ID: 946362856

View in Genome Browser
Species Human (GRCh38)
Location 2:219229467-219229489
Sequence TCCGCAGGCACCCCTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 228}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362840_946362856 28 Left 946362840 2:219229416-219229438 CCCGCCGGCGGCGCCCCTTCCTC 0: 1
1: 0
2: 3
3: 41
4: 274
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362842_946362856 24 Left 946362842 2:219229420-219229442 CCGGCGGCGCCCCTTCCTCCGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362844_946362856 14 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362839_946362856 29 Left 946362839 2:219229415-219229437 CCCCGCCGGCGGCGCCCCTTCCT 0: 1
1: 0
2: 0
3: 27
4: 206
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362852_946362856 -4 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362846_946362856 9 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362841_946362856 27 Left 946362841 2:219229417-219229439 CCGCCGGCGGCGCCCCTTCCTCC 0: 1
1: 0
2: 4
3: 51
4: 476
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362845_946362856 13 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362851_946362856 -1 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362847_946362856 6 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362843_946362856 15 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228
946362850_946362856 0 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362856 Original CRISPR TCCGCAGGCACCCCTGGGCA AGG Intronic
900090207 1:916997-917019 TCCTCTGGAACCCGTGGGCAGGG - Intergenic
900147919 1:1166475-1166497 ACCGCAGGGACGGCTGGGCAGGG + Intergenic
900620511 1:3584871-3584893 TCCCCAGGCACCTCCGGGCTGGG - Intronic
900981213 1:6047375-6047397 TCCCCAGGCACCGCTGGTAACGG + Intronic
901008117 1:6181347-6181369 TCTGCATTCATCCCTGGGCAAGG + Intronic
902195048 1:14792066-14792088 TCAGCAGGCAGCCCTGTGCTTGG - Intronic
903483600 1:23672987-23673009 TCCTCATGAACCACTGGGCATGG + Intergenic
903889313 1:26558907-26558929 CCCGCAGGCACCCCTGCACTCGG + Exonic
904489936 1:30852333-30852355 TCCAGAGCCAGCCCTGGGCAGGG + Intergenic
905396943 1:37672812-37672834 TCCCCAGACTCCCCTAGGCAAGG + Intergenic
905626223 1:39491934-39491956 TCCGCCGCCGCCCCTGGGCCCGG - Exonic
905868390 1:41388776-41388798 GCGGCAGGCACCCCGGGCCAGGG + Intergenic
906696156 1:47824771-47824793 TCCACAGGCAGCTCTGGGCCCGG - Intronic
907575531 1:55522566-55522588 TGTGCAGGCACTCTTGGGCATGG + Intergenic
911039330 1:93579478-93579500 CCTGCAGGCACCCCTGGACAAGG - Intronic
912454586 1:109789074-109789096 TGCGAAGAGACCCCTGGGCATGG - Intergenic
918143647 1:181737883-181737905 TCTGCAGCCACCCATGGGCTTGG + Intronic
