ID: 946362861

View in Genome Browser
Species Human (GRCh38)
Location 2:219229478-219229500
Sequence CCCTGGGCAAGGCCAGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 335}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362852_946362861 7 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362843_946362861 26 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362847_946362861 17 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362851_946362861 10 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362846_946362861 20 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362845_946362861 24 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362850_946362861 11 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335
946362844_946362861 25 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG 0: 1
1: 1
2: 3
3: 40
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362861 Original CRISPR CCCTGGGCAAGGCCAGACAC GGG Intronic
900300626 1:1975034-1975056 CCCTGGACAAGGTCAGACGCAGG + Intronic
900324268 1:2100360-2100382 CTCTGGGCAGGGACAGACAGAGG - Intronic
900364083 1:2303643-2303665 CTCTTGCGAAGGCCAGACACAGG - Intronic
900639466 1:3681826-3681848 CCCAGGCCAAACCCAGACACAGG + Intronic
900663190 1:3796259-3796281 CCCTGCGCCAGGCCAGGCCCCGG + Exonic
902080951 1:13820486-13820508 CCCTGGGGTAGGAAAGACACGGG - Intronic
903742919 1:25568667-25568689 GCGTGGGCGAGGCCTGACACAGG + Exonic
904198015 1:28800538-28800560 CCCTTGGGAAGGGCAGACATTGG + Intergenic
904553739 1:31343426-31343448 AACAGGGCAAGGCCAGACAATGG - Intronic
904723164 1:32526261-32526283 CCCAAGGCCAAGCCAGACACTGG + Intronic
904769154 1:32871179-32871201 CCCTGGGAAAGGGCAGAAAGCGG - Intronic
904817940 1:33219801-33219823 CCCTGGGCAGGGATAGACCCAGG - Intergenic
905022080 1:34825103-34825125 CCCTGTGCCAGGTCATACACAGG + Intronic
907160374 1:52365210-52365232 CCCAGCGCAAGGTCTGACACAGG - Intronic
907753232 1:57283820-57283842 CCCTGGGCAATGGCAGAGCCAGG - Intronic
907848691 1:58233528-58233550 ACCTGGGTAAGGGCAGACCCTGG - Intronic
908823849 1:68115048-68115070 CCCAGGGAAAGGCCTGTCACAGG - Intronic
910053734 1:83007095-83007117 CCCTGGGGAAGTCCAGGCTCAGG - Intergenic
910347616 1:86258405-86258427 CCCTGGGCAAGACATGACACAGG + Intergenic
912580816 1:110719347-110719369 CCCTGGGCAATGCCACACAAGGG - Intergenic
912967490 1:114249001-114249023 CCCAGGCCAAGGACAGACAGTGG + Intergenic
913278559 1:117163170-117163192 CACTGGGCAAGGCCAGATACGGG + Intronic
914900183 1:151707479-151707501 GCCTGGGCAAGGCCGGGCAAGGG - Intronic
915148220 1:153808221-153808243 CACTGGGGGAGCCCAGACACTGG + Exonic
915561524 1:156690987-156691009 GCCTGCCCAAGGCCAGGCACAGG + Intergenic
915818150 1:158992247-158992269 CTCTGGCCAAGGCCAGAGACAGG + Intergenic
915907216 1:159887750-159887772 CACTGGACAAGGCCAGGGACTGG - Intronic
918136965 1:181682190-181682212 GCCTGGTCAAGGTCTGACACTGG + Intronic
922785791 1:228281703-228281725 CCCTGGGAGAGGCCAGGCCCTGG - Intronic
923215974 1:231848061-231848083 CCCTGGGCAAAGAGAGAAACAGG + Intronic
923660754 1:235955011-235955033 CCCTGGGGAATGACAGATACAGG + Intergenic
924567335 1:245209839-245209861 CCCTGGGCACTGCCCGACCCAGG + Intronic
1064020377 10:11804574-11804596 TCCTGGGCAACTCCAGACACGGG + Intergenic
1064449266 10:15426496-15426518 CCCTTGGCCAGCCCAGAAACGGG + Intergenic
1066582771 10:36898941-36898963 CACTGGGGAATGCCAGACAGTGG - Intergenic
1069280579 10:66649832-66649854 CCCAGGACCAGGCCTGACACAGG + Intronic
