ID: 946362856

View in Genome Browser
Species Human (GRCh38)
Location 2:219229467-219229489
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 228}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362847_946362856 6 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362851_946362856 -1 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362852_946362856 -4 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362839_946362856 29 Left 946362839 2:219229415-219229437 CCCCGCCGGCGGCGCCCCTTCCT 0: 1
1: 0
2: 0
3: 27
4: 206
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362840_946362856 28 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362841_946362856 27 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362842_946362856 24 Left 946362842 2:219229420-219229442 CCGGCGGCGCCCCTTCCTCCGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362843_946362856 15 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362846_946362856 9 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362850_946362856 0 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362845_946362856 13 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362844_946362856 14 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type