920715363 1:208335547-208335569 GCCGCAGGCACACATGGGCCCGG + Intergenic
922720311 1:227896891-227896913 TCCCCAGGCATCCCAGTGCATGG + Intergenic
922732099 1:227954028-227954050 TCAGCAGACGCCCCTGGGCTGGG - Intergenic
922796713 1:228343108-228343130 TCCACAGCCACCCCTGAGCCTGG - Intronic
1067690130 10:48496636-48496658 TCAGCAGGCACCCGGGGACAAGG - Intronic
1067762160 10:49056584-49056606 CAGGCAGGCTCCCCTGGGCAGGG - Intronic
1069618560 10:69821988-69822010 TCCTGATGGACCCCTGGGCAGGG - Intronic
1072656474 10:97333929-97333951 CCCGCAAGCGCCCCTGGGCCCGG - Exonic
1072683063 10:97520678-97520700 CCAGCAGGCAGCCCTGGCCAGGG - Intronic
1073045569 10:100635854-100635876 TCCCCCTGCACACCTGGGCAAGG + Intergenic
1076156534 10:128210035-128210057 TCCGCAGGCAGCACGGGACAGGG - Intergenic
1076336564 10:129710434-129710456 TCCGCAGGCAGGCCTGGCCCAGG - Intronic
1076643053 10:131931840-131931862 TCGGAGGGCACCCCTGGGGATGG + Intronic
1077034442 11:487989-488011 GCTGCACGCACCCGTGGGCAGGG + Intronic
1077034464 11:488058-488080 GCTGCACGCACCCGTGGGCAGGG + Intronic
1077034488 11:488128-488150 GCTGCACGCACCCGTGGGCAGGG + Intronic
1077141146 11:1025474-1025496 TCAGCAGGCGCTCCTGTGCATGG - Intronic
1077217022 11:1399181-1399203 TGGGCAGGCCCCCCAGGGCAGGG + Intronic
1077541683 11:3149503-3149525 GCCACAGGCACACATGGGCAGGG - Intronic
1081907662 11:46679764-46679786 TCCACAGGCAGCCCTGGGGTGGG + Exonic
1083196338 11:61090817-61090839 TCCACAGGCACCCCTTGCCCTGG - Intergenic
1083272869 11:61580880-61580902 TCCGCCGCCGCCGCTGGGCATGG + Intronic
1084147686 11:67273758-67273780 TCAGCAGCCACGCCTGGGCATGG - Intronic
1084891363 11:72238641-72238663 CCCACAGGCACCCCTGGGGCTGG - Exonic
1085351246 11:75799210-75799232 TCCCCAGCCACACCTGTGCATGG - Intronic
1085410397 11:76287403-76287425 TCTGAAGACAGCCCTGGGCAAGG - Intergenic
1085639349 11:78182677-78182699 TCCACATGAAGCCCTGGGCAAGG - Intronic
1085788169 11:79473233-79473255 TCCGCAGGGCCCCCTGAGAAAGG + Intergenic
1087774234 11:102243082-102243104 TGCTCAGGCTGCCCTGGGCAGGG - Intergenic
1088469288 11:110176497-110176519 TCCCCAGGCACCCCGTGGCTGGG - Intronic
1089495072 11:118903659-118903681 TCCACAGGCTCCCATGGGCCTGG + Intronic
1089515452 11:119029046-119029068 CCCGCAGGCACCCATGTCCATGG + Intronic
1090116639 11:123980108-123980130 CCTGCAGGCACCCCTTGGCCTGG - Intergenic
1090996602 11:131871757-131871779 TCCCCAGGGAGCCCAGGGCAGGG - Intronic
1091769667 12:3142676-3142698 ACCGCAGGCACCCGGGGGCAGGG - Intronic
1092716481 12:11394238-11394260 CCAGCAGGCACTCCTGGCCAGGG + Intronic
1092860420 12:12715564-12715586 TCTGCAGGCAACCCAGGGCCTGG + Intronic
1096037490 12:48485474-48485496 CTAGCAGGAACCCCTGGGCAAGG + Intronic
1096244118 12:49974836-49974858 TCTGCTGGCAGCCCTGGGGAGGG + Intronic