1069797531 10:71062893-71062915 CCCTGGGCAGTGCCAGAGTCCGG + Intergenic
1070740551 10:78900428-78900450 GCCTGGGCTAGGCCAGTCACTGG + Intergenic
1070772065 10:79088334-79088356 CCCTGGGCAGGGCCAGGGGCTGG + Intronic
1070782121 10:79143740-79143762 CCCTGAACAAGGCCAGAGGCCGG + Intronic
1070955176 10:80459104-80459126 CCCTGAGTTAGGCCTGACACTGG + Intronic
1073110449 10:101060587-101060609 CCCTGAAAAAGGCCAGAGACGGG - Intergenic
1073774779 10:106773250-106773272 TCCTAGGCAAGGGCAGTCACTGG + Intronic
1073894498 10:108139163-108139185 CCCAGGGGAAGGCCAGTCATGGG - Intergenic
1075590214 10:123685575-123685597 CCCTGATAAAGGCCAGACATTGG + Intronic
1075631439 10:124003095-124003117 CCCTGGGCAAGGCCGAGCCCTGG + Intergenic
1075692060 10:124403570-124403592 CCCAGGACAAGGCCAGAGACAGG + Intronic
1076424932 10:130361188-130361210 CCCGGACCAAGACCAGACACTGG - Intergenic
1076466909 10:130689235-130689257 CCCTGGCCAAGGTGAGCCACAGG - Intergenic
1076691177 10:132224573-132224595 CCCAGAACAATGCCAGACACAGG + Intronic
1076855738 10:133114912-133114934 CCCTGGGCAGTGCCAGCCTCGGG + Intronic
1077087316 11:760346-760368 CCCTGGGGAATGCCAGACTGGGG + Intronic
1077089800 11:773250-773272 TCCTGAGCAAGGCAGGACACCGG - Intronic
1077235924 11:1481989-1482011 CGCTGGGCATGGCCTGGCACAGG - Intronic
1078352180 11:10603598-10603620 CCCTGGGCCAGGCCGCAAACCGG - Intronic
1078648494 11:13164834-13164856 CCCTGTGAAAAGCAAGACACAGG - Intergenic
1079104481 11:17561498-17561520 CCCTGGGCAGTGGGAGACACAGG - Intronic
1079712028 11:23696951-23696973 CCCTGGGCCAGGGCTGACAGTGG - Intergenic
1079935019 11:26606651-26606673 TCATGGGCAAGGACACACACAGG - Intronic
1081841006 11:46201400-46201422 ACCTGGGGAAGGCAAGAGACTGG - Intergenic
1082188016 11:49208182-49208204 CCCTGGGGAAGACCAGCAACAGG + Intronic
1084468728 11:69342812-69342834 GATGGGGCAAGGCCAGACACAGG + Intronic
1084604441 11:70164379-70164401 CCCTGGGCAGCCCAAGACACGGG + Intronic
1084893739 11:72250509-72250531 CCCAGGGAAAGGCCAGACAGGGG - Intergenic
1085176307 11:74491529-74491551 CCCTGAGCTAGGCCAAAGACTGG - Intergenic
1085533618 11:77205630-77205652 CCAGGGGCAGGGACAGACACTGG + Intronic
1085610466 11:77943919-77943941 CCCTGGGAAAGACCAGTCATGGG + Intronic
1086076831 11:82863795-82863817 CCTTGGGCATGGCCACACAAGGG - Intronic
1088164770 11:106921129-106921151 CCCTGGGAAAAGCCAAAAACAGG + Intronic
1089583329 11:119495130-119495152 CTGTGCCCAAGGCCAGACACTGG + Intergenic
1089848110 11:121474307-121474329 CCCTGGCCCCGGCAAGACACTGG - Intronic
1089910434 11:122094007-122094029 CCCCGGGCAAGGCAATACAAGGG - Intergenic
1090185830 11:124738633-124738655 CCCTGGTCATGGCCAGGGACTGG + Intergenic
1090548745 11:127795183-127795205 CCCTGGAGAAGGCCTAACACTGG - Intergenic
1091625148 12:2115869-2115891 CCCTGGGCAAGCTCAGCTACAGG - Intronic
1091785982 12:3243705-3243727 GCCTGGGCAAGACCAGACCACGG - Intronic
1091828883 12:3535342-3535364 CCCTGGGTAAGGCCAGTCTGGGG + Intronic
1094810511 12:34133449-34133471 CACTGGGCAGTGCCAGACAGTGG + Intergenic
1095488365 12:42707608-42707630 CACTGGGCTAGGCCAGTCAAGGG + Intergenic
1095721568 12:45406997-45407019 CCCTGGCCAAGGCTAGAAGCAGG - Intronic
1096520150 12:52180475-52180497 CTCTGGGCTTGGCAAGACACTGG + Intronic
1096638458 12:52975917-52975939 CCCTGGCCAAGCATAGACACAGG + Intergenic
1101845848 12:108362453-108362475 CCCTGGGCAATGGAAGACAGAGG - Intergenic
1101895505 12:108753577-108753599 CCATGGTCAAGGCCAGAGTCAGG - Intergenic
