ID: 946362863

View in Genome Browser
Species Human (GRCh38)
Location 2:219229479-219229501
Sequence CCTGGGCAAGGCCAGACACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 241}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362847_946362863 18 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362844_946362863 26 Left 946362844 2:219229430-219229452 CCCTTCCTCCGTTACCCGCCGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362846_946362863 21 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362851_946362863 11 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362850_946362863 12 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362845_946362863 25 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362843_946362863 27 Left 946362843 2:219229429-219229451 CCCCTTCCTCCGTTACCCGCCGC 0: 1
1: 0
2: 2
3: 9
4: 130
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241
946362852_946362863 8 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG 0: 1
1: 0
2: 1
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362863 Original CRISPR CCTGGGCAAGGCCAGACACG GGG Intronic
900830052 1:4959438-4959460 CCTGGGCAAGGACAGGCCAGTGG + Intergenic
901380689 1:8871826-8871848 ACTGGGCAAGGCCAGGAATGGGG + Intronic
902080949 1:13820485-13820507 CCTGGGGTAGGAAAGACACGGGG - Intronic
902217051 1:14940845-14940867 CCTGGGCCTGGCCAGGCAGGTGG + Intronic
902435115 1:16393432-16393454 CCTGGGCAGCGCCAGCCCCGAGG + Exonic
902626454 1:17679423-17679445 CCTGGGCAAACCAAGACACTTGG - Intronic
903558568 1:24210990-24211012 ATTGGGCATGGCCAGACAAGGGG - Intergenic
903741954 1:25563551-25563573 CCTGGGCAAGGCCACATCAGAGG + Intronic
904553738 1:31343425-31343447 ACAGGGCAAGGCCAGACAATGGG - Intronic
904768603 1:32869080-32869102 CCTGGGGAAGGCCATGCAGGAGG + Intronic
905294570 1:36946192-36946214 CCTGGGCAAGCCCTGACACCTGG + Intronic
905302671 1:36996476-36996498 CCGGGACAAGCCAAGACACGCGG + Intronic
907452033 1:54551622-54551644 CCTGGGCCAGGCTAGACCTGAGG - Intronic
908515098 1:64884269-64884291 CTTGGGCAAGGCCAGAAAGGAGG + Intronic
909622426 1:77683219-77683241 CGTGGTGAGGGCCAGACACGGGG - Intronic
912580814 1:110719346-110719368 CCTGGGCAATGCCACACAAGGGG - Intergenic
914802552 1:150972101-150972123 CATGGTCAAGGACAGACACCTGG + Intronic
916817838 1:168370944-168370966 CCTGGTCCAGGCCAGGCAAGTGG + Intergenic
917966849 1:180184192-180184214 CCTGAGCATGGCCAGACCCCAGG - Intronic
918136967 1:181682191-181682213 CCTGGTCAAGGTCTGACACTGGG + Intronic
922422920 1:225471540-225471562 CCTGGGCAGGGCAAGACCCCTGG + Intergenic
922724091 1:227914562-227914584 CCTGCGCAGGGCCAGACTGGAGG - Intergenic
923437759 1:233984032-233984054 CCTGAACAAGGCCAGAGAGGAGG - Intronic
1062793511 10:324771-324793 CCAGGGCGGGGCCTGACACGTGG - Intronic
1063568890 10:7196385-7196407 CGTGGGCATGGCCACACAGGTGG - Intronic
1064020379 10:11804575-11804597 CCTGGGCAACTCCAGACACGGGG + Intergenic
1064806744 10:19143593-19143615 CCTGGGCCAGGCAAGACATGTGG + Intronic
1065174581 10:23064140-23064162 CCGGGGCCAGGCGAGACAGGTGG + Intergenic
1070542294 10:77425004-77425026 CCTGGGCCAGGGCAGGCACCTGG + Intronic
1070579099 10:77705264-77705286 CCTGTGCCAGGTCAGACAAGAGG - Intergenic