1096491338 12:52014802-52014824 TCCGCGGGGACGCCCGGGCACGG - Exonic
1096537687 12:52286026-52286048 TCCGCTGGCACCCATAGGAAGGG - Exonic
1100460570 12:94795419-94795441 TCCCCAGGCACACCCGGACATGG + Intergenic
1102726796 12:115072784-115072806 TCCACAGACACCCTGGGGCAGGG - Intergenic
1103173636 12:118843590-118843612 ACTGCAGGCACCCCTCAGCACGG + Intergenic
1103609839 12:122116609-122116631 GGGGCAGGGACCCCTGGGCAGGG - Intronic
1103849172 12:123920387-123920409 GCCACAGGCCCCACTGGGCATGG + Intronic
1104370459 12:128219646-128219668 TCTGTAGGCAGCCTTGGGCATGG + Intergenic
1104750373 12:131234630-131234652 ACCGCAGCCACACCTGGGCCAGG + Intergenic
1104782347 12:131429832-131429854 ACCGCAGCCACACCTGGGCCAGG - Intergenic
1106541963 13:30698385-30698407 GTCACAGGCACCTCTGGGCAGGG - Intergenic
1110185394 13:72668333-72668355 TGAGCAGGCCCCCCAGGGCATGG + Intergenic
1111123035 13:83879343-83879365 ACCGCAGGCACCCCGGGGGCTGG - Exonic
1113485850 13:110651953-110651975 TCCGACTGCACCCCTGGCCAGGG + Intronic
1117615624 14:57531113-57531135 TCAGCAGGCTCCCCTGGTAATGG - Intergenic
1118318891 14:64741987-64742009 TCCGGAGGGAGCCCTGGGAAGGG + Exonic
1119100019 14:71871043-71871065 TCAGCTGGAACCCCTGGGCTGGG - Intergenic
1120759376 14:88272079-88272101 TCCACAGGAAACACTGGGCAGGG + Intronic
1122634101 14:103122313-103122335 TCCGCTGGCCCCCCTGGTCCTGG + Intergenic
1122887563 14:104717214-104717236 TCCTCAGTCCCCCCCGGGCAGGG + Intronic
1122919724 14:104875025-104875047 TTCCCCAGCACCCCTGGGCAAGG - Intronic
1124268162 15:28256076-28256098 TCCCCAGGCCCACCTGCGCAGGG + Exonic
1125719056 15:41836386-41836408 ACCCCAGCCAGCCCTGGGCAGGG - Intronic
1127309481 15:57739739-57739761 CCCACAGGCTCCCCTGGGCATGG + Intronic
1128344053 15:66842639-66842661 CCCGCAGGCCCCGCGGGGCACGG - Intergenic
1128796844 15:70472494-70472516 TCCCCAGTCACCCCAGGGCCAGG + Intergenic
1129525208 15:76209266-76209288 TCTCCAGCCAGCCCTGGGCAAGG + Intronic
1132109294 15:99090490-99090512 TCCCCAGGCAGCCATGGGCCCGG - Intergenic
1132469874 16:96518-96540 TCCAAAGGCACAGCTGGGCATGG + Intronic
1132556098 16:573338-573360 CCCACAGCCACCCCAGGGCAGGG - Intronic
1132678330 16:1129851-1129873 GCCGCAGGGGCCCCGGGGCATGG - Intergenic
1134034196 16:11017019-11017041 CCTGCAGGCACCCCTTGGCATGG - Intronic
1135544664 16:23357600-23357622 TGCACAGGCACACATGGGCAGGG + Intronic
1136022479 16:27448960-27448982 TCAGCTGGCAGCCCTGGGCTAGG + Exonic
1136382330 16:29901353-29901375 TCCCCAGGACCCCCTGGGCTTGG - Exonic
1136418661 16:30118550-30118572 TCCGCAGACCCCCCCAGGCAGGG + Intronic
1138346775 16:56325035-56325057 TCTGCAGGCATCCTTGGGGATGG - Intronic
1140663034 16:77206337-77206359 TCTGCAGACACCCGTGGGCTGGG - Intronic
1142109844 16:88325458-88325480 TCCTCCGGGTCCCCTGGGCAGGG - Intergenic