1102246986 12:111362188-111362210 CCCGGAGCAAGGCCAGGCCCAGG + Exonic
1102600645 12:114027255-114027277 CCCAGGGCCAGTCCAGACTCAGG + Intergenic
1103004791 12:117412654-117412676 CCCAGGGCCAGGCCAGACCCAGG + Intronic
1103526002 12:121569029-121569051 CCCAGGGCAAGGTAAGACACTGG + Intronic
1104404881 12:128508999-128509021 CCCTGGGCCAGGCAGGACACTGG - Intronic
1104590036 12:130076934-130076956 CCCTGGCCAGTGCCAGACAAAGG + Intergenic
1104683339 12:130767363-130767385 CAGTAGGCAAGGCCAGATACAGG + Intergenic
1104765528 12:131327799-131327821 CCCTGCGCAAGTCCTGACCCAGG + Intergenic
1104962277 12:132493894-132493916 CCCTGAGCCAGGCCAGACCCTGG - Intronic
1105440133 13:20408163-20408185 CCCTGGGCAAGTCCTCACTCAGG - Intronic
1106081019 13:26500523-26500545 TCCCTGGCAAGGCCTGACACAGG - Intergenic
1106081102 13:26500890-26500912 CCCTGGGCGAGGACAGAACCTGG + Intergenic
1106153590 13:27130624-27130646 CCCTGAGGAATTCCAGACACTGG + Intronic
1106341352 13:28830301-28830323 CCCTGAGAAAGTCCAGATACTGG + Intronic
1107093989 13:36515067-36515089 CCCTGGGCAAAGTCAAATACAGG + Intergenic
1108259682 13:48644229-48644251 ACCAGGGCAAGGCAAGACAGCGG + Intergenic
1110185316 13:72667522-72667544 CCCTGGGCAAACCAAGACATAGG + Intergenic
1113584906 13:111458427-111458449 GCCTGGGCAAAGGCAGGCACTGG - Intergenic
1115391280 14:32857176-32857198 CACTGGGGAATGCCAGACAGTGG - Intergenic
1115660660 14:35491336-35491358 CCCTGAGGAAGCCCAGATACTGG - Intergenic
1117573088 14:57068838-57068860 CCCTGGGGAAGCCGGGACACTGG + Intergenic
1118509832 14:66459889-66459911 CCATGGGCAAAGTCTGACACAGG - Intergenic
1119249145 14:73136964-73136986 CCCTGGACAAGGACACACCCGGG - Intronic
1119388858 14:74276597-74276619 AAGTGGGCAAGGGCAGACACGGG + Intergenic
1119428590 14:74551430-74551452 CCCTGGGCCAGGCAGGCCACTGG + Intronic
1119694223 14:76699857-76699879 CTCTGGACAAGACCAGAGACAGG - Intergenic
1119788884 14:77331704-77331726 CCATGGGCCAGGCCTGCCACAGG - Intergenic
1121273531 14:92652770-92652792 TCCTGGGCAAGGCTCGGCACCGG + Exonic
1121692746 14:95889568-95889590 CCCTGGGCAAGCCCCGTGACTGG + Intergenic
1122418088 14:101559998-101560020 CCCAGGGCAAGGCCTGAACCAGG - Intergenic
1122707442 14:103629785-103629807 CCCTGGGCAGGGCCGGGGACCGG - Intronic
1122785926 14:104163227-104163249 GCCTGGGCGAGGCCAGAGGCAGG - Intronic
1122881929 14:104694081-104694103 CCCTGGGCCAGGCCAGGCTGTGG + Intronic
1123065476 14:105616881-105616903 CCCAGGGCAAGGCCCGAGGCAGG - Intergenic
1125581626 15:40789655-40789677 CCCTGGGAAAGGGCAGAGACTGG - Intronic
1128988296 15:72237167-72237189 CAATGAGCAAGGGCAGACACAGG - Intergenic
1128993177 15:72277514-72277536 CCTTGGGAAAAGCCAGACCCAGG - Intronic
1128993655 15:72280857-72280879 CCTTGGGAAAAGCCAGACCCAGG + Intronic
1129462228 15:75705126-75705148 CCCTGGGGAGGGCCAGGCAGGGG + Intronic
1129702033 15:77773753-77773775 CCCTGGGCAAAGTCAGAGAGAGG - Intronic
1129722633 15:77886722-77886744 CCCTGGGGAGGGCCAGGCAGGGG - Intergenic
1129884840 15:79030856-79030878 TCCTCTGCAAGGGCAGACACAGG - Intronic
1130126320 15:81096980-81097002 CCCTGTGGAGGGACAGACACTGG + Intronic
1130576134 15:85094748-85094770 CCCTGAGCAAGGTCAGGCCCAGG - Intronic
1131089701 15:89614200-89614222 CCCTGAGAAAGTCCAGACATTGG - Intronic
1132614873 16:835463-835485 CCAGGGGCTGGGCCAGACACAGG + Intergenic
1133688492 16:8189851-8189873 AGCTGGACAATGCCAGACACAGG - Intergenic
1133877950 16:9752447-9752469 CCCATACCAAGGCCAGACACAGG - Intergenic
1133880431 16:9776746-9776768 CCCTGGGCAAGACATGAAACAGG - Intronic
