ID: 946362864

View in Genome Browser
Species Human (GRCh38)
Location 2:219229484-219229506
Sequence GCAAGGCCAGACACGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 257}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362857_946362864 -7 Left 946362857 2:219229468-219229490 CCGCAGGCACCCCTGGGCAAGGC 0: 1
1: 1
2: 2
3: 38
4: 299
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362846_946362864 26 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362845_946362864 30 Left 946362845 2:219229431-219229453 CCTTCCTCCGTTACCCGCCGCGA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362847_946362864 23 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362851_946362864 16 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362852_946362864 13 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257
946362850_946362864 17 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362864 Original CRISPR GCAAGGCCAGACACGGGGCC TGG Intronic
900162024 1:1228358-1228380 GCAGGTCCCGACACAGGGCCCGG + Intronic
900189818 1:1348639-1348661 CCAAGGCAGGACTCGGGGCCGGG + Intronic
900785656 1:4648438-4648460 GCAAAGCAAGTCACAGGGCCAGG - Intergenic
901220456 1:7580662-7580684 GCACAGCCAGCCTCGGGGCCAGG - Intronic
901836184 1:11925705-11925727 GCAAGGCCAGAGACGGAGGCGGG + Exonic
902804536 1:18852704-18852726 TCAAGCCCAGTCACGTGGCCAGG + Intronic
903623271 1:24713546-24713568 GCAAGGCCAGCCTCTGGCCCTGG - Intergenic
904562096 1:31405729-31405751 GCAAGGCCAGGCCTGGGCCCTGG - Intergenic
904606640 1:31701513-31701535 GCAAGGCCAGGCAAGTTGCCCGG + Intronic
904607146 1:31704181-31704203 GCTCGGCCAGACCCGGGGCGGGG - Exonic
904607289 1:31704683-31704705 GCAAAGCCAGAGCAGGGGCCAGG - Intergenic
907334062 1:53688940-53688962 CCCAGGCCAGACTCTGGGCCAGG + Intronic
914251404 1:145924873-145924895 GCAGGGCCAGTCTCAGGGCCCGG - Intergenic
915486318 1:156223385-156223407 GCAGGGCCAGACACAGAGTCTGG - Intronic
919986962 1:202682097-202682119 GCAAGGCAAGACAGGGACCCAGG - Intronic
920059280 1:203216545-203216567 GCAAGACCTGCCACAGGGCCTGG + Exonic
920199659 1:204251799-204251821 GAAAGGCCACAGAAGGGGCCGGG + Intronic
1066250953 10:33632163-33632185 GCAAGCCCAGGCAGTGGGCCAGG - Intergenic
1067148979 10:43714221-43714243 AGAAGGACAGAGACGGGGCCAGG - Intergenic
1068786698 10:60983774-60983796 GCAAGGCCAGACATTGGGGAAGG - Intronic
1069810831 10:71158364-71158386 GCAAGGCCAGGAATGGGACCTGG - Intergenic
1070746751 10:78938237-78938259 GGAAGGGCAGACAGGGGCCCTGG - Intergenic
1071309453 10:84328822-84328844 TCAGGGCCAGAGCCGGGGCCGGG + Intronic
1072437854 10:95430161-95430183 TCAAATCCACACACGGGGCCGGG + Intronic
1072894345 10:99353365-99353387 GCAATGCCTGACACTGTGCCTGG + Intronic
1073101836 10:101010581-101010603 GCAGAGCCAGATCCGGGGCCGGG - Intronic
1073326902 10:102648431-102648453 GCAAGGCCAGACATGTTGCTAGG + Intronic
1073458653 10:103652923-103652945 GCAAGGGCAGAGACGGGTGCCGG - Intronic
1074123345 10:110509454-110509476 GCACAGCCAGACAGGGTGCCCGG + Intronic
1075002330 10:118808060-118808082 GAAAGGCCAGACAGGCAGCCTGG - Intergenic
1075343450 10:121665092-121665114 GCAAGGGCAGAGACTGGGCTGGG - Intergenic
1076698231 10:132257264-132257286 GGAAGGACAGACACGTGGACAGG - Intronic
1076744255 10:132504859-132504881 GAATGGCCAGACCCCGGGCCAGG + Intergenic
1076858325 10:133128070-133128092 GCAGAGCCAGGCAGGGGGCCAGG - Intronic
1077354261 11:2107817-2107839 GCCAGGCCAGACCCAAGGCCAGG + Intergenic
1077417599 11:2432099-2432121 GGAAGGGCAGACACTGGGCCGGG + Intergenic
1077442255 11:2574305-2574327 ACAAGGGCAGACGCGGGGGCAGG - Intronic
1077804030 11:5571948-5571970 GCAAGGCCACACACGGTGGATGG - Intronic
1078527296 11:12110686-12110708 GGCAGGCCTGACCCGGGGCCGGG + Exonic
1080387173 11:31817009-31817031 GGAGGGCCAGAGCCGGGGCCCGG - Intronic
1081807956 11:45900359-45900381 CCAAGGCCAGAGCCAGGGCCCGG + Exonic
1081812188 11:45920342-45920364 CCAAGCCCAGGCAGGGGGCCAGG - Intergenic
1084468729 11:69342818-69342840 GCAAGGCCAGACACAGGCAAAGG + Intronic
1084938499 11:72600111-72600133 GCAAGGCTAGACAGGGGCCAGGG + Intronic
1085386782 11:76162211-76162233 TTAAGGCCAGACATGGGGCTGGG - Intergenic
1085533622 11:77205636-77205658 GCAGGGACAGACACTGGGGCGGG + Intronic
1085724369 11:78941572-78941594 GCAAGCCCTGGCACGGCGCCGGG + Intronic
1089342714 11:117770238-117770260 GCAAGGCCTGGCACTGTGCCTGG + Intronic
1089617957 11:119705819-119705841 CCAAGGCCAGAGGCGGGGCAGGG + Intronic
1089640953 11:119846914-119846936 CCAAGGCCAGACACTGTGCCAGG + Intergenic
1089811759 11:121137926-121137948 ACAAGGCCAGTGACGGGTCCCGG - Exonic
1090237948 11:125163577-125163599 CCCAGGCCAGGCAGGGGGCCTGG - Intergenic
1090537338 11:127657875-127657897 TCAAGGCCAGACAACGGGCTAGG - Intergenic
1091615426 12:2047478-2047500 GACAGGCCAGACACAGAGCCAGG - Intronic
1092926717 12:13278611-13278633 GCAAGGCTCGACCCTGGGCCAGG - Intergenic
1094040164 12:26114089-26114111 GCAAGTCCTGGCCCGGGGCCTGG + Intergenic
1100395089 12:94179072-94179094 GCAAAGCTAGACTCGGGCCCAGG + Intronic
1100404869 12:94264040-94264062 GAAAGGCCAGCCACGTGGCTGGG - Intronic
1101900712 12:108789330-108789352 GCGAGGCCGGACTGGGGGCCAGG + Intronic
1102572169 12:113833491-113833513 GCCAGGCCAGACAAGGCCCCAGG + Intronic
1103733107 12:123041776-123041798 GGAAGGCCAGGCAAGGGGTCTGG + Intronic
1105014506 12:132777890-132777912 GCCAGGACATGCACGGGGCCGGG - Intronic
1112054298 13:95676695-95676717 GGAAGGCCAAACACGGTCCCGGG - Intergenic
1112374225 13:98823961-98823983 GAGAGGCCAGACTCGGGTCCTGG - Intronic
1113490690 13:110689393-110689415 GCAACGCCACACGTGGGGCCAGG + Intronic
1113790153 13:113023993-113024015 GCAAGGCCAGACCCAGGCTCGGG + Intronic
1117889156 14:60399269-60399291 GCAGGGCCAGTCTCAGGGCCCGG + Intronic
1122083115 14:99280585-99280607 GCATGGCGAGAGACCGGGCCAGG - Intergenic
1122142126 14:99668731-99668753 GGAAGGGCAGGCACGGGGCGGGG - Intronic
1122742872 14:103881988-103882010 GCAGGGCCAGGAACGGGGCCCGG - Intergenic
1122773132 14:104105970-104105992 TCCAGGCCTGACATGGGGCCTGG + Intronic
1122954821 14:105065710-105065732 GCAAGGCAGGACAGGGGTCCTGG + Intergenic
1123938720 15:25206486-25206508 CCAAGGCCACACAGGGAGCCAGG - Intergenic
1124353793 15:28979622-28979644 GCAAGGCCAGAAAGGGGCCAGGG - Intronic
1124596907 15:31098820-31098842 GCAGGGGCAGACAGGGGGCCAGG + Intronic
1125999421 15:44195161-44195183 GCAACGGCAGCGACGGGGCCGGG - Exonic
1126676013 15:51159837-51159859 GAAAGGCCAGACGAAGGGCCAGG - Intergenic
1129828275 15:78650092-78650114 GCTAGGCCAGACAAGGGACCGGG - Intronic
1129897058 15:79116197-79116219 GCAAGGCCCGGCAATGGGCCTGG - Intergenic
1130927887 15:88398686-88398708 GCAAGGCCAGGTGCTGGGCCAGG + Intergenic
1131137788 15:89951665-89951687 GCAATGCCTGACATGGGGCCAGG + Intergenic
1132463241 16:65930-65952 GACATGCCAGGCACGGGGCCAGG + Intronic
1132513944 16:357471-357493 GAAAGACCTGACACTGGGCCAGG + Intergenic
1132574881 16:659719-659741 GCAGGGCTGGAGACGGGGCCTGG + Intronic
1132576176 16:665503-665525 GCAGGGACACACACGGGGGCCGG + Intronic
1132882864 16:2170148-2170170 GCAAGGCCAGACAAGCAGCCAGG + Intronic
1134531818 16:14989628-14989650 GCAAGGCCAGAGACGGAGGCGGG + Intronic
1134656497 16:15951518-15951540 GCAAGGTCAAACACGGGGATGGG - Intronic
1135488744 16:22888678-22888700 GAAAAGCCAGAGACGGAGCCAGG - Intronic
1136247861 16:28985581-28985603 GCCAGGACAGACACAGGGGCTGG - Intronic
1136407306 16:30055427-30055449 TCAAGGCCAGGCACGGTTCCAGG + Intronic
1137771167 16:51016118-51016140 GCAAGGTCAGACATGGGTTCAGG + Intergenic
1138050718 16:53774500-53774522 GCCAGGCCAGAAACAGAGCCAGG - Intronic
1138094189 16:54199446-54199468 GCCAGGCTGGGCACGGGGCCTGG + Intergenic
1138460774 16:57146469-57146491 GCAAGGCCTGGCACGGCGCCTGG - Intronic
1139471346 16:67179641-67179663 GCGAGGCCAGACAATTGGCCAGG + Intronic
1141183733 16:81772465-81772487 GGAAGGTAAGACACGGGGCCTGG + Intronic
1141657350 16:85423278-85423300 GCAAGGCCAGGCCCTGGGTCAGG + Intergenic
1141877283 16:86834559-86834581 GAAAGGCCAGAGACGCGTCCCGG - Intergenic
1142185983 16:88694948-88694970 GCCAGGGCAGGCACTGGGCCCGG - Intergenic
1203120348 16_KI270728v1_random:1530496-1530518 GCGAGGCCAGACAAGGGCCGCGG + Intergenic
1142644493 17:1303072-1303094 GAAAGGCCTGGGACGGGGCCAGG - Intergenic
1142683149 17:1562108-1562130 GCCAGGCCCGAGACGGGGTCAGG - Intronic
1143181827 17:4988168-4988190 ACAAGGCCAGGAGCGGGGCCTGG + Intronic
1144041191 17:11412806-11412828 GAAAGGCCACACCCGGGCCCAGG - Intronic
1144787663 17:17840776-17840798 GCAGGGCCAGGCAGGGGGGCAGG - Intergenic
1146274829 17:31509994-31510016 GCAAGGCCTGACCCAGAGCCAGG + Intronic
1146518737 17:33509820-33509842 GCAAGGCTAGACTGGGAGCCAGG + Intronic
1147989517 17:44324435-44324457 GACGGGCCAGACCCGGGGCCCGG + Intronic
1148156390 17:45427354-45427376 GCAAGAGAAGACATGGGGCCGGG - Intronic
1148180608 17:45602118-45602140 CCAAGGCCAGAGCCAGGGCCCGG - Intergenic
1148268294 17:46243797-46243819 CCAAGGCCAGAGCCAGGGCCCGG + Intergenic
1148740668 17:49890708-49890730 GCGAGGCCAGCCTAGGGGCCCGG - Intergenic
1149569325 17:57661328-57661350 GCAAGACATGACACAGGGCCTGG + Intronic
1151583514 17:74993938-74993960 GCCAGACCAGCCACTGGGCCTGG - Intronic
1152524318 17:80878971-80878993 GCAAGGCGