ID: 946362859

View in Genome Browser
Species Human (GRCh38)
Location 2:219229477-219229499
Sequence CCCCTGGGCAAGGCCAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 0, 3: 40, 4: 355}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362845_946362859 23 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362843_946362859 25 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362852_946362859 6 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362850_946362859 10 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362844_946362859 24 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362846_946362859 19 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362851_946362859 9 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355
946362847_946362859 16 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG 0: 1
1: 1
2: 0
3: 40
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362859 Original CRISPR CCCCTGGGCAAGGCCAGACA CGG Intronic
900177148 1:1295928-1295950 CCCCTGGTCCAGGCAGGACAAGG - Exonic
900226525 1:1535837-1535859 CCCCGGGGGAAGGCCAGGCCGGG - Intronic
901028160 1:6290163-6290185 ACGCTGGGAAAGGCGAGACATGG + Intronic
901032929 1:6318827-6318849 CCCCTGGGCAGGGCCTTGCAGGG - Intronic
901156874 1:7146131-7146153 CCCCTGGGGATGGGCAGTCATGG + Intronic
901693564 1:10990221-10990243 CCCCTGGTCATGGCCACTCATGG - Intergenic
901836179 1:11925698-11925720 CCCCGCGGCAAGGCCAGAGACGG + Exonic
902080953 1:13820487-13820509 CCCCTGGGGTAGGAAAGACACGG - Intronic
902610634 1:17595349-17595371 CCCCAGGGCTTGGTCAGACATGG - Intronic
902669898 1:17965948-17965970 CCCCTGGCCTAGGCCAGTCTGGG + Intergenic
904001412 1:27341140-27341162 CCCCTGGGAGAGGCAGGACAAGG - Intergenic
905539690 1:38750194-38750216 CCCCTTGGCCAGGCCAAACCAGG + Intergenic
906522680 1:46476752-46476774 CCCTTGGGACAGGCCAGAGAGGG + Intergenic
906885289 1:49638882-49638904 TCCCTGTGCAAGGCAGGACAAGG + Intronic
907198690 1:52707701-52707723 ACCCAGGTCAAGGCCAGGCACGG + Intergenic
908990463 1:70081741-70081763 CCCCTTGTCCAGGGCAGACATGG - Intronic
911095068 1:94048181-94048203 CCCCTGGGCTCTGCCTGACAGGG - Intronic
911610942 1:99958594-99958616 CCACTGTGCCAGGCCAGACGGGG - Intergenic
912580818 1:110719348-110719370 GCCCTGGGCAATGCCACACAAGG - Intergenic
913278558 1:117163169-117163191 ACACTGGGCAAGGCCAGATACGG + Intronic
914900184 1:151707480-151707502 GGCCTGGGCAAGGCCGGGCAAGG - Intronic
915624596 1:157106910-157106932 CCCTTGGGCAGGACCAGAAAGGG + Intergenic
915676300 1:157535264-157535286 CCCCTTGGGCAGGCCAGGCATGG - Intronic
917216296 1:172681608-172681630 CCCCTTGGGAAGTCCAGAAATGG + Intergenic
918070307 1:181129411-181129433 CCACTGGGCAGGGCCAGGCTGGG - Intergenic
918811881 1:189132801-189132823 CCCCTGGCCAAGGTCATCCATGG - Intergenic
919895994 1:202010244-202010266 CCCAGGGGCCAGGCCAGAGATGG - Exonic
920172676 1:204081585-204081607 CGCCTAGGAAAGGCTAGACAGGG + Intronic
920650174 1:207831763-207831785 AGCCTGTGCCAGGCCAGACATGG + Intergenic
922447621 1:225711008-225711030 CACCTTGGCAAGGCAAGTCAGGG + Intergenic
922808784 1:228404349-228404371 CCCCAGGTCAGGGCCAGGCAAGG + Intronic
922817367 1:228459323-228459345 CCCATGGGCGAGGCCAGACGTGG + Exonic
923207749 1:231775374-231775396 CCCCTGGCCAATGTCAGAGATGG + Intronic
1063386294 10:5618256-5618278 CCGCAGGGCAAGCCCAGGCAGGG + Intergenic
1064020376 10:11804573-11804595 TTCCTGGGCAACTCCAGACACGG + Intergenic
1065024390 10:21526617-21526639 CCGCTGGGCCAGGCCAGGCGGGG - Intergenic
1065643115 10:27805269-27805291 TCCCTTAGCCAGGCCAGACATGG - Intergenic
1065898683 10:30186404-30186426 CCAATGTGCAAGGCAAGACAGGG - Intergenic