1070740553 10:78900429-78900451 CCTGGGCTAGGCCAGTCACTGGG + Intergenic
1070967817 10:80540310-80540332 CCTGGGCAGGGCCAGCCCCCAGG - Intronic
1073110447 10:101060586-101060608 CCTGAAAAAGGCCAGAGACGGGG - Intergenic
1074908170 10:117883203-117883225 TCTGTAAAAGGCCAGACACGTGG - Intergenic
1076834548 10:133014522-133014544 CCTGTGCAAGGGCAGAGACAAGG + Intergenic
1076880738 10:133238050-133238072 CCTGGCCCAGGCCAGACATCCGG + Exonic
1077024199 11:432121-432143 CCTGGGCCTGGCCAGACCAGAGG - Intronic
1081760808 11:45575395-45575417 CCTGGCCAAGGCCACACAGCCGG + Intergenic
1081841004 11:46201399-46201421 CCTGGGGAAGGCAAGAGACTGGG - Intergenic
1082799792 11:57406181-57406203 CCAGGACAGGGCCTGACACGTGG + Intronic
1083709813 11:64541054-64541076 CCTGGGCATGGCCAGCCTGGGGG + Intergenic
1083738817 11:64696977-64696999 CCTGGGGAAGGAGAGACACATGG + Intronic
1083771141 11:64868267-64868289 CCTGAGCAAGCCCAGGAACGAGG - Intronic
1083924568 11:65798192-65798214 CCTGGGCCAGGCCAGGCGGGTGG - Intergenic
1085218105 11:74849851-74849873 CCTAGGCATGGACAGACAGGAGG - Intronic
1088588370 11:111379558-111379580 CCTGGGGAGGGCTTGACACGGGG - Exonic
1088917700 11:114239799-114239821 CCAGGGTAAGCCCAGACAGGCGG + Intronic
1089285540 11:117405379-117405401 CCTAGCCAAGGGAAGACACGAGG - Intronic
1089645485 11:119876031-119876053 CCTGGCCCAGTCCAGACACATGG - Intergenic
1091588367 12:1828630-1828652 CCTGGCCGAGGCCAGCCAAGGGG - Intronic
1091785980 12:3243704-3243726 CCTGGGCAAGACCAGACCACGGG - Intronic
1091828885 12:3535343-3535365 CCTGGGTAAGGCCAGTCTGGGGG + Intronic
1095488366 12:42707609-42707631 ACTGGGCTAGGCCAGTCAAGGGG + Intergenic
1097158910 12:57031879-57031901 CCTGGGAAAGGCCAGAGAGAAGG - Intronic
1104404879 12:128508998-128509020 CCTGGGCCAGGCAGGACACTGGG - Intronic
1104977364 12:132558132-132558154 CCTGGGCAAAGCCAGCCAGGAGG - Intronic
1107816546 13:44249792-44249814 CCTGGGTAGGGCCTGACAAGAGG - Intergenic
1108486676 13:50934084-50934106 CATGGGCAAGGCCATACATCTGG + Intronic
1108841344 13:54620332-54620354 CCTGGGGAAGACCATACATGAGG - Intergenic
1112319849 13:98396023-98396045 CCTCGCCAAGGCCATACATGCGG + Intronic
1113584904 13:111458426-111458448 CCTGGGCAAAGGCAGGCACTGGG - Intergenic
1113864183 13:113510350-113510372 GCTTGACAAGGACAGACACGTGG - Exonic
1114726222 14:24940723-24940745 CCTCGGCAAGGCCAGTTACTTGG - Intronic
1117276764 14:54201912-54201934 CCTAGGGAAGGCCTCACACGTGG - Intergenic
1119249143 14:73136963-73136985 CCTGGACAAGGACACACCCGGGG - Intronic
1119669332 14:76506705-76506727 CCTGGGCCAGCCCAGGCACCTGG - Intergenic
1119703914 14:76772495-76772517 CCTGGGCAAAGCCAGTGACCAGG + Intronic
1121529299 14:94641208-94641230 CCTGGGACAGGGCAGACATGTGG + Intergenic
1121935684 14:98016546-98016568 CCTGGGCAAGCCTGGACAGGTGG - Intergenic
1123011127 14:105350109-105350131 CCTGGGCATGGCCACACCCATGG - Intronic
1124733238 15:32218382-32218404 CCTAGGCAAGGCCACACAGCTGG - Intergenic
1125581624 15:40789654-40789676 CCTGGGAAAGGGCAGAGACTGGG - Intronic
1125892879 15:43279188-43279210 CCTCCGCGATGCCAGACACGCGG + Exonic
1125919731 15:43518313-43518335 CCTCGGCAGGGCCAGAAAGGGGG - Intronic
1127263548 15:57343672-57343694 CTTGGGCAAGGCCAGCCAGATGG + Intergenic
1128354943 15:66919503-66919525 CCTTGGCAGGGCAAGCCACGAGG + Intergenic
