCCTCGG + Intronic
1180123273 21:45768191-45768213 AGGCCTCAGCAGGCACCACACGG - Intronic
1180201980 21:46229516-46229538 AGGGCGCCGCCGGCGTCCCTGGG + Intergenic
1180718905 22:17892161-17892183 AGGGCTCCGCTGACAACCCTGGG + Intronic
1180840610 22:18957234-18957256 AGGGCTCCTCACGCACACCCAGG + Intergenic
1181060879 22:20281540-20281562 AGGGCTCCTCATGCACACCCAGG - Intronic
1181515023 22:23405347-23405369 AGGGCTCCTCACGCACACCCAGG - Intergenic
1184536570 22:45091655-45091677 AGGGATCCGCAGGGCCCCCGAGG - Intergenic
1184604327 22:45563456-45563478 AGCGCTCCTCAGTCAGCCCTCGG - Intronic
1184715706 22:46280587-46280609 AGGGGACCGTGGGCACCCCTGGG - Intronic
1184832208 22:46996053-46996075 AGGGGTCTGCAGGCACCACCTGG - Intronic
1185023049 22:48391590-48391612 CGGGCTCCGCACCCACCCCCAGG - Intergenic
1185102681 22:48850133-48850155 TGGACTCCACAGGCACCTCTGGG + Intronic
1185176466 22:49330079-49330101 AGGGCTTAGCAGACACCCTTAGG + Intergenic
1185373005 22:50469530-50469552 ACGGCTCCGCAGGCCTCCCAGGG + Intronic
952533876 3:34290075-34290097 AGGGCTCCCCAGGCTCACCTGGG + Intergenic
954107026 3:48414960-48414982 AGGGGTCCTCAGGCAGGCCTGGG + Exonic
961356693 3:126343997-126344019 AGGTCTGCGCAGCCACCCTTTGG - Intronic
961745551 3:129061737-129061759 AGGGCTCCCCAGGCAGGCATGGG - Exonic
962682306 3:137813123-137813145 AGGGCTGCTGGGGCACCCCTAGG + Intergenic
967092783 3:186149555-186149577 AGGGCTCAGCAGGCGCACGTTGG - Exonic
972290480 4:37686265-37686287 ATGGCTCCGCGGGCACTCCCGGG - Exonic
978184072 4:105836535-105836557 ATGGGCCTGCAGGCACCCCTTGG - Intronic
978498436 4:109384499-109384521 ATGGGCCTGCAGGCACCCCTTGG + Intergenic
978813975 4:112882051-112882073 AGGGCTCCTCAGGCTCTCATCGG + Intronic
981727395 4:147862073-147862095 AGGGGCCTGCAGGCACCTCTTGG - Intronic
982802640 4:159723224-159723246 ATGGGCCTGCAGGCACCCCTTGG - Intergenic
984565251 4:181322294-181322316 AGGTCTCCTCAGGCGCCTCTTGG + Intergenic
984947796 4:184983404-184983426 AGGGTGCAGCAGGCACACCTTGG - Intergenic
985538330 5:476495-476517 AGGACCCCGCAGGGACCCCGTGG - Intronic
986290921 5:6398065-6398087 TGGGGGCCGCAGGCACTCCTTGG - Intergenic
986454092 5:7898484-7898506 AGGGCTCAGAAGGAAACCCTGGG + Intronic
986730823 5:10633665-10633687 ATGGCTCCTCAGGCTCCTCTTGG + Intronic
987488889 5:18552164-18552186 AGGGCTCCTCAAGCACGCCGAGG + Intergenic
992017972 5:72594938-72594960 TGTGCTCTGCAGGCGCCCCTGGG - Intergenic
995862970 5:116661180-116661202 ATGGGTCCGTAGGCACCTCTTGG + Intergenic
997585662 5:135041489-135041511 AGGGCTGCACAGGCACTCCTGGG + Intronic
998063229 5:139135519-139135541 AGGGCTCCACAGGCCCAGCTGGG + Intronic
998079929 5:139266373-139266395 AGGGCTCGGCAGGCAGCGCTAGG - Intronic
998855633 5:146392577-146392599 AGGGCCCTGCAGGCAGCCCCTGG + Intergenic
1001541862 5:172545346-172545368 AGGGGTGCTCAGGCAGCCCTGGG - Intergenic
1002188778 5:177468306-177468328 AGGCCTCCACAGGCACCCCCAGG + Intronic
1002662894 5:180803196-180803218 CGGGCTCCTCAGCCTCCCCTGGG - Intronic
1003129960 6:3386871-3386893 AGGGCGGGGCAGGCACCCCAGGG + Intronic
1006182532 6:32162961-32162983 AGGGGTCCCCAGGAACTCCTCGG + Exonic
1010210331 6:73357861-73357883 AGGGCAAGGCAGGCATCCCTAGG - Intergenic
1011822655 6:91271619-91271641 GTGGGTCTGCAGGCACCCCTAGG - Intergenic
1016994024 6:149948207-149948229 GGGGTTCCACAGGCACCACTGGG + Intronic