1066520640 10:36214370-36214392 CCACTGTGCACGGCCAGAAATGG + Intergenic
1069956249 10:72053787-72053809 CCCCTGGGCCAGGGCTGAGAGGG - Intergenic
1070475412 10:76824424-76824446 CCTCTGAGCAAAGCAAGACAGGG + Intergenic
1070727573 10:78802795-78802817 TCCCTGGGCCAGGCCAGGCAGGG + Intergenic
1072454866 10:95567016-95567038 TAACTGGGCAAGGCCAGGCATGG + Intergenic
1073894500 10:108139164-108139186 ACCCAGGGGAAGGCCAGTCATGG - Intergenic
1075309845 10:121405030-121405052 CCCCTGGGCAGGCCAACACAAGG + Intergenic
1075787732 10:125061417-125061439 CCCCAGGGGAAGGCCAGAGAAGG + Intronic
1076445060 10:130508802-130508824 CCCCAGGGCAAGACCAGCCTTGG + Intergenic
1076601329 10:131658771-131658793 CCCCTGGGGAAGTCCAGAGCTGG + Intergenic
1077034676 11:488875-488897 CCCCTGCGCCAGGCCGGCCAGGG - Intronic
1077087314 11:760345-760367 GCCCTGGGGAATGCCAGACTGGG + Intronic
1077183577 11:1226939-1226961 GCCCTGGCCCAGGTCAGACATGG - Intronic
1077236833 11:1485947-1485969 TCTCTGGACAAGGCCACACAAGG + Intronic
1078568914 11:12440712-12440734 TCCCTGGCCAAGGCCAGCAAGGG - Intronic
1078620061 11:12899048-12899070 CCCCTGGGCCAGGTCAGAGCTGG - Intronic
1079855317 11:25595544-25595566 CTCCTGGGCAGGGCCATAGATGG + Intergenic
1080456365 11:32423196-32423218 CCTCTGGGCAAGCCCAAACCAGG + Intronic
1081961178 11:47138685-47138707 AACCTGAGCTAGGCCAGACACGG + Intronic
1082788152 11:57328694-57328716 TCCCTGGGCATGGCCAAACCAGG + Intronic
1083255287 11:61491702-61491724 CCCCTCTGCATGCCCAGACAGGG - Intergenic
1083709810 11:64541052-64541074 CTCCTGGGCATGGCCAGCCTGGG + Intergenic
1083747069 11:64742576-64742598 CCGCTGGGGAAGGCTAGAGAAGG + Intronic
1083748459 11:64747698-64747720 CCCCAGGGCAAGGCCGGATATGG - Intronic
1083759390 11:64807404-64807426 GCCCTGGGAAAGGCCAGGCCAGG + Intronic
1084603575 11:70160345-70160367 CCCCTGGGCAGGGCGGGGCAGGG + Intronic
1084604439 11:70164378-70164400 CCCCTGGGCAGCCCAAGACACGG + Intronic
1084893741 11:72250510-72250532 GCCCAGGGAAAGGCCAGACAGGG - Intergenic
1085032580 11:73281666-73281688 CCCAGGGGCAAGGCCAGGCCTGG + Intronic
1085413691 11:76306643-76306665 CCCCAGGGCCAGGCCAGGCCTGG - Intergenic
1085524178 11:77154795-77154817 CTCCTGGTCCAGGCCAGCCAAGG + Intronic
1085610464 11:77943918-77943940 ACCCTGGGAAAGACCAGTCATGG + Intronic
1086076833 11:82863796-82863818 ACCTTGGGCATGGCCACACAAGG - Intronic
1089377075 11:118002054-118002076 CTCCTGGGCAAGGGGAGCCAGGG - Intergenic
1089401253 11:118166012-118166034 CGCCTGGGCAGGGGCAGCCAAGG - Exonic
1089809036 11:121116297-121116319 CCCCTGGTCCAGGCTATACAGGG - Intronic
1089910436 11:122094008-122094030 ACCCCGGGCAAGGCAATACAAGG - Intergenic
1091588370 12:1828632-1828654 CTCCTGGCCGAGGCCAGCCAAGG - Intronic
1091604396 12:1937674-1937696 CCCCTTCAGAAGGCCAGACATGG - Intergenic
1091792256 12:3278668-3278690 CCCCTGGGACAGGCAAGACCTGG + Intronic
1091828881 12:3535341-3535363 GCCCTGGGTAAGGCCAGTCTGGG + Intronic
1095145512 12:38721697-38721719 CCCCTGGGGGAGCCCAGACCTGG + Intronic
1095488364 12:42707607-42707629 TCACTGGGCTAGGCCAGTCAAGG + Intergenic
1096466716 12:51850738-51850760 CCCATTGGCAATGCCAGACTTGG - Intergenic
1097103404 12:56605281-56605303 CCACTGGGCAATGTCAGACCAGG + Exonic
1097681561 12:62654521-62654543 CCCCAAGTCAAGGCCGGACAAGG + Intronic
1099593608 12:84627803-84627825 CCCCTTGACAGGGCCAGATACGG - Intergenic
1103109092 12:118259253-118259275 ACACTGGACAAGGCCAGCCACGG + Intronic
1103920591 12:124397220-124397242 CCCCTGCCCCAGGCCAGGCACGG + Intronic
1104626102 12:130356389-130356411 CCCCTGCGTGAGGCCAGGCAGGG + Intronic
1104823631 12:131693350-131693372 CCCCTGGGGAGGGCCAGGGAGGG - Intergenic
1104964791 12:132504022-132504044 CCCCTGGGCAAAGTCAGGCCTGG - Intronic
1112971339 13:105266785-105266807 CCCAGGGGCAAGGACACACAGGG + Intergenic
1112998176 13:105599640-105599662 ACCCTTGGCAAGGCAAGACAAGG + Intergenic
1114613055 14:24054577-24054599 CCCCTGGGCCAGGGCTGAGAAGG + Intronic
1115252727 14:31366116-31366138 CACCTGGGTAAGGCCAGGCATGG + Intronic
1117448536 14:55828254-55828276 CCAATGGGGAGGGCCAGACAAGG + Intergenic
1119249147 14:73136965-73136987 CCCCTGGACAAGGACACACCCGG - Intronic
1119472938 14:74910617-74910639 CCCTTGGGAGTGGCCAGACAGGG - Intronic
1119669846 14:76510069-76510091 TCCCTGGCCAAGACCAGGCAAGG - Intergenic
1120854587 14:89201651-89201673 GGCCTGGGCACGGCCAGCCAGGG + Intronic
1120950290 14:90034823-90034845 CCACTGGGCAAGGCCAAGCTTGG - Intronic
1121000603 14:90449662-90449684 CCCCTGAGAGATGCCAGACAAGG - Intergenic
1121720467 14:96105301-96105323 CCCCAGGGCAGGGCGAGCCATGG - Intergenic
1122118701 14:99540610-99540632 CCCCTTGGCCAGGCCAGCCCAGG - Intronic
1122123601 14:99567484-99567506 CCCCTGGGCCAGGACAGCCAAGG + Intronic
1122410613 14:101524140-101524162 TCCCTTGGGAAGGCCAGAGATGG - Intergenic
1122954915 14:105066091-105066113 CTCCTGGGCCAGGCCAGGCTTGG - Intergenic
1122967547 14:105138358-105138380 CCCTCGGGCCAGGCCAGGCAGGG + Intergenic
1123032457 14:105458383-105458405 CTCCTGGGCAAGGCCAGCAGGGG + Intronic
1124249522 15:28097719-28097741 CCCCTGGGAAAGGCCAGGTGTGG - Intronic
1125930266 15:43594866-43594888 CCGCGGAGCAAAGCCAGACATGG + Intronic
1125943434 15:43694698-43694720 CCGCGGAGCAAAGCCAGACATGG + Intronic
1127361395 15:58247688-58247710 CCCCTTGGGATGGCCAAACAGGG - Intronic
1128328294 15:66739377-66739399 GGCCTGGGTAAGGCCAGGCACGG - Intronic
1128546479 15:68572044-68572066 CCCCTGGGCCAGACCAGTCCTGG - Intergenic
1129179949 15:73867645-73867667 CCCCTGGGCCTTGCCAGTCATGG - Intergenic
1129436664 15:75547003-75547025 CACCTGTGCCAGGCCAGGCACGG + Intronic
1129459673 15:75694196-75694218 ACCCCAGGCAAGCCCAGACATGG - Intronic
1129462226 15:75705125-75705147 GCCCTGGGGAGGGCCAGGCAGGG + Intronic
1129722635 15:77886723-77886745 GCCCTGGGGAGGGCCAGGCAGGG - Intergenic
1130464663 15:84185840-84185862 ACCCCAGGCAAGCCCAGACATGG + Intergenic
1130499602 15:84487697-84487719 ACCCCAGGCAAGCCCAGACATGG - Intergenic
1131063515 15:89418624-89418646 TACCTGGGCAATGGCAGACATGG + Intergenic
1132112661 15:99113840-99113862 GCCCTTGGCATGGCCAGGCAAGG + Intronic
1132292572 15:100713769-100713791 CACCTGGGCAGGGCCGGCCAAGG - Intergenic
1132991714 16:2798878-2798900 CCCCGGGGCAAAGCCGGGCAGGG + Intergenic
1134531813 16:14989621-14989643 CCCCGCGGCAAGGCCAGAGACGG + Intronic
1136282036 16:29219074-29219096 CCCGTGGGCACACCCAGACATGG + Intergenic
1137237044 16:46625099-46625121 TCCCAGGGCCAGGCCAGGCATGG - Intergenic
1137615750 16:49845919-49845941 CCCCTGAGAAAGGCAGGACATGG + Intronic
1137771164 16:51016111-51016133 CTCCAGGGCAAGGTCAGACATGG + Intergenic
1138283616 16:55791381-55791403 CCTCTGGCCAAGCCCAGAAACGG + Intergenic
1138285386 16:55805606-55805628 CCTCTGGCCAAGCCCAGAAACGG - Intronic
1138460776 16:57146476-57146498 CACCGGGGCAAGGCCTGGCACGG - Intronic
1138551850 16:57752758-57752780 CTCCTGGGCCAGGCGAGAGATGG - Exonic
1139965450 16:70742597-70742619 CTCCTGGGCAAGGCCCCACATGG + Intronic
1140805257 16:78526852-78526874 ACACTGGGCCAGGCCAGACCAGG - Intronic
1141678897 16:85532550-85532572 CCCCAGCGCTAGGCCAGACGTGG - Intergenic
1141977887 16:87529747-87529769 GCCCTAGGTAAGGCCAGGCAAGG + Intergenic
1142086412 16:88184994-88185016 CCCGTGGGCACACCCAGACATGG + Intergenic