1129058435 15:72839160-72839182 CCTGGGCAAATCCAGACTGGAGG + Intergenic
1129884838 15:79030855-79030877 CCTCTGCAAGGGCAGACACAGGG - Intronic
1130437402 15:83914752-83914774 CTTGGGCAAGAACAGACACAAGG - Intronic
1132745610 16:1434965-1434987 CCTGCCCATGGCCAGACACTTGG + Intronic
1134626603 16:15726958-15726980 CCTGGGCCAGGCCAAGCAGGAGG - Exonic
1138241912 16:55434237-55434259 CATGAACAAGGCCTGACACGTGG - Intronic
1139594720 16:67950947-67950969 CCTGGGAAAGGATACACACGAGG + Exonic
1140298512 16:73732436-73732458 CCTGGGCAAATCCAGACATATGG - Intergenic
1141805390 16:86338209-86338231 CCTGGACAATGCTAGTCACGTGG + Intergenic
1141984749 16:87572486-87572508 CGTGGGCAAGGCCAGAAGCCTGG - Intergenic
1142397298 16:89839544-89839566 CCAGGGCCAGGGCAGACAGGGGG - Intronic
1143777671 17:9210008-9210030 CCTGGGCCAGGCCAGGCCCCTGG + Intronic
1143900672 17:10172324-10172346 CTTGGGCAGGGCCGGACATGCGG - Intronic
1144685125 17:17221104-17221126 CCTGGGGAAGCCCAGGCACCTGG + Intronic
1145272101 17:21410199-21410221 CCTGGGCAGGGCCTGCCATGAGG + Intronic
1146003392 17:29145430-29145452 CTGGGGGAAGGCCAGACAGGAGG + Intronic
1147217904 17:38911635-38911657 CCAGGGCACTCCCAGACACGGGG - Intronic
1147741928 17:42674875-42674897 CCTGGCCAAGGCAGGACAGGTGG + Intronic
1147847912 17:43418174-43418196 CCTGGGTGATGCCAGACACTGGG + Intergenic
1148615128 17:48996081-48996103 ACTGGGCAAGGGGCGACACGTGG - Intergenic
1148812416 17:50302034-50302056 ACTGGGCACGGGCATACACGAGG + Intergenic
1154356190 18:13624636-13624658 CATGGGCCAGGCCAGGCATGGGG - Intronic
1160147926 18:76379380-76379402 CCTGGCCAAGCCCAGGCAGGAGG - Exonic
1160356698 18:78233041-78233063 GCTGGGGAAGGCCACACACACGG + Intergenic
1160554223 18:79715550-79715572 CCTGGGCATGGTCAGGCCCGCGG + Intronic
1160817042 19:1040941-1040963 CCTGGGCTGGGCCAGGCAGGAGG + Intronic
1160854055 19:1208031-1208053 CCTGGGCAGGGCCCGCCAGGCGG - Intronic
1160968745 19:1758076-1758098 CCGGGGCCAGGACAGAGACGGGG + Intronic
1161379210 19:3955843-3955865 CCAGAGGAAGGCCAGAGACGGGG + Intergenic
1161379817 19:3958992-3959014 GCTGGGCAAGGACAGGCACCCGG + Exonic
1161411527 19:4120878-4120900 CACGGGCACAGCCAGACACGGGG - Intronic
1162041782 19:7975203-7975225 CCAGGGCAAGCCCGGACACTAGG - Intronic
1162332257 19:10037586-10037608 CCAGGGCCAGGGCAGACAAGAGG + Intergenic
1163441513 19:17324498-17324520 CCTGGGGAGGGTCAGGCACGGGG + Intronic
1163727607 19:18931701-18931723 CCTGGGCGTGGCCAGACAGGAGG - Intronic
1163735552 19:18978175-18978197 CCTGGGCAGGGCCAGGCCTGAGG + Intergenic
1164463062 19:28464755-28464777 CCTGGGAAAGCCCAGGCACTTGG + Intergenic
1165385649 19:35509360-35509382 CAGGGGCAAGGCCAGACCGGAGG - Intronic
1166345040 19:42160235-42160257 CCAGGGTGAGGCCAGAGACGAGG + Intronic
1167896228 19:52584843-52584865 CCTGGGTCAGGCCAGACGGGAGG - Exonic
1168236073 19:55063772-55063794 TCTGTGCAGGGCCAGACATGGGG - Intronic
925693163 2:6546488-6546510 ACTGGGCAAGGCCAGAGACATGG - Intergenic
927253483 2:21019283-21019305 CCAAGGCAAGGGCAGACACCAGG + Intronic
927510504 2:23641312-23641334 CCTGGGCACGGCCAGCCCTGGGG - Intronic
928092061 2:28380921-28380943 GCTGGGCAAGGGGAGAAACGTGG - Intergenic
928379799 2:30807941-30807963 CCTGGGCATGGCGAGACCCAGGG + Intronic