1142403143 16:89871519-89871541 TCCGCATGCAGCCCTGACCATGG - Intergenic
1143100007 17:4499555-4499577 TGCTCAGGCACAACTGGGCAAGG + Intronic
1143202953 17:5124440-5124462 TCCCCAGAAAGCCCTGGGCATGG + Intronic
1143462778 17:7114647-7114669 CCCGCAGGCAACCCTGGCCTTGG + Exonic
1143847961 17:9787393-9787415 CTCCCAGGCACACCTGGGCAAGG - Intronic
1144955990 17:19019160-19019182 TCCGCAGAGACCCCAGGGCAGGG + Intronic
1145056729 17:19707990-19708012 CCCACAGGCACCTCTGGCCATGG + Intronic
1145982321 17:29020368-29020390 CCGGTAGGCACCCCTGTGCAGGG + Intronic
1146845841 17:36181755-36181777 TCCCCAGAAAGCCCTGGGCATGG - Intronic
1147184856 17:38707565-38707587 TCAGCAGGGCCCCCTGAGCAGGG + Intronic
1147600271 17:41740850-41740872 AGCACAGGCACCCCTGGGTACGG - Intergenic
1148115008 17:45170364-45170386 TCTGAAGGAACCCCTGGGCCTGG - Intergenic
1148386468 17:47238194-47238216 CCTGGAGGCACCCCTGGGCAGGG - Intergenic
1149065572 17:52475325-52475347 TCAGAAGACACCCCTGGGCCTGG - Intergenic
1149849044 17:60024696-60024718 TCCCCAGAAAGCCCTGGGCATGG - Intergenic
1149861124 17:60121828-60121850 TCCCCAGAAAGCCCTGGGCATGG + Intergenic
1151935407 17:77258015-77258037 TCCCCAGAGGCCCCTGGGCAGGG + Intergenic
1151935420 17:77258049-77258071 TCCCCAGAGGCCCCTGGGCAGGG + Intergenic
1152257843 17:79250708-79250730 TCGGCAGCCACCCCTGTGCTTGG + Intronic
1156361562 18:36388619-36388641 TCCCCAGGGTCTCCTGGGCAGGG + Intronic
1157241122 18:46010298-46010320 TCCAAAGGGACCCCCGGGCAGGG + Intronic
1157562729 18:48660098-48660120 TCCCCAGGCTCCTCTGGGAATGG + Intronic
1158534174 18:58292420-58292442 TCCACAGGCTCCCCTGGGAGGGG + Intronic
1160152126 18:76403246-76403268 GGTGCAGGCAGCCCTGGGCAAGG - Intronic
1161567657 19:5012535-5012557 TCCTCAGGCTCCTCTGGGCTGGG + Intronic
1161726801 19:5933993-5934015 TCCGCAGGCACATCTGGAAAGGG - Intronic
1162158795 19:8697175-8697197 TCCCCAGGCACCCTTGGGTTGGG - Intergenic
1163008892 19:14412640-14412662 TCCCCAGGCCATCCTGGGCATGG - Exonic
1163322917 19:16585170-16585192 ACAGCAGGCACCCCTGGGGCTGG + Intronic
1165108888 19:33489754-33489776 TGCTCAGGCAGCCCTGGCCAGGG - Intronic
1167044083 19:47039750-47039772 CCCGAAGGCACCCCTGGGCTAGG - Intronic
1167578451 19:50328859-50328881 GCCGCCGGCAGCCCGGGGCATGG + Exonic
926801330 2:16663561-16663583 TCCCAAGCCAGCCCTGGGCAAGG - Intronic
927937737 2:27085067-27085089 TCCTCGGGCAGCCCTGGGCTGGG + Intronic
928366952 2:30710163-30710185 TGAGCAGGCACGCCTGGGCCAGG + Intergenic
930105111 2:47633163-47633185 TGCCCAGGCTGCCCTGGGCAAGG - Intergenic
932713955 2:74088103-74088125 ACTGCAGGCAACCCTGGGGAAGG + Intronic
934517740 2:94999280-94999302 TCAGCAGGGACCCCAGGGGAAGG - Intergenic
934897045 2:98128095-98128117 TCCTCAGAAAACCCTGGGCAGGG + Intronic
935396960 2:102619515-102619537 CCCGCGGGCCGCCCTGGGCAGGG + Intergenic