1142148429 16:88502343-88502365 CCCCTGGGCAGGGCGGGAGAGGG - Intronic
1142174868 16:88640509-88640531 GCCCTGGTCCAGGCCAGCCATGG + Intergenic
1142235009 16:88918024-88918046 CCCCAGGGCAAAGCCAGCCCAGG - Intronic
1142397301 16:89839546-89839568 CACCAGGGCCAGGGCAGACAGGG - Intronic
1143036171 17:4000255-4000277 AAACTGGGCAAGGCCAGGCATGG - Intergenic
1143289582 17:5818792-5818814 ACCCGGGACAAGGCCAGACACGG - Intronic
1144833591 17:18144978-18145000 GCCCTGGGCAGGGCCAGAGAGGG + Intronic
1145208346 17:20996318-20996340 CAGCTGGGGAAGGCCAGGCAGGG - Intergenic
1145916807 17:28578883-28578905 CCCCAGGGCCAAGCCAGGCAAGG + Intronic
1146300645 17:31686384-31686406 CCCCTGCACAAGGCCAGAACTGG - Intergenic
1147773370 17:42883198-42883220 CCCCTGGGCCAAGCCAGTCGGGG - Intergenic
1147912157 17:43862184-43862206 ACCCTCAGCAGGGCCAGACAAGG + Exonic
1148145628 17:45362803-45362825 ACCCTGGGCAGGGGCAGACAAGG + Intergenic
1148386465 17:47238184-47238206 CCCCTGGGCAGGGTCTGACAGGG - Intergenic
1149315441 17:55434154-55434176 CCCCGGGGCAGGGCAAGTCAAGG - Intergenic
1150008761 17:61486339-61486361 CACCTGGGCATGGCCAGAGCCGG + Intergenic
1150156971 17:62861816-62861838 CCACTGGGCTAGGACAGTCAGGG + Intergenic
1150227365 17:63531274-63531296 CCCCTGGCCAAGGTCACACAGGG - Intronic
1150463883 17:65375402-65375424 CCCCTGGGCAAAGCAAGTCCAGG - Intergenic
1150640732 17:66947903-66947925 CTCCTGGGCAAGGACACCCAGGG - Intergenic
1150657142 17:67046651-67046673 CCCCTGGGCAGGGCAGGGCAGGG + Intronic
1150791931 17:68205874-68205896 CCCCTGGGCGAGCTCAGCCACGG - Intergenic
1151363922 17:73605035-73605057 CCACTGGGCAAGGCCAACTATGG + Intronic
1151438912 17:74115602-74115624 CCCCTCTGCAAAGCCAGGCATGG + Intergenic
1152299595 17:79487271-79487293 GCCCTGGGCAAGGGCAGAGAAGG + Intronic
1152350252 17:79780197-79780219 CCACAGGGCAAGTCCAGCCAGGG - Intronic
1152564496 17:81094094-81094116 CCCCGGGGCCAGGGCAGCCAGGG + Intronic
1152997459 18:421030-421052 TCCATGGGAAAGGCCAGGCAGGG - Intronic
1153618146 18:6952803-6952825 CCACTGGACACGGGCAGACATGG - Intronic
1153618225 18:6953193-6953215 CCGCTGGACACGGGCAGACATGG - Intronic
1154062459 18:11074958-11074980 CCCTTTAGCAAGGCCAAACAAGG + Intronic
1154306184 18:13232540-13232562 CCCCCGGACAAGGCCACGCAGGG - Intronic
1154356192 18:13624638-13624660 CACATGGGCCAGGCCAGGCATGG - Intronic
1155237174 18:23832231-23832253 CCCCTGGGCATCTCCAAACAAGG - Intronic
1155863142 18:30929916-30929938 CTCCTGTGAAAGCCCAGACAAGG - Intergenic
1156243093 18:35272044-35272066 CCCCTCGGCCAGCCCAGAGAGGG + Intronic
1157529122 18:48407535-48407557 TCCCTGGGCAAGGCCTGGTAGGG - Intronic
1158653260 18:59306752-59306774 CCCCTGACCAAGGCCCGACGGGG - Intronic
1158911237 18:62065011-62065033 CTCCTGGACAAGGACAAACACGG + Intronic
1158937262 18:62376100-62376122 CCTCTGGGCCAGGCCAGGCCTGG - Intronic
1160543587 18:79638508-79638530 GCCCTGGGCACGGCCAGCCCCGG - Intergenic
1160891213 19:1379687-1379709 CCGCTGGGCCAAGCCAGAGAGGG - Intergenic
1160953337 19:1678016-1678038 CCTCTGGGCAGGGCCAGAGCAGG + Intergenic
1161048739 19:2151081-2151103 CCCCAGGCCCAGGCCAGGCAGGG + Intronic
1162780116 19:13002451-13002473 CCCCTGGCCAAGCCCACTCAGGG - Intronic
1162792425 19:13069953-13069975 CCCCCGGGGAAGCCCAGACAGGG + Intronic
1162951766 19:14075206-14075228 TCCCCCGGCACGGCCAGACACGG + Intergenic
1163454676 19:17399473-17399495 ACCCTGAACAAGGCCAGGCATGG + Intergenic
1164079481 19:21850270-21850292 GGCCTGGGCAGGGCCAGACACGG + Intronic
1165103705 19:33456376-33456398 CCCCTAGGCATGGCCAGCCAGGG + Intronic
1165267198 19:34669936-34669958 CCCATGGGAAAAGCCAGGCAGGG + Intronic
1166666479 19:44683494-44683516 GTCCTGGGCCAGGCCAGCCAGGG + Exonic