928652776 2:33419994-33420016 CCAGGGCAAGGGCAGAGACTTGG - Intergenic
929607140 2:43242175-43242197 CCTGGGAAAGGAAAGACACAGGG - Intronic
931644127 2:64406126-64406148 CCTGTGCAGGGCCTGACACATGG - Intergenic
933955269 2:87357660-87357682 CCAGGGCAAGGCAAGACCAGGGG - Intergenic
934553322 2:95275192-95275214 CCTGGGCAAAGGCAGAGAAGGGG - Intronic
935701502 2:105816028-105816050 CCTGGGCAAGCTCCGACACTCGG - Intronic
937329728 2:121019009-121019031 CCCGTGCAGGGCCAGCCACGAGG - Intergenic
937580860 2:123485831-123485853 CCTGGGCAAGCCAAGCCAGGTGG - Intergenic
941366917 2:164621216-164621238 CCTGGGCAGCGCCACACACCTGG + Exonic
941855946 2:170231088-170231110 CCTGCTCAAGGACAGACAAGGGG + Intronic
942064900 2:172261450-172261472 CCTGGGATAGGCCAGACATTTGG - Intergenic
942094436 2:172524092-172524114 CCTAGGGAAGGCCAGAGAAGAGG - Intergenic
944490556 2:200254101-200254123 CTTGGCCAAGGCCAAACACCTGG - Intergenic
944881983 2:204022632-204022654 TCTGGGCAAGGTCAGACAAGAGG - Intergenic
946362863 2:219229479-219229501 CCTGGGCAAGGCCAGACACGGGG + Intronic
946432995 2:219635487-219635509 CCTGGGAAAGGTCAGACCCTTGG + Exonic
947824802 2:233098427-233098449 CGTGGTCAGGGCCAGACACCAGG + Intronic
948619792 2:239227230-239227252 CCTGGGCTCTGCCAGCCACGTGG - Intronic
948632686 2:239312189-239312211 CCTGGGCAGGGCAGGACACCAGG + Intronic
948808337 2:240462543-240462565 CCTGGGCGTGGCCAGCGACGTGG + Exonic
1170857480 20:20070467-20070489 CCTGGGCAAAGAGAGACACTTGG + Intronic
1172272895 20:33664340-33664362 CTGGGGCAAGGCCTGAGACGTGG + Intronic
1173010899 20:39181176-39181198 GAGGGGCAAGGGCAGACACGGGG - Intergenic
1174298808 20:49567906-49567928 CCCGGGCAAGGCGAGACCCTCGG - Intronic
1175210004 20:57348335-57348357 CCTTGGCCAGCCCAGAAACGGGG - Intergenic
1175482470 20:59321240-59321262 CCTCGGCAAGGCCAGGCCAGGGG + Intronic
1178745727 21:35248441-35248463 ACTGGGCAATGCAAGACACAGGG + Intronic
1179507652 21:41852480-41852502 GCTGGGCCAGGCCAGGCACCTGG + Intronic
1179532783 21:42031709-42031731 CCTGGGTGAGCCCAGACCCGGGG + Intergenic
1179597535 21:42452807-42452829 CCTGGGCAGGGGGAGCCACGCGG + Intergenic
1180074064 21:45453832-45453854 CCTGGGCAGAGCCAGGCACAAGG - Intronic
1180141055 21:45893557-45893579 CCTGGGCAAGTGCAGACAGTGGG + Intronic
1180228662 21:46413262-46413284 CCTGGGAGAGGCTGGACACGCGG + Intronic
1181648848 22:24247864-24247886 CATGGGGAAAGCCAGGCACGTGG - Intergenic
1183333556 22:37234179-37234201 CTGGCGGAAGGCCAGACACGGGG + Intronic
1183608570 22:38882162-38882184 CCTGGACAGGGCCTGACACTAGG + Intergenic
1184090724 22:42291713-42291735 CCTGGGCTAGGCCAGGCAGCCGG - Intronic
1184566606 22:45295748-45295770 CTGGGGCAAGGCCAGAGAGGAGG - Exonic
1185132484 22:49047019-49047041 CTTGGGAAAGGCCAGAGACAGGG - Intergenic
1185146548 22:49140107-49140129 CCTGGGCAAGGGCATCCAGGGGG - Intergenic
1185306335 22:50119300-50119322 CGTGGGCAGGTCCAGACACCTGG - Intronic
950175485 3:10870613-10870635 CCTTGGCCATGCCAGACACTTGG - Intronic
950676668 3:14558333-14558355 CCTGGGCTAAGCCAGCCAGGCGG - Intergenic
950941026 3:16891629-16891651 CCTGGGCAAAGCAAGACATGTGG - Intronic
953901554 3:46846608-46846630 CCTGGGCCCTGCCAGACACCTGG - Intergenic
956710737 3:72036619-72036641 CCTTGGCCAGGGCAGAAACGAGG + Intergenic