936433883 2:112486461-112486483 TTCGCAGGCATTTCTGGGCAGGG + Intronic
936676474 2:114721628-114721650 TCAGCAGGCACTTTTGGGCAGGG - Intronic
937872276 2:126794402-126794424 TCAGCAGCCACCTCTGAGCAAGG + Intergenic
938467028 2:131531050-131531072 ACAGCAGGCACCCCAGGGCGGGG + Intronic
939362242 2:141187588-141187610 TCAGCAGTCACTACTGGGCAAGG - Intronic
941653150 2:168115284-168115306 TACGCATGCACCCATGTGCATGG + Intronic
944689806 2:202148981-202149003 TCCGCAGGCTGCCATGGGCAAGG + Intronic
946131441 2:217610005-217610027 CCTGCATGCACACCTGGGCAGGG + Intronic
946362856 2:219229467-219229489 TCCGCAGGCACCCCTGGGCAAGG + Intronic
947724053 2:232386623-232386645 CCCTCAGGGACCCCTGGGCAAGG + Intergenic
947741210 2:232485791-232485813 CGCGCAGGGACCCCTGGGCAAGG + Intronic
948808556 2:240463340-240463362 TCCCCAGGTCCCCCTGGGCCCGG + Exonic
948837876 2:240635176-240635198 TGGGCAGGGACCCCTGGACATGG - Intergenic
1169253960 20:4083242-4083264 TCCACTGACACCCCTGGGAAGGG + Intergenic
1171185209 20:23120039-23120061 GCGGCAGGCAGGCCTGGGCAGGG - Intergenic
1173188932 20:40861647-40861669 TCCGCAGGCCCCCCAGCCCAGGG - Intergenic
1173522847 20:43712121-43712143 TCTGCAGGGGCTCCTGGGCAGGG + Intronic
1175083018 20:56437157-56437179 CCCACAGGCACTCCTGGCCAGGG + Exonic
1175428935 20:58889456-58889478 CCCGGAGGCGCCCCGGGGCAAGG - Intronic
1176016830 20:62938185-62938207 TCCGCAGCCTCTCCTGGGCTGGG - Exonic
1176384877 21:6134284-6134306 CCTGCCTGCACCCCTGGGCATGG - Intergenic
1179738595 21:43403968-43403990 CCTGCCTGCACCCCTGGGCATGG + Intergenic
1179758164 21:43508968-43508990 TCCCCACGTACCCCTGGGCCGGG - Intergenic
1179788749 21:43743614-43743636 TCCCCAGCCACCCCTCTGCAGGG + Intronic
1179874603 21:44261660-44261682 CCAGCAGGGACCCCTGGGGATGG + Intronic
1180002444 21:45001512-45001534 TCTGCAGACACTCGTGGGCAGGG - Intergenic
1180019620 21:45113695-45113717 TGCACAGGCTCCTCTGGGCAGGG - Intronic
1181488151 22:23244607-23244629 TCCGCTGGCTCCCATGGGCAGGG + Intronic
1181761016 22:25058921-25058943 TCAGATGTCACCCCTGGGCAAGG + Intronic
1182620945 22:31618240-31618262 TCCCCAGGGACACCTGGGGATGG - Intronic
1183260265 22:36790300-36790322 TCCACAGGCAGCCCTGGGTGGGG - Intergenic
1183726542 22:39593037-39593059 TCCCCGGGCACCTCTGGGCAAGG + Intronic
1183743457 22:39680487-39680509 TCTGCAGCCACCACAGGGCAGGG - Intronic
1183950293 22:41348932-41348954 TGCTCAGGCACCCCTGGGCCTGG - Intronic
1184071877 22:42151808-42151830 TCCTCTGGCAGCCCAGGGCAAGG - Intergenic
1184516896 22:44967805-44967827 TCCCCAGGCTGCCCTGGGCTGGG + Intronic
1184715704 22:46280582-46280604 ACCGTGGGCACCCCTGGGCAGGG - Intronic
1185027950 22:48426249-48426271 TGAGCAAGCACACCTGGGCAGGG + Intergenic