1166688764 19:44810695-44810717 CCCCAGGGCAGGGCCAGGCCTGG - Intronic
1168097823 19:54125601-54125623 TCCCTGGGGGAGGCCAGGCAGGG - Intronic
1168236075 19:55063774-55063796 TCTCTGTGCAGGGCCAGACATGG - Intronic
925845428 2:8029065-8029087 TCCCTGGCCAAGGCCAAGCAAGG + Intergenic
929779653 2:44949503-44949525 CCCCTCGGCAAGCCCAGGCAAGG - Intergenic
931006035 2:57850566-57850588 CCCCTGGGCAGGGCCATATGTGG - Intergenic
931300448 2:60973623-60973645 CCCCTTGGCAAGAACAGCCAGGG + Intronic
932055045 2:68434826-68434848 TCTCTTGGCAAGGCTAGACAGGG + Intergenic
932448806 2:71796619-71796641 CCACTGGGCAAGGGCAGAGCAGG + Intergenic
932780630 2:74556428-74556450 GCCCAGGGAAAGGCCGGACAGGG + Exonic
933801142 2:85961331-85961353 GCCCTGGGCAGGTCCAGAAAAGG + Intergenic
934766540 2:96883098-96883120 CCCCTGGGGAAGGAATGACAAGG + Intronic
935352176 2:102160747-102160769 CCCATGGGAAAGGCAAGGCAGGG - Intronic
935406895 2:102718825-102718847 CCCCAGGGCAAGGCCGGCCACGG + Exonic
935479866 2:103573271-103573293 CCACTTGGCAAGGAAAGACATGG - Intergenic
936093751 2:109516647-109516669 CTCCTGCGAGAGGCCAGACACGG - Intergenic
937942765 2:127299401-127299423 TCACTGGGCAAGGTCAGACTGGG - Exonic
938905587 2:135833108-135833130 CACCTGGGCAAGCGCAGATATGG + Exonic
940904500 2:159157072-159157094 TCCCAGAGCAAGGCCAGAGAGGG + Intronic
940920083 2:159296399-159296421 CCACTGAGGAAGGCCAGCCAAGG + Intergenic
941855942 2:170231086-170231108 ACCCTGCTCAAGGACAGACAAGG + Intronic
945657121 2:212638195-212638217 TTCCTGGGGAAGGCAAGACAAGG - Intergenic
945704002 2:213206366-213206388 CAGCTGGGCTAGGCTAGACATGG - Intergenic
945984493 2:216342743-216342765 TCCCTGGGCCAGGGCAGAGAAGG - Intronic
946362859 2:219229477-219229499 CCCCTGGGCAAGGCCAGACACGG + Intronic
946754544 2:222931126-222931148 CTCCTGGGCAGGGCAAGGCAAGG - Intronic
946867971 2:224059550-224059572 CCCCTGGGCAGGCCCTGAAAAGG - Intergenic
948469216 2:238166696-238166718 CCCCTGCTCAAGGCCAGAGTGGG - Intronic
1168856410 20:1012451-1012473 CCTAGGGGCAAGGCCAGAGAAGG + Intergenic
1169301175 20:4443246-4443268 CCCTGGGGCAATGCCGGACAAGG - Intergenic
1169830309 20:9817866-9817888 CACCTGGTGAAGGCCAGGCATGG + Intronic
1170056301 20:12208150-12208172 CTCCTGGGCAAGACAATACATGG + Intergenic
1171382122 20:24742067-24742089 CCTCTGGGCAAGTCCAGGCTGGG - Intergenic
1172033698 20:31997756-31997778 CACATGGGCAACGCCAGGCAGGG - Exonic
1172223462 20:33289088-33289110 CCCCAGAGCAAGGCCAGGGACGG + Intronic
1172692195 20:36797571-36797593 CAGCTGGGCAAGGGCAGAGAGGG + Exonic
1173838216 20:46139379-46139401 CTCCTGAGCAAGGCCAGCCCTGG + Intergenic
1174202398 20:48816200-48816222 ACTCTGGGCAGGGCCAGAGAGGG + Intronic
1175259103 20:57663746-57663768 CCCCTGGACATGCCCAGACCTGG + Intronic
1175282729 20:57814852-57814874 CCACTGGGAAAGGCGAGAGATGG + Intergenic
1175413200 20:58784968-58784990 CACCTGTGCAAGGCCACCCAGGG + Intergenic
1175482466 20:59321238-59321260 ACCCTCGGCAAGGCCAGGCCAGG + Intronic
1175767541 20:61601663-61601685 GACCAGGGAAAGGCCAGACAGGG - Intronic
1176180846 20:63748618-63748640 CCCCTGGCCAAGTCCACACGAGG + Intronic
1176377797 21:6095432-6095454 CCTCTGGCCAGGGCAAGACAAGG - Intergenic
1179577758 21:42318357-42318379 CCCCTGGGCAACCCAAGACCTGG + Intergenic
1179618781 21:42598920-42598942 CCCCTAGGGAAGGTCAGGCATGG - Intergenic
1179745677 21:43442816-43442838 CCTCTGGCCAGGGCAAGACAAGG + Intergenic
1179909946 21:44442306-44442328 CCCCTAGCCCAGGCCAGGCAAGG - Exonic
1179974771 21:44858408-44858430 CCCGTGGGCAAGGCTGGACAAGG + Intronic
1180086722 21:45510891-45510913 CCCCTGGGCATGTCCTGCCAGGG - Intronic