961017700 3:123480452-123480474 CCTGGGCAGGGGCAGACACCTGG + Intergenic
961389378 3:126543120-126543142 CCTGGGTAGGGCCAGCCGCGTGG - Exonic
964474262 3:157084430-157084452 GCTGGGGAAGGCCATGCACGGGG + Intergenic
968609688 4:1551335-1551357 CCCTGGAAAGGCCAGACACTGGG - Intergenic
968745124 4:2356043-2356065 CCTGGCCAAGGCCACACAGAGGG - Intronic
969577742 4:8046394-8046416 CGTGGGGAAGGCCAGGCAGGTGG - Intronic
979253220 4:118586704-118586726 CAAGGGCAATGCAAGACACGTGG - Intergenic
985391549 4:189496141-189496163 CATGTGCAAGCCTAGACACGTGG + Intergenic
985860205 5:2464751-2464773 CCTGGACGAGGCCACACACTAGG + Intergenic
990725237 5:58745627-58745649 CCTGGCGGAGGCCAGCCACGAGG + Intronic
992563048 5:77971694-77971716 CCTGTCCAAAGCCAGACAGGTGG + Intergenic
994267640 5:97737695-97737717 TCTGGACTAGGCCAAACACGAGG - Intergenic
999325284 5:150639931-150639953 CCAGTGCAGGGCCAGTCACGTGG - Intronic
1000988191 5:167883674-167883696 CCTAGGCAAGCCCAGAGACTGGG + Intronic
1001085012 5:168694132-168694154 CCTGGTCAACGGCAGACACCAGG + Intronic
1001561461 5:172671942-172671964 CCTGGCCAAGGCCACACAGCTGG - Intronic
1001939421 5:175729949-175729971 CCAGGGGAAGCCCAGGCACGGGG + Intergenic
1002522196 5:179798132-179798154 GCAGGGCCAGGCCAGGCACGGGG - Intronic
1002674353 5:180898651-180898673 CCTGGGCAGGTTCAGACATGAGG - Intergenic
1004293779 6:14391820-14391842 CTTGCGCAAGGCCACACAAGAGG - Intergenic
1005685315 6:28248123-28248145 CCTGGGCAAGCCCAGGAACCTGG + Exonic
1006223885 6:32519736-32519758 CCTGGTCAAGGCCAGAGCCTGGG - Intronic
1006230480 6:32581923-32581945 CCTGGTCAAGGCCAGAGCCTGGG - Intronic
1006338595 6:33433558-33433580 CCTGGGGGTGGCCAGACATGGGG - Intronic
1007752165 6:44077144-44077166 CCTGGGCACGGCCAGGCCGGGGG - Intergenic
1008169605 6:48186879-48186901 TGTGGGCAAGGCCAGACAGAAGG - Intergenic
1011547578 6:88498508-88498530 CCTGGGCAGGGCCAGGCTCAAGG - Intergenic
1016902070 6:149113100-149113122 CCTGGGCAAACCCAGACATCTGG - Intergenic
1018026912 6:159813957-159813979 CCTGTGCAAGGCCAGGCAGGAGG + Intronic
1018226034 6:161629597-161629619 CCTGGGAAGGGCAAGACAGGAGG - Intronic
1020253487 7:6487378-6487400 ACTGGGCAAGGGCAGAAATGGGG + Intergenic
1022097522 7:27150350-27150372 CCAGGGCAAGGGCAGACAGTGGG - Intronic
1025993979 7:66516663-66516685 CCTTGGGAAGCCCAGACAGGAGG + Intergenic
1028423695 7:90662409-90662431 CCTTGGCAAAGCCAGAGATGGGG + Intronic
1031567633 7:123320307-123320329 CCTGGGCAGGGCGAGTCAGGAGG + Intergenic
1032005892 7:128301710-128301732 CCAGGGCAAGGCCCGCCAAGTGG - Exonic
1034504412 7:151475514-151475536 TCTGGACAAGGCCTTACACGTGG + Intronic
1034893349 7:154859311-154859333 GCTGGGCAGGGCAAGACAGGAGG + Intronic
1035330365 7:158092851-158092873 CCTACTCAAGGCCAGACACAGGG - Intronic