1136234101 16:28903932-28903954 CCCTGGGCAGTGCCAGCCTCTGG + Intronic
1136370118 16:29830942-29830964 CCCTGGGCATCCCGAGACACAGG - Exonic
1136428768 16:30185397-30185419 CCCTGGGCAAGGTGAGCCCCTGG + Exonic
1137771165 16:51016112-51016134 TCCAGGGCAAGGTCAGACATGGG + Intergenic
1138277727 16:55748312-55748334 CTCTGGCCAAGCCCAGAAACAGG + Intergenic
1138283617 16:55791382-55791404 CTCTGGCCAAGCCCAGAAACGGG + Intergenic
1138285385 16:55805605-55805627 CTCTGGCCAAGCCCAGAAACGGG - Intronic
1139965451 16:70742598-70742620 TCCTGGGCAAGGCCCCACATGGG + Intronic
1141422922 16:83928556-83928578 TCCTGTGCAAGCACAGACACAGG + Intronic
1141632107 16:85293696-85293718 CTGTGGGCAATGCCAGAAACTGG - Intergenic
1141692366 16:85603455-85603477 CCCTGGGAGAGGCCAGATGCAGG - Intergenic
1142245058 16:88966566-88966588 CGCTGGGCAGGGCCTGGCACCGG - Intronic
1143198311 17:5094091-5094113 GCTTTGGCAAGGCCAGACCCTGG - Exonic
1143314905 17:6025190-6025212 CCCTGGGCAACCGCAGACAGTGG - Intronic
1143563947 17:7710234-7710256 GCCTGGGCCAGGCCAGAGAATGG - Exonic
1144829858 17:18125238-18125260 CCCAGGGCAGGGCCAGCCCCAGG - Intronic
1145947915 17:28791948-28791970 TCCTGGGCATGGCCAGGCACAGG - Intronic
1147312820 17:39605273-39605295 CCCTGGGACAGGCCACCCACAGG + Exonic
1147847910 17:43418173-43418195 ACCTGGGTGATGCCAGACACTGG + Intergenic
1148145630 17:45362804-45362826 CCCTGGGCAGGGGCAGACAAGGG + Intergenic
1148222025 17:45869778-45869800 CCTTGGGCACGGCCAGGGACCGG + Intergenic
1148490958 17:48023844-48023866 CCCTGGGGATGGCAGGACACTGG + Intergenic
1149065878 17:52478653-52478675 CTCTGGCCAAGACCAGAGACAGG - Intergenic
1150008762 17:61486340-61486362 ACCTGGGCATGGCCAGAGCCGGG + Intergenic
1150324815 17:64248438-64248460 CACTGGGCAGGTCCAGACACTGG - Intronic
1151578036 17:74962719-74962741 CCCTGGGCAAGCAAAGACAATGG + Intronic
1152805619 17:82354455-82354477 CCCTGGGCTGGGCCAGAGCCTGG - Intergenic
1152821557 17:82440140-82440162 CCATGGGCAGGGGCAGGCACCGG + Intronic
1157427940 18:47600176-47600198 TCCTGGGTAAGGCCAGACTCAGG + Intergenic
1157514114 18:48298742-48298764 GCCAGAGCAGGGCCAGACACTGG - Intronic
1157699914 18:49755727-49755749 CCCTGGGGAAGGACAGTCTCAGG - Intergenic
1158911238 18:62065012-62065034 TCCTGGACAAGGACAAACACGGG + Intronic
1160513080 18:79463375-79463397 TCCTGGGAACGGCCAGCCACAGG + Intronic
1160543585 18:79638507-79638529 CCCTGGGCACGGCCAGCCCCGGG - Intergenic
1160560591 18:79753514-79753536 CTCTGGTCAAGGACACACACAGG - Intronic
1161298466 19:3531665-3531687 CCCCGGGCCAGACCTGACACCGG + Intronic
1161379208 19:3955842-3955864 CCCAGAGGAAGGCCAGAGACGGG + Intergenic
1161447852 19:4328183-4328205 CCTGGGGCAAGGCCAGCCTCAGG + Intronic
1161649900 19:5478011-5478033 CCCTGGGGCAGGACAGACCCTGG - Intergenic
1161976722 19:7611556-7611578 CCCTGGGCAAGGCCTGGAACCGG + Exonic
1162754117 19:12847177-12847199 CACTGGGCAAGGCCAGGATCAGG - Intronic
1163441511 19:17324497-17324519 CCCTGGGGAGGGTCAGGCACGGG + Intronic
1163708807 19:18833041-18833063 CCCCGGACCAGGCCAGAGACAGG - Intronic
1163790840 19:19305365-19305387 CCCTGGGAAAGGACGGTCACTGG - Intronic
1164578340 19:29419036-29419058 TTCTGGGGAAGGCCAGACACAGG - Intergenic
1164673013 19:30083457-30083479 CCCTGGGCAACGCCCCACGCCGG - Intergenic
1165169616 19:33882532-33882554 CCCAGGGCAAGGCCAGGACCAGG - Intergenic
1165232000 19:34393157-34393179 CCCTGTGCAAGACCAGGGACAGG + Intronic
1165958661 19:39517157-39517179 CTCTGGGAAAGGAAAGACACAGG - Intronic