1180144278 21:45910657-45910679 CACCTGGCCAAGGCTAGACAAGG - Intronic
1180342590 22:11629792-11629814 CCCCTGGCCGGGGCCAGAGAGGG - Intergenic
1181110781 22:20601725-20601747 CCCCTGGGCAAGGAAAGCAAAGG + Intergenic
1181125451 22:20699349-20699371 CCCATGAGCAAGGACAGAAAAGG - Intergenic
1181280541 22:21716778-21716800 CCCATGAGCAAGGACAGAAAAGG + Intronic
1181732134 22:24855143-24855165 TCCATGGGCAAGGCTGGACAGGG - Intronic
1181853836 22:25768688-25768710 CCCCAGGGCAAAGACAGGCAGGG + Exonic
1181879761 22:25968838-25968860 CCCCTGGGCAAGCCCAGAGCTGG + Intronic
1182115251 22:27752882-27752904 CCTCTGTGCAAGCCCAGCCAAGG + Intronic
1182358636 22:29734154-29734176 TCCCTCGGCAAGGCCAGGCCTGG - Intronic
1183296734 22:37034143-37034165 CCCATGGGGAGGGACAGACATGG + Intergenic
1183346948 22:37313227-37313249 CCCATGGGCAGGGCCAGAGTGGG - Intronic
1184070125 22:42142193-42142215 CCTCTGGGCAAGGAGAGAGAGGG - Intergenic
1184905940 22:47486743-47486765 CCCCTGGGCACAGCCAGCCCAGG - Exonic
1185146552 22:49140109-49140131 GCCCTGGGCAAGGGCATCCAGGG - Intergenic
950695900 3:14701063-14701085 CACCTGGGGCAGGCCAGACATGG + Intronic
951886896 3:27533267-27533289 CCCCTGCGGAAGTCCAGCCAGGG + Intergenic
953745025 3:45567588-45567610 CCACTGAGCAGGGCCAGACTGGG - Intronic
953842151 3:46397520-46397542 TCCCACTGCAAGGCCAGACAGGG + Intergenic
953914401 3:46909281-46909303 CCCCTGGGCCAGGCCTGAGCTGG - Intergenic
953919699 3:46943412-46943434 GCCCTGGGTAAGGGCAGAGAAGG + Intronic
954447607 3:50555123-50555145 CCCCTGGGTGAGGCCAGGGAGGG + Intergenic
954455866 3:50599551-50599573 CCCCTGGCCAAGGCTGGACGGGG - Intergenic
954623081 3:52006671-52006693 CCCCAGGGCCAGGCCAGAGCAGG + Intergenic
954655538 3:52191924-52191946 CCCCTGGGCTAGCCCAGGCAGGG - Intergenic
956730751 3:72194521-72194543 TCCCGGGGCCAGGCCAGACTGGG + Intergenic
959540024 3:107525902-107525924 CTCCTGGGCAAGGCGAGGCTCGG + Intronic
960577955 3:119245703-119245725 TCCCTGGGCAAGGCCTGCCATGG - Intergenic
960881722 3:122352370-122352392 CCACTGAGCCAGGCCAGGCATGG + Intergenic
961451909 3:127006006-127006028 ACACAGGGCAAGTCCAGACAGGG - Intronic
962271687 3:133982204-133982226 TCCCTGGTCCAGGCCAGACCTGG + Intronic
967073376 3:185981348-185981370 TCCCTGAGCAAGGACAGAGATGG + Intergenic
967877780 3:194278522-194278544 CCCCTGGGCAACCTCAGAGAAGG + Intergenic
968478663 4:824643-824665 TCTCTGGGGAAGGCCAGGCAGGG - Intronic
968641030 4:1714902-1714924 CCTCTGGCCAAGACCAGAGATGG - Intergenic
968905202 4:3447682-3447704 CCCCAGGCCAGGCCCAGACAGGG + Intronic
968915566 4:3495713-3495735 CACCTGGGCCTGGCCAGGCAGGG + Intronic
969488407 4:7485335-7485357 CCCCTGGGCCATCCCAGCCAAGG + Intronic
973630099 4:52812184-52812206 CTCCAGGTTAAGGCCAGACATGG + Intergenic
975404135 4:73969397-73969419 CCCCAGGGCAAGGGCAGAAAGGG - Intergenic
977249789 4:94677049-94677071 CCCTTGGGCAAGGCCAGCAATGG - Intergenic
977359095 4:95981120-95981142 GCCATGGGCAGGGCCAGAAAAGG - Intergenic
979647380 4:123087356-123087378 CCCATGGGAAAGGCTAGAGAGGG + Intronic
983432283 4:167666007-167666029 CACTTGGGCAAGACCAGACAAGG + Intergenic
984704171 4:182835602-182835624 CGACTGGGCAAGGGCAGACTTGG - Intergenic
985489537 5:171323-171345 CCCCTGGGCCAGGCCACAGCTGG - Exonic
985551606 5:535961-535983 CACCTGGGCAGGGCGAGCCAGGG + Intergenic
986670736 5:10140539-10140561 CCCCAGGGCCAGGGCACACAGGG - Intergenic
988174370 5:27702358-27702380 ACCCTGGGCTAGATCAGACATGG + Intergenic
989612864 5:43312488-43312510 CCACTGGTCAAGGCCAGACGTGG + Intronic
990049126 5:51473981-51474003 CTCCTGGGCAAGCCAAGAGAAGG + Intergenic
991437879 5:66615010-66615032 CCCCAAGGCAAGGCCTTACAAGG - Intronic