1035571350 8:675125-675147 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571375 8:675234-675256 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571388 8:675289-675311 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571401 8:675344-675366 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571414 8:675399-675421 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571421 8:675427-675449 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571434 8:675482-675504 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571447 8:675537-675559 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571460 8:675592-675614 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571473 8:675647-675669 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571505 8:675783-675805 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571512 8:675811-675833 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571532 8:675893-675915 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571592 8:676138-676160 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571599 8:676166-676188 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571606 8:676194-676216 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571633 8:676304-676326 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571640 8:676332-676354 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571659 8:676414-676436 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571666 8:676442-676464 CCTCGGCGAGGACAGAGACGCGG + Intronic
1035571673 8:676470-676492 CCTCGGCGAGGACAGAGACGCGG + Intronic
1036424721 8:8633760-8633782 CCAGGCCAAGGCCACACACAAGG + Intergenic
1036664490 8:10730086-10730108 CCTGGGGAAGACCCGGCACGCGG - Intronic
1037889677 8:22617226-22617248 CCAGGGCATCGCCAGACACCTGG - Intronic
1045863899 8:106843566-106843588 GCTGAGGAAGGCCAGGCACGGGG + Intergenic
1047247536 8:123158405-123158427 TCTGGGCAAGGCCAGGCGTGGGG + Intergenic
1047922961 8:129654154-129654176 CTTGGGAAAGGCCAGAGAGGAGG - Intergenic
1049224351 8:141442521-141442543 CCTGGGCAAGGGCACAGAGGTGG + Intergenic
1049263404 8:141652120-141652142 CCTGGGCAAGGCCACGCAGTTGG - Intergenic
1051507543 9:17843054-17843076 CCTGGGCTAGGACAGCCACTGGG - Intergenic
1056461136 9:86810688-86810710 CCTGGGCAAGGCCAAAGGCTGGG + Intergenic
1057745124 9:97745331-97745353 CCTGGGCAGGGCCTGACACATGG - Intergenic
1058822317 9:108744119-108744141 CTTGGGCAAGTGCACACACGTGG + Intergenic
1059330083 9:113529386-113529408 CCTGGGCAAGGCCAGAGTAGCGG + Intronic
1059339097 9:113587343-113587365 CCTAGGCAATGCCAGGCAAGAGG + Intronic
1060477831 9:123999299-123999321 CCTGAGCAAGGCGAGAAAGGGGG + Intergenic
1060656582 9:125376373-125376395 CAAGGGCAGGGCCAGACACCCGG + Intergenic
1060779113 9:126398742-126398764 CCTGGCCCAGGCCAGCCAGGAGG + Intronic
1061807158 9:133142887-133142909 CCTGGGAAGGGCCAGGCACCAGG - Intronic
1062271616 9:135712470-135712492 CCCTGGCATAGCCAGACACGGGG - Intronic
1062588591 9:137262979-137263001 CCTGGGCTCCGCCAGACACAGGG - Intronic
1062601846 9:137321910-137321932 CCTGGGCATGGCCAGTCTGGGGG - Intronic
1185643420 X:1600601-1600623 CCTGAGCCTGGCCGGACACGTGG - Intronic
1187401662 X:18965974-18965996 CTTGGGCCAGGCCAGATAAGTGG - Intronic
1189148968 X:38685050-38685072 CCTGGAGGAGGCCAGACAGGAGG - Intronic
1198275996 X:135097072-135097094 TCTTGGCAAGGCCAGAGAAGGGG + Intergenic
1198310519 X:135423660-135423682 TCTTGGCAAGGCCAGAGAAGGGG - Intergenic
1200039708 X:153356111-153356133 CCTAGGCAAGGCCTGACAGCAGG + Intronic
1201858966 Y:18574114-18574136 CCGGGGCATGGCCAGACCAGAGG + Intronic
1201874356 Y:18746267-18746289 CCGGGGCATGGCCAGACCAGAGG - Intronic