1166106458 19:40600349-40600371 CCCGGGACAGGACCAGACACAGG + Intronic
1166108259 19:40608136-40608158 CCCTAGCCAAGGCCAGAGTCTGG + Intronic
1167485585 19:49761261-49761283 CCCTGGGCCAGGCCTAAAACAGG - Intronic
1168148050 19:54430472-54430494 CCCGGGGGAAGGCCGGGCACTGG - Intronic
1168236074 19:55063773-55063795 CTCTGTGCAGGGCCAGACATGGG - Intronic
928379797 2:30807940-30807962 TCCTGGGCATGGCGAGACCCAGG + Intronic
929607142 2:43242176-43242198 TCCTGGGAAAGGAAAGACACAGG - Intronic
929779651 2:44949502-44949524 CCCTCGGCAAGCCCAGGCAAGGG - Intergenic
931582225 2:63789362-63789384 CACTGGGCAAAGGCAGACCCAGG - Intronic
932780632 2:74556429-74556451 CCCAGGGAAAGGCCGGACAGGGG + Exonic
934118986 2:88822382-88822404 CCAAGGGCAAGGCCAGATAGAGG + Intergenic
934239261 2:90253133-90253155 TCCTGGGCAAGGCCAGAAGCAGG - Intergenic
934558869 2:95301995-95302017 CCCTGGGCACAGACAGACATAGG - Intronic
934709176 2:96503862-96503884 CCCTGTGCCAGCCCAGCCACTGG - Intronic
935753812 2:106261804-106261826 ACCTGGGCAGGGCAGGACACTGG + Intergenic
936093750 2:109516646-109516668 TCCTGCGAGAGGCCAGACACGGG - Intergenic
936288138 2:111197575-111197597 CCCAGGGCCAGTCCAGACTCAGG - Intergenic
936463148 2:112726151-112726173 CGCTGGGCCAGGGCAGACACAGG + Intronic
937216318 2:120315809-120315831 CTCCAGGCAAAGCCAGACACTGG + Intergenic
937919874 2:127121543-127121565 CCCTGAGCAAGCCTGGACACTGG + Intergenic
937937156 2:127255518-127255540 CCCCAGTCGAGGCCAGACACAGG - Intergenic
938080953 2:128369858-128369880 CCCAGGGCAGGGACAGCCACAGG - Intergenic
938313546 2:130311030-130311052 CACAGGTCAAGGTCAGACACTGG - Intergenic
940242198 2:151575499-151575521 CACTGGGCAAGGCCAGTTACTGG - Intronic
941855944 2:170231087-170231109 CCCTGCTCAAGGACAGACAAGGG + Intronic
944410795 2:199440290-199440312 CCCTGGGCTAAGGCAGCCACAGG + Intronic
946362861 2:219229478-219229500 CCCTGGGCAAGGCCAGACACGGG + Intronic
947139791 2:227010371-227010393 CCCTGGGCATGCCCAGGCTCTGG - Exonic
948084261 2:235233189-235233211 CCCTGGGGAAGGCCAGATGGTGG - Intergenic
948676703 2:239601156-239601178 CGCTGGGCAAGGCTTGGCACAGG + Intergenic
1168819334 20:762532-762554 CCCTGGGTAAGAACAGACAGAGG + Intronic
1170660196 20:18331153-18331175 CCCTGAAGAAGCCCAGACACTGG + Intergenic
1170877813 20:20267305-20267327 GCATGGGCAGGGACAGACACTGG + Intronic
1173189656 20:40866284-40866306 CTCTGGGAAAGGCCAGATGCAGG + Intergenic
1173422895 20:42918362-42918384 CCTTTAACAAGGCCAGACACAGG + Intronic
1173677193 20:44846203-44846225 CCCTGAGAAAGCCCAGACATTGG - Intergenic
1174104827 20:48154706-48154728 CTGGGGGCAAGGCCAGCCACAGG + Intergenic
1174367821 20:50067067-50067089 CCCTGGGCTAGGCCAAAACCTGG + Intergenic
1174571292 20:51503609-51503631 CCCTGGGTCAGGCCACTCACAGG + Intronic
1175482468 20:59321239-59321261 CCCTCGGCAAGGCCAGGCCAGGG + Intronic
1175727894 20:61332011-61332033 CCCAGAGCAGGGCCAGGCACAGG + Intronic
1176100684 20:63363099-63363121 CCCTGGGCAGTGCAAGACCCTGG + Intronic
1176383471 21:6125579-6125601 CCATGGGCAGGGGCAGGCACAGG + Intergenic
1176419172 21:6500128-6500150 GCCTGGCCAAGGCCACCCACAGG + Intergenic
1176550806 21:8220270-8220292 CCCGGGGCACGGCGAGACAGCGG - Intergenic
1176569604 21:8402537-8402559 CCCGGGGCACGGCGAGACAGCGG - Intergenic
1178745726 21:35248440-35248462 TACTGGGCAATGCAAGACACAGG + Intronic
1179515691 21:41904770-41904792 ACCTGGGCAAGGTCAGACACAGG + Intronic
1179597006 21:42449682-42449704 CCCTGGGCAAAGCCAGACACAGG + Intergenic
1179694665 21:43108450-43108472 GCCTGGCCAAGGCCACCCACAGG + Intergenic