949226300 3:1699762-1699784 CCTACAGGCACCCCTTGGCATGG + Intergenic
949919406 3:8989337-8989359 TCTTCAGGGACCCCTGGGAATGG + Intronic
949926692 3:9047584-9047606 CCCGCAGGGACCCCGGCGCAGGG + Intronic
950160447 3:10756785-10756807 ACAGCATGGACCCCTGGGCAAGG - Intergenic
953981405 3:47414978-47415000 TCCTCAGGGACCCCAGGGCGGGG - Exonic
954367440 3:50154192-50154214 TCCGCAGGGTGCCCGGGGCAGGG + Intergenic
954648643 3:52146286-52146308 CCTGCAGCCACCCCTGGGAAGGG - Intronic
954684006 3:52360935-52360957 TGCCCAGGGACCCCTGGGGATGG - Intronic
955052580 3:55426706-55426728 TCCTCATGCATCCCTGGGCCTGG - Intergenic
955407091 3:58632476-58632498 TCCTCAGCCAACCCTGAGCACGG + Intergenic
960389447 3:117058688-117058710 TCAGCAATTACCCCTGGGCATGG - Intronic
961057777 3:123803715-123803737 TTGGCGGGCAGCCCTGGGCAGGG - Intronic
962498530 3:135966116-135966138 TCCGCGGGCGCCCCTGGGGCAGG - Intronic
964199103 3:154098078-154098100 TCCTCAGGCAGCCCTGGGGTGGG - Intergenic
967174762 3:186853147-186853169 TGTGCAGGCCCCCTTGGGCAGGG - Exonic
968571879 4:1346532-1346554 ACAGCAGGTACCCCTGGGCCCGG - Intergenic
968662413 4:1804232-1804254 GCCGCAGGCACCACTGGGAGCGG - Intronic
972243872 4:37224297-37224319 CCTGCAGGCAAGCCTGGGCAAGG + Intergenic
977140558 4:93366317-93366339 TAAACTGGCACCCCTGGGCATGG + Intronic
984844694 4:184099505-184099527 TCCGCAGATGCCCCTGGCCATGG + Intronic
985386119 4:189450151-189450173 TCCAGAGGCACCCCTGTCCATGG + Intergenic
985822925 5:2172614-2172636 TGGGCAGGCACCCCTGTGCTGGG - Intergenic
985879161 5:2625481-2625503 GCCTCAGGCAGCCCTGGGCTGGG - Intergenic
986213221 5:5694019-5694041 TCCACAGGCACCCGTGGAGAAGG + Intergenic
988624109 5:32852598-32852620 TCTCCAGGCATCCCTGGGGAGGG - Intergenic
989600074 5:43192539-43192561 TTCGCAGACACCCCGTGGCAGGG - Intronic
1000039868 5:157477586-157477608 TTCGCAGGCTCCCCTGGGGAAGG + Exonic
1001322368 5:170693217-170693239 TCTGCTGGCATCCCTGGGGACGG + Intronic
1001526194 5:172430452-172430474 CCCACAGGCACCCATGGGGAGGG - Intronic
1001586733 5:172837947-172837969 TGCTCAGGCACCACTGGGCCTGG - Intronic
1001590232 5:172859729-172859751 TCCGCAGGTGCCCTTGGACAGGG + Intronic
1002259244 5:177982587-177982609 TCCGCAGGGGCCCCAGGCCAGGG + Intergenic
1005912937 6:30326801-30326823 TCCGCAGGCACCGCTAGACCCGG + Intronic
1006518211 6:34556172-34556194 CCAGCAGGCAGCCCTGGGCTGGG - Exonic
1006845987 6:37061851-37061873 TCCTCAGGCCCCCTTGGGCAAGG - Intergenic
1007684168 6:43655500-43655522 TGCCCAGGCACCCCGGCGCAAGG - Intronic
1010665941 6:78629786-78629808 TCCGTACGTACCCCTGGGAAAGG - Intergenic
1013462648 6:110390102-110390124 TCCTTAGGCACTTCTGGGCAAGG - Intergenic
1016569754 6:145498343-145498365 TCCACAGGTACCCCTAGGAAGGG - Intergenic
1018790282 6:167143136-167143158 TCAGAGGGCACCCCTGGCCACGG - Intergenic