995972883 5:117994176-117994198 CTCCTGGACAAGTCCAGACAAGG + Intergenic
997693540 5:135844017-135844039 GCCCTGGGGAGTGCCAGACATGG - Intronic
998558443 5:143148687-143148709 TCCCTAGGCAAGCCCAGCCATGG - Intronic
999059689 5:148620101-148620123 ACCTGGGGCAAGGTCAGACAAGG + Intronic
1001052135 5:168422126-168422148 CCCCTGGGCATGGCCAGACATGG + Intronic
1002758525 6:183779-183801 CACCTGGGGAAGGCCACAGAGGG - Intergenic
1002973843 6:2053328-2053350 CCCTTTGTCAAGACCAGACATGG - Intronic
1004931236 6:20465051-20465073 CCACTGGGCAAGCCCTGACTTGG - Intronic
1007093736 6:39200717-39200739 GCTCTGGGCAAGGGCACACATGG - Intronic
1007271583 6:40641394-40641416 CCCCTGGGCCAGGCCAAGGATGG + Intergenic
1007417583 6:41700968-41700990 CCACTGGGCATGGCAGGACAGGG + Intronic
1007752169 6:44077146-44077168 TCCCTGGGCACGGCCAGGCCGGG - Intergenic
1007779681 6:44245867-44245889 CGGCTGAGCCAGGCCAGACACGG + Intergenic
1007790879 6:44307422-44307444 CACCTGGGCCAGGTCAGGCAGGG - Exonic
1010207657 6:73337458-73337480 CCCCTAGGCCAGGTCAGGCACGG + Intergenic
1010439184 6:75873886-75873908 TGCCTGAGCAAGGTCAGACATGG - Intronic
1013514744 6:110875426-110875448 CCCCAGGGCAATGCCAGGCGCGG - Intronic
1015159241 6:130133526-130133548 TCCCAGCGCAAGGGCAGACATGG - Exonic
1015317220 6:131830104-131830126 CACCTGTGGAAGGCAAGACAAGG + Intronic
1017376708 6:153778394-153778416 CGCCTGTCCAAGTCCAGACAAGG - Intergenic
1017778717 6:157699837-157699859 ACACTGGGCAGGGCCACACAGGG + Intergenic
1018918488 6:168153893-168153915 ACCTTGGACAAGGCCAGGCACGG + Intergenic
1019162872 6:170080749-170080771 AGCCTGCGCCAGGCCAGACACGG - Intergenic
1019312402 7:369232-369254 TTCCTGGGCAAGAGCAGACACGG + Intergenic
1019355114 7:574369-574391 CAGCTGGGTAGGGCCAGACAGGG + Intronic
1019599127 7:1872716-1872738 CCCCAGCACAGGGCCAGACACGG + Intronic
1019776399 7:2914143-2914165 TCCCTGAGCAGGGCCAGCCAGGG + Intronic
1020253485 7:6487376-6487398 TCACTGGGCAAGGGCAGAAATGG + Intergenic
1020747230 7:12092767-12092789 CTCCTGGGCATGGCTTGACATGG + Intergenic
1021555754 7:21916066-21916088 CCACTGGGCAAGTCCAGGAAGGG - Intronic
1022117772 7:27277254-27277276 ACTCTGGGCAAGGCCAGGCGCGG + Intergenic
1022923593 7:35038583-35038605 CCACTGGGCACGGCCAGGAAAGG - Intergenic
1023941133 7:44768989-44769011 CCCCAGGGCAAGCCCAGATAAGG - Exonic
1025158436 7:56631041-56631063 GCCCTGGGGGAGGCCAGCCAAGG - Intergenic
1025757293 7:64357114-64357136 GCCCTGGGTGAGGCCAGCCAAGG + Intergenic
1025842638 7:65165117-65165139 ACCCTGGGAAAGACCAGTCATGG - Intergenic
1025880407 7:65530851-65530873 ACCCTGGGAAAGACCAGTCATGG + Intergenic
1025893030 7:65671753-65671775 ACCCTGGGAAAGACCAGTCATGG - Intergenic
1028153424 7:87402268-87402290 GCCCTGGACAAAGCCAGAGAAGG - Exonic
1028162705 7:87504415-87504437 GCCCTGGACAAAGCCAGAGAAGG - Exonic
1028423691 7:90662407-90662429 GCCCTTGGCAAAGCCAGAGATGG + Intronic
1029168826 7:98617000-98617022 CGCCTGGGCACGGCCAGCCGAGG + Intergenic
1030308813 7:108048065-108048087 CCACAGGGCAAGGGCACACATGG + Exonic
1032969837 7:137148180-137148202 CCCCTGCTCAAGGCCTCACAAGG + Intergenic
1034418028 7:150975311-150975333 AGCCTGGGAAAGGCCAGAGATGG + Intronic
1035205065 7:157289791-157289813 CCCCTGGGCAGGGCTAGAGCAGG - Intergenic
1035745040 8:1955804-1955826 CCCCTGGGCAAGCCCCCAGAAGG - Intronic
1035905599 8:3506451-3506473 CCACTGGTCATGGCCAGAAAGGG + Intronic
1036494017 8:9252971-9252993 CCCCTGAGCAAAGGGAGACAGGG + Intergenic
1038067158 8:23975033-23975055 TCTCTGGGCAAGGACAGCCATGG + Intergenic
1040806888 8:51405197-51405219 CGCCTGGGCCAGCCCAGAAAGGG + Intronic
1040907675 8:52485751-52485773 CTCTGGGGAAAGGCCAGACACGG + Intergenic
1041034178 8:53771184-53771206 CACTTGTGCAAGGCCACACAGGG + Intronic
1041730114 8:61054205-61054227 GCCCTGGGCACGACCAAACAGGG + Intergenic
1042315915 8:67425659-67425681 CCACTGTGCCAGGCCAGAGATGG + Intronic
1042478516 8:69277653-69277675 CCCTTGGGCAAGGCCATCAAAGG - Intergenic
1043702876 8:83312968-83312990 CCCCTTGGCAAGGACAGCCTTGG - Intergenic
1045526972 8:102949214-102949236 GCCCTGTGCCAGGCCAGACAGGG - Intronic
1047247534 8:123158403-123158425 ACTCTGGGCAAGGCCAGGCGTGG + Intergenic
1048503313 8:134998043-134998065 CCCCTTGGAAAGCCCAGAAAGGG + Intergenic
1049247016 8:141568282-141568304 CCCCTGGCCAAGTCCAGCCTCGG - Intergenic
1049279511 8:141737176-141737198 TCCCTGGCCAAGTCCAGGCAGGG - Intergenic
1049454489 8:142680199-142680221 TCACAGTGCAAGGCCAGACAAGG - Intronic
1049481092 8:142823300-142823322 CCCCTTGGGGAGGCCTGACATGG - Intergenic
1049587666 8:143439680-143439702 CCCTGGGGCAGGGCCAGCCAAGG - Intronic
1049657620 8:143805698-143805720 CCCCACGGCCAGGCCACACATGG + Intronic
1049695895 8:143984134-143984156 CCTCTGGGCAAGGGCAGAGGAGG + Intronic
1051233441 9:14976010-14976032 AGCCTGAGCAAGGCCAGGCACGG + Intergenic
1051506907 9:17837566-17837588 CCCCTGGGGAAGGATGGACATGG - Intergenic
1052796093 9:32924878-32924900 TCCCTAGGCAAGGCCATACCTGG + Intergenic
1052933271 9:34073011-34073033 TCCCGGGGAAAGGCCACACATGG + Intergenic
1057521324 9:95762799-95762821 CGCCTGGGCACGGACAGAGATGG + Intergenic
1057717077 9:97503168-97503190 CCCCTGCTCAAGGTCACACAGGG + Intronic
1058572557 9:106363219-106363241 CCCATTGTCAAAGCCAGACAAGG - Intergenic
1059311657 9:113392313-113392335 GCCCTGGGCTTGGCCAGGCAGGG - Intronic
1060194005 9:121611262-121611284 CCTATGGTCAAGGCCAGGCATGG - Intronic
1060477827 9:123999297-123999319 CCCCTGAGCAAGGCGAGAAAGGG + Intergenic
1061371193 9:130198447-130198469 CCCCTTGCCAAGGTCATACAAGG + Intronic
1061466712 9:130786160-130786182 TCTGTGGGAAAGGCCAGACAGGG + Intronic
1061670946 9:132187962-132187984 GCCCTGGCCAAGGTCACACATGG + Intronic
1061674427 9:132207811-132207833 AACCAGGGCAAGGCCAGGCACGG + Intronic
1061789312 9:133050707-133050729 CCGCTGGGCCAGACCAGGCAGGG - Intronic
1061825677 9:133256890-133256912 ACTCTGGGCCAGGCCAGAGAGGG - Intronic
1061894165 9:133638477-133638499 TCCATGGGAAAGGCCAGGCAGGG + Intronic
1061894641 9:133640875-133640897 TCCATGGGAAAGGCCAGGCAGGG + Intronic
1061903644 9:133685504-133685526 CCCCTGGGGGAGGCCAGACTTGG + Intronic
1061974156 9:134059973-134059995 CCCCTGGGCACTGCAGGACAGGG + Intronic
1062583959 9:137240727-137240749 TCCCGGCGCAAGGCCAGAGAGGG + Intergenic
1062601849 9:137321912-137321934 CACCTGGGCATGGCCAGTCTGGG - Intronic
1187736126 X:22305346-22305368 TTCCTTGGCAAGGCCAGAAATGG - Intergenic
1189619965 X:42825531-42825553 GCCATGGGCCAGGCCATACAAGG - Intergenic
1191894601 X:65978861-65978883 GCCCTGGGCAAGGAGAGACCAGG - Intergenic
1192195321 X:69023994-69024016 CCCCTGGCCCAGTCCAGACCTGG - Intergenic
1193568432 X:83109902-83109924 CCACTGTGCCAGGCCACACAAGG + Intergenic
1197306666 X:124850634-124850656 CCCATGGGCAAAGGCAGAAACGG + Intronic
1198275994 X:135097070-135097092 ACTCTTGGCAAGGCCAGAGAAGG + Intergenic
1198310521 X:135423662-135423684 ACTCTTGGCAAGGCCAGAGAAGG - Intergenic
1200077152 X:153556844-153556866 TCCCTGGGCAGGGCTACACAGGG + Intronic
1200179342 X:154140905-154140927 ATCCTGGACAAGGGCAGACAGGG + Intergenic
1200311817 X:155086049-155086071 CCCTTGGGCATGACCAGGCAGGG - Intronic
1201499636 Y:14627719-14627741 CGCCTGGGCCAGTCCAGAGAGGG + Intronic
1202370555 Y:24192833-24192855 ACCCCAGGCAAGCCCAGACATGG - Intergenic
1202500229 Y:25477284-25477306 ACCCCAGGCAAGCCCAGACATGG + Intergenic