1179739998 21:43412659-43412681 CCATGGGCAGGGGCAGGCACAGG - Intergenic
1180141053 21:45893556-45893578 CCCTGGGCAAGTGCAGACAGTGG + Intronic
1180899634 22:19361012-19361034 CCAAGGGCAAAGCCAGACAGAGG + Intronic
1181480083 22:23193301-23193323 CCCTGTGCAAGACCACACAGTGG - Intronic
1181732132 22:24855142-24855164 CCATGGGCAAGGCTGGACAGGGG - Intronic
1183747552 22:39700296-39700318 CTCTAGGCAAGGCCCCACACTGG - Intergenic
1184172546 22:42768534-42768556 CCACGGGCAAGGACAGAGACAGG + Intergenic
1185132485 22:49047020-49047042 CCTTGGGAAAGGCCAGAGACAGG - Intergenic
1185146550 22:49140108-49140130 CCCTGGGCAAGGGCATCCAGGGG - Intergenic
1203255709 22_KI270733v1_random:136594-136616 CCCGGGGCACGGCGAGACAGCGG - Intergenic
950614103 3:14145855-14145877 CCCTGGGCATGCCCAGCCCCTGG - Exonic
952987714 3:38801093-38801115 CAGTGGGCAAGGCAAGACAGAGG + Intergenic
953463101 3:43097099-43097121 CCCTGGCCAGCCCCAGACACGGG + Intronic
953672683 3:44976073-44976095 CTCTGGACTCGGCCAGACACCGG + Exonic
953999142 3:47542479-47542501 CCCTGCCAAATGCCAGACACCGG - Intergenic
954196766 3:49001747-49001769 GCCTGGGCATGCCCAGACCCAGG + Intronic
954431213 3:50471744-50471766 CCCTGGACATGGCCAGACTTTGG + Intronic
958758829 3:98282503-98282525 CTCTGGCCAAGACCAGAAACAGG - Intergenic
959540025 3:107525903-107525925 TCCTGGGCAAGGCGAGGCTCGGG + Intronic
961035405 3:123638284-123638306 ACCTGGGAGGGGCCAGACACAGG + Intronic
961451908 3:127006005-127006027 CACAGGGCAAGTCCAGACAGGGG - Intronic
962271576 3:133981334-133981356 CCCTGGTCCAGGCCAGACCTAGG - Intronic
962271689 3:133982205-133982227 CCCTGGTCCAGGCCAGACCTGGG + Intronic
962604547 3:137022872-137022894 CTCTGGCCAAGACCAGAGACAGG + Intergenic
965782024 3:172296228-172296250 CCCTGGGCACGGGCAGTCACTGG - Intronic
966874718 3:184315315-184315337 CCCTGGGCCAGGCCCGAACCCGG + Intronic
966917391 3:184592641-184592663 CTATGGTCAAGGCCGGACACTGG + Intronic
968056677 3:195697138-195697160 GCCTCGGCAAGGCCTGAGACCGG - Intergenic
968110453 3:196042202-196042224 CCCTGAGGAAGCCCAGACACTGG - Intronic
968478662 4:824642-824664 CTCTGGGGAAGGCCAGGCAGGGG - Intronic
968609690 4:1551336-1551358 TCCCTGGAAAGGCCAGACACTGG - Intergenic
968704591 4:2072050-2072072 CCTTGGGGAAGGCCACACAATGG + Exonic
968745126 4:2356044-2356066 CCCTGGCCAAGGCCACACAGAGG - Intronic
969323444 4:6426824-6426846 GCTTGGGCCAGGCCAAACACTGG + Intronic
972100062 4:35404238-35404260 CCCTGAGCAAGGGCAGACTATGG - Intergenic
982476218 4:155854635-155854657 CACAGGACAAGGCCACACACAGG - Intronic
983432284 4:167666008-167666030 ACTTGGGCAAGACCAGACAAGGG + Intergenic
984483497 4:180336381-180336403 CCCTGGGCAAGACCAAAGATAGG + Intergenic
984707616 4:182859286-182859308 CTCTGGCCAAGGCCAGAGACAGG - Intergenic
984849587 4:184142480-184142502 CCGTGGGCAAGGCCAACCCCAGG - Intronic
985622578 5:963188-963210 CCCCAGACAAGGGCAGACACAGG + Intergenic
985909328 5:2866549-2866571 CCCTGGCCAATGCCTGGCACTGG - Intergenic
986433699 5:7706897-7706919 CCCTGGGTAAGGCCAAGCATTGG + Exonic
989612865 5:43312489-43312511 CACTGGTCAAGGCCAGACGTGGG + Intronic
991489319 5:67166798-67166820 CCATGGGCGGGGCCAGCCACCGG + Exonic
992132074 5:73703439-73703461 CCCTGGGCCTGGCCAGACTCAGG + Intronic
993274989 5:85845851-85845873 CCCTGAGGATGGCCAGATACTGG - Intergenic
995297785 5:110540269-110540291 CCGTGGGCAATCCCAGCCACTGG + Intronic
995466756 5:112457740-112457762 CCCTGAGGAAGCCCAGACATTGG + Intergenic
997193923 5:131965032-131965054 CCCTGGGCCAGGGCACTCACTGG + Intronic