1018856234 6:167677354-167677376 TCTGCAGCCACTCCGGGGCAGGG - Intergenic
1018860639 6:167708572-167708594 GCCGCAGGCACCCCACAGCACGG + Intergenic
1018950773 6:168377491-168377513 TCTCCAGGCACCCCTGGCCTTGG + Intergenic
1019911060 7:4100776-4100798 GCACCAGGCACCCCTGGGCCTGG + Intronic
1020073618 7:5243338-5243360 GCCGCAGGCAGCCTGGGGCATGG - Intergenic
1021674217 7:23064224-23064246 TCAGGAGGCCCTCCTGGGCATGG + Intergenic
1023043079 7:36189654-36189676 TTCTCAGGCATCTCTGGGCAGGG - Intronic
1024062631 7:45710310-45710332 TGCACGGGCTCCCCTGGGCAGGG - Intronic
1024506315 7:50165138-50165160 TCTGGAGGGACCCATGGGCAGGG + Intergenic
1029228357 7:99045592-99045614 TCACCAAGCACTCCTGGGCAGGG - Intronic
1029595129 7:101533645-101533667 ACCCCAGGCAGCACTGGGCAGGG + Intronic
1032500991 7:132399598-132399620 GAAGCAGGCACACCTGGGCAGGG + Intronic
1036470691 8:9049916-9049938 TCTGCAGGCTGCCCTTGGCATGG - Intronic
1039546418 8:38414218-38414240 TCCACAGGCACACCGGGGTATGG + Exonic
1040593201 8:48815277-48815299 CCACCAGGCACCACTGGGCAGGG - Intergenic
1043702878 8:83312978-83313000 CCTGCAGTCACCCCTTGGCAAGG - Intergenic
1043734273 8:83724322-83724344 CCTGCAGGCCCCCCTTGGCATGG - Intergenic
1044956999 8:97491459-97491481 TCAGCAGGCAAGCCTGGGCTTGG + Intergenic
1045190302 8:99875526-99875548 TCTGCAGCCACCACAGGGCATGG - Exonic
1049198937 8:141330540-141330562 CCTGCCGGCAGCCCTGGGCAGGG - Intergenic
1049468755 8:142765606-142765628 TCCACAGGGAGCCCAGGGCAAGG + Intronic
1049613833 8:143567828-143567850 TCCGCAGGTAGCCCTGGGTCTGG + Exonic
1053421618 9:37983469-37983491 TGCCCAGGAACCTCTGGGCAGGG + Intronic
1055295170 9:74826586-74826608 TCAGCATGCACCACTGGGCAGGG - Intronic
1056936519 9:90919177-90919199 TCCACAGGGACCCCTGGGCTGGG - Intergenic
1056949365 9:91029721-91029743 TCCTCAGGCACCCTGGGGCAAGG + Intergenic
1057220631 9:93256079-93256101 TGCCCGGGCACCCCTGGGCTGGG + Intronic
1057221844 9:93261734-93261756 TTCCCAGACACACCTGGGCACGG + Intronic
1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG + Intronic
1061807398 9:133144112-133144134 TCGGAAGGCAGCCCTGGGCACGG - Intronic
1062067643 9:134537353-134537375 TCCCCAGGCACCCTGGGGCTTGG - Intergenic
1062321170 9:135991122-135991144 TCCCCAGGCTCCCCATGGCAGGG + Intergenic
1062433706 9:136536805-136536827 GATGCAGGCCCCCCTGGGCAGGG - Intronic
1062436790 9:136549964-136549986 CCTGCAGGCACCCCTGGGCCTGG - Intergenic
1062502741 9:136858301-136858323 TAGGCAGGCACCCCAGAGCAGGG - Intronic
1190259901 X:48791118-48791140 TCCCCAGGGACCCCAGGCCAGGG - Exonic
1193724223 X:85020952-85020974 TCCAGAGCCACCCCAGGGCAAGG + Intronic
1196443903 X:115735600-115735622 TCGGCAGGGACCCCTGGGCTCGG + Intergenic
1198636731 X:138710423-138710445 TCCCCAGGCTCTCCTGGGGACGG + Intronic