ID: 946362857

View in Genome Browser
Species Human (GRCh38)
Location 2:219229468-219229490
Sequence GCCTTGCCCAGGGGTGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362857_946362867 8 Left 946362857 2:219229468-219229490 CCGCAGGCACCCCTGGGCAAGGC 0: 1
1: 1
2: 2
3: 38
4: 299
Right 946362867 2:219229499-219229521 GGGCCTGGGATTCCAATAACCGG 0: 1
1: 0
2: 1
3: 11
4: 85
946362857_946362864 -7 Left 946362857 2:219229468-219229490 CCGCAGGCACCCCTGGGCAAGGC 0: 1
1: 1
2: 2
3: 38
4: 299
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362857_946362871 27 Left 946362857 2:219229468-219229490 CCGCAGGCACCCCTGGGCAAGGC 0: 1
1: 1
2: 2
3: 38
4: 299
Right 946362871 2:219229518-219229540 CCGGTCTCACGTCTTACCTCAGG 0: 1
1: 0
2: 0
3: 0
4: 47
946362857_946362865 -6 Left 946362857 2:219229468-219229490 CCGCAGGCACCCCTGGGCAAGGC 0: 1
1: 1
2: 2
3: 38
4: 299
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362857 Original CRISPR GCCTTGCCCAGGGGTGCCTG CGG (reversed) Intronic