997472460 5:134124489-134124511 CCCAGGAGAAGGCCAGACTCAGG - Intronic
997693538 5:135844016-135844038 CCCTGGGGAGTGCCAGACATGGG - Intronic
999059691 5:148620102-148620124 CCTGGGGCAAGGTCAGACAAGGG + Intronic
1000988189 5:167883673-167883695 TCCTAGGCAAGCCCAGAGACTGG + Intronic
1001052137 5:168422127-168422149 CCCTGGGCATGGCCAGACATGGG + Intronic
1001148385 5:169204619-169204641 CCTTTGGCAGGGCCAGAGACGGG + Intronic
1001634243 5:173198355-173198377 CCATGGCCAAGGCAAGTCACAGG + Intergenic
1002000313 5:176193338-176193360 CCCTGCGCCTGGCCACACACAGG + Intergenic
1002254024 5:177945646-177945668 CCCTGCGCCTGGCCACACACAGG - Intergenic
1003337144 6:5184918-5184940 CCCTGCGCAAGCCCAAGCACAGG + Intronic
1005590719 6:27323355-27323377 CCCTGAGGAAGCCCAGACATTGG - Intergenic
1005856154 6:29864418-29864440 GCCTGGGCAGGACCAGGCACTGG - Intergenic
1005861987 6:29908721-29908743 GCCTGGGTAGGGCCAGGCACTGG - Intergenic
1006093987 6:31644525-31644547 CCCTGGTCATGGCCAAACCCTGG - Exonic
1006223887 6:32519737-32519759 GCCTGGTCAAGGCCAGAGCCTGG - Intronic
1006230482 6:32581924-32581946 GCCTGGTCAAGGCCAGAGCCTGG - Intronic
1006446189 6:34081062-34081084 CCCTGGGGAAGGCCAGATGAAGG + Intronic
1007752167 6:44077145-44077167 CCCTGGGCACGGCCAGGCCGGGG - Intergenic
1008588525 6:52970472-52970494 CCTTGGGCAAGGACTGACCCTGG - Intergenic
1008877873 6:56349121-56349143 CCCTAGCCAAGGCCAGAAAGAGG - Intronic
1012861704 6:104568040-104568062 CCCTGGTCAAGAGCAGACATTGG + Intergenic
1014217299 6:118764987-118765009 CCCTCTGCATGGCCAGAAACAGG - Intergenic
1014997801 6:128173300-128173322 CCCTGCTCAAGGGCAGAAACTGG - Intronic
1015187759 6:130437584-130437606 CCCTGGTCAAGCCCAGACAGAGG - Exonic
1019162871 6:170080748-170080770 GCCTGCGCCAGGCCAGACACGGG - Intergenic
1019174742 6:170154332-170154354 CCCTGGGCAAGCCCTGAGTCAGG + Intergenic
1019312403 7:369233-369255 TCCTGGGCAAGAGCAGACACGGG + Intergenic
1019434047 7:1012643-1012665 CCCTGGGCTGTGCCTGACACTGG + Intronic
1019599129 7:1872717-1872739 CCCAGCACAGGGCCAGACACGGG + Intronic
1019660422 7:2220890-2220912 CCAGGGGCAAGGCCAGATGCAGG + Intronic
1019995408 7:4721250-4721272 CCCTGTGCACTGCCACACACAGG - Intronic
1020253486 7:6487377-6487399 CACTGGGCAAGGGCAGAAATGGG + Intergenic
1020346876 7:7174944-7174966 CCCTGAGGAAGTCCAGACATTGG - Intronic
1021813330 7:24424613-24424635 ACCAGGGCAAGGGAAGACACGGG + Intergenic
1022097524 7:27150351-27150373 CCCAGGGCAAGGGCAGACAGTGG - Intronic
1025639723 7:63354706-63354728 CCCTGTGCGAGGCCTGACCCAGG - Intergenic
1025642976 7:63393386-63393408 CCCTGTGCGAGGCCTGACCCAGG + Intergenic
1025709945 7:63899873-63899895 CCCTGTGCGAGGCCTGACCCAGG + Intergenic
1025842636 7:65165116-65165138 CCCTGGGAAAGACCAGTCATGGG - Intergenic
1025880409 7:65530852-65530874 CCCTGGGAAAGACCAGTCATGGG + Intergenic
1025893028 7:65671752-65671774 CCCTGGGAAAGACCAGTCATGGG - Intergenic
1026873120 7:73865244-73865266 CACTGAGCAAGGCCAGGCCCAGG - Exonic
1027198637 7:76048366-76048388 CCCGGGGCAGGCCCTGACACTGG + Intronic
1028423693 7:90662408-90662430 CCCTTGGCAAAGCCAGAGATGGG + Intronic
1029307601 7:99631966-99631988 CTCTGGGGAAGGCCACACTCAGG - Exonic
1029602445 7:101576210-101576232 CTCTGAGGAAGTCCAGACACTGG - Intergenic
1032020146 7:128403157-128403179 CCCTGGGCCAGGCCTCACTCAGG + Intronic
1032804056 7:135338648-135338670 CCCCAGCCAAGGCCAGAGACAGG - Intergenic
1033132395 7:138755752-138755774 CTCTGGGCAAGGGTAGACAGTGG + Exonic