1017718062 6:157225680-157225702 AGGGGCCCGCAGGCTGCCCTTGG + Intergenic
1017750289 6:157485234-157485256 AGGGCACCACAGGCACCCCCAGG - Intronic
1018085420 6:160297524-160297546 AGGGCTCAGCAGCCACCACAAGG - Intergenic
1018804530 6:167248703-167248725 AGGGCTTCGCATGCTCCCCGGGG + Intergenic
1018825822 6:167407378-167407400 AGGGCTCCGCATGCTCCCCGGGG + Intergenic
1019519930 7:1456011-1456033 AGGTCTCCTCATGCAGCCCTTGG - Intronic
1021106427 7:16644878-16644900 AGGCCTCCACACCCACCCCTCGG - Intronic
1021970013 7:25956656-25956678 AGGGCTCCGGAGGCACACAGAGG - Intergenic
1023157507 7:37265751-37265773 AGGGCTCAGCACAGACCCCTGGG - Intronic
1023339036 7:39199701-39199723 AGGGATCTGCAGGCACCCTGTGG + Intronic
1024428585 7:49259944-49259966 AGGGCTCTGCAAGCATCCTTTGG + Intergenic
1024472075 7:49775056-49775078 TGGGCTCCGCAAGCCGCCCTTGG + Intronic
1026899430 7:74028590-74028612 AGGGCCCAGCGGGAACCCCTGGG + Intronic
1029211200 7:98909647-98909669 AGGGCCCCGCCACCACCCCTGGG - Intronic
1029561024 7:101303046-101303068 GGGGCTCCGCAGTCCCCCCACGG + Intergenic
1031629671 7:124032303-124032325 GGGGCTCCCCCGGCGCCCCTGGG + Exonic
1032487886 7:132301692-132301714 ATGGCTCCTCCAGCACCCCTGGG - Intronic
1034557755 7:151860749-151860771 AGGGCACAGCAGGCATCCTTGGG - Intronic
1035636707 8:1152630-1152652 GAGGCCCTGCAGGCACCCCTGGG - Intergenic
1038230713 8:25697115-25697137 AGGGAGCCTCAGGAACCCCTGGG + Intergenic
1039967451 8:42293566-42293588 AGGGCTCCGCAGGGACTCACAGG - Intronic
1040998973 8:53430970-53430992 AGTGCTCCTCTGGCAGCCCTGGG + Intergenic
1042176846 8:66045768-66045790 AGGGCTCTGCAGGCTCCCCAGGG + Intronic
1048180728 8:132192164-132192186 TGGGCTCCGCAGGCTCCCTGCGG - Intronic
1048307346 8:133293414-133293436 AGGGCTCAGGAGGCTCACCTTGG + Intronic
1049216296 8:141409856-141409878 GGGCCCCCGCAGGCACCGCTGGG - Intronic
1049225278 8:141447838-141447860 AGGGTTCCGCAGGCATCCGAGGG - Intergenic
1049246606 8:141566061-141566083 AGGGCTTCCCAGGCAACCATGGG - Intergenic
1049282192 8:141755387-141755409 AGGGCTGCTCAGGCTCCCCAGGG + Intergenic
1049613832 8:143567823-143567845 TGGACTCCGCAGGTAGCCCTGGG + Exonic
1049644899 8:143731822-143731844 AGGCCCCCGCAGGGACCCTTTGG - Intronic
1049646348 8:143737556-143737578 GGGCCTCCACAGGCATCCCTAGG + Intergenic
1050020876 9:1283505-1283527 TGGGCACCAAAGGCACCCCTTGG + Intergenic
1056843631 9:90018764-90018786 GGGGATCCCCAGGCACCACTTGG + Intergenic
1060480378 9:124013750-124013772 AGGGCTGCGCAGGCAGGCCTGGG + Intronic
1060812709 9:126619033-126619055 AGGGCTCCGCCGGGCCCGCTGGG + Intronic
1061215153 9:129217545-129217567 AGGGCTTCCCAAGCATCCCTGGG - Intergenic
1061328899 9:129880086-129880108 AGGGCACGAGAGGCACCCCTAGG - Intronic
1061533913 9:131235824-131235846 AGGGCTGCGTGGGCATCCCTGGG - Intergenic
1062048097 9:134433629-134433651 AGGACTCCGCAAGCACACCGAGG + Intronic
1062334354 9:136058430-136058452 GGGGCTCCGGAGGCTCCCCAGGG + Intronic
1062346365 9:136117150-136117172 CGGGATCTGCAGGCACTCCTGGG + Intronic
1192180380 X:68912346-68912368 CGGGCACCGCAGCCGCCCCTCGG + Intergenic
1200251749 X:154557710-154557732 AGGGCCCCGCAGCCACTCCTTGG - Intronic
1200253956 X:154569394-154569416 AGGGCCCCGCAGCCACTCCTTGG - Intergenic
1200263813 X:154635014-154635036 AGGGCCCCGCAGCCACTCCTTGG + Intergenic
1200266018 X:154646706-154646728 AGGGCCCCGCAGCCACTCCTTGG + Intergenic