1033866190 7:145692715-145692737 CCCAGGGCAAGACCAGTCAGAGG - Intergenic
1034142186 7:148831092-148831114 CGCTGGGAAAGGCCACACACAGG + Intronic
1035204974 7:157289399-157289421 CCCTGGAAAAAGCCAGACCCCGG + Intergenic
1035330367 7:158092852-158092874 ACCTACTCAAGGCCAGACACAGG - Intronic
1037892382 8:22630125-22630147 CCCTGAGCAAAGCCAGGCCCAGG - Intronic
1038586018 8:28790020-28790042 CTCGGAGCAAGGGCAGACACTGG + Intronic
1038738518 8:30194955-30194977 TCCTGAGGAAGCCCAGACACTGG + Intergenic
1039059601 8:33563183-33563205 CTCTAGGCTAGGCCGGACACTGG - Intronic
1040510087 8:48085464-48085486 CCGTGGGCAGGGCCTGACAGCGG + Intergenic
1042868930 8:73380123-73380145 CCCTGGGCATTGCTAGATACTGG + Intergenic
1045601699 8:103723990-103724012 CACTGGGGAAGGCCTGATACTGG + Intronic
1047247535 8:123158404-123158426 CTCTGGGCAAGGCCAGGCGTGGG + Intergenic
1049159579 8:141088849-141088871 CCCCGGGCCAGGCCAGGCCCTGG + Intergenic
1049454488 8:142680198-142680220 CACAGTGCAAGGCCAGACAAGGG - Intronic
1049577663 8:143397179-143397201 GCCTGGCCCAGGCCAGACCCAGG - Intergenic
1049600846 8:143506886-143506908 CCCAGGGCACGGCCACCCACCGG - Intronic
1049759134 8:144324022-144324044 CCCTGGGAGAAGCCAGAAACCGG + Intronic
1051250360 9:15152792-15152814 CCCAGGGGAAGGCCAGAGAAAGG - Intergenic
1051281233 9:15443307-15443329 CCCTGAGGAAGCCCAGACATTGG - Intronic
1051507545 9:17843055-17843077 CCCTGGGCTAGGACAGCCACTGG - Intergenic
1051608577 9:18940101-18940123 CCATGGGGAGGGACAGACACAGG + Intronic
1051701884 9:19833204-19833226 CACTGGGGAGTGCCAGACACTGG + Intergenic
1053208960 9:36211449-36211471 CCCTGGCCCAGGTCAGACTCAGG - Intronic
1055127640 9:72737482-72737504 ACCTAGGCAAGGTCTGACACAGG - Intronic
1056461134 9:86810687-86810709 CCCTGGGCAAGGCCAAAGGCTGG + Intergenic
1057129665 9:92644926-92644948 CCCTGAGGAAGCCCAGACACTGG + Intronic
1058263437 9:102866952-102866974 CCTTGGACAAAGCCAGGCACAGG + Intergenic
1059450545 9:114368722-114368744 CCCTTGGCTAGGCCAAACACAGG + Intronic
1060477829 9:123999298-123999320 CCCTGAGCAAGGCGAGAAAGGGG + Intergenic
1060757286 9:126223051-126223073 CTCTGGGCAGGGCCTGGCACAGG - Intergenic
1061500092 9:130997157-130997179 CCCAGAGCAATCCCAGACACAGG + Intergenic
1061732127 9:132623708-132623730 CCCTGCCCAAGGTCACACACTGG + Intronic
1062347639 9:136122744-136122766 CCCTGGGCCAGCGGAGACACAGG - Intergenic
1062357704 9:136172688-136172710 CCATGGGCTGGGGCAGACACAGG + Intergenic
1062368806 9:136225971-136225993 CCCTGGGGCAGGGCTGACACCGG + Intronic
1062534521 9:137015596-137015618 CCTAGGACAAGGCCAGACCCAGG + Exonic
1062563844 9:137154906-137154928 CCCTGGGCAGTGGCAGGCACAGG + Intronic
1062588593 9:137262980-137263002 TCCTGGGCTCCGCCAGACACAGG - Intronic
1186945678 X:14563620-14563642 CCCTGAGGAAGTTCAGACACTGG + Intronic
1187322218 X:18250183-18250205 CCCTAAGGAAGCCCAGACACTGG + Intronic
1187583370 X:20633276-20633298 TTGAGGGCAAGGCCAGACACAGG - Intergenic
1191894599 X:65978860-65978882 CCCTGGGCAAGGAGAGACCAGGG - Intergenic
1192532757 X:71903270-71903292 CCCTGGGTAACTCCAGAAACTGG + Intergenic
1194240328 X:91436698-91436720 CCCTGGGCCAGGCCAGGCGCAGG + Exonic
1194969926 X:100332103-100332125 CCTTGGGCAAGTCCTGACCCTGG + Intronic
1197299225 X:124757511-124757533 CACTGGGGAATGCCAGACAGTGG - Intronic
1198275995 X:135097071-135097093 CTCTTGGCAAGGCCAGAGAAGGG + Intergenic
1198310520 X:135423661-135423683 CTCTTGGCAAGGCCAGAGAAGGG - Intergenic
1200108078 X:153725377-153725399 CCCTGGCCGGGGCCAGGCACTGG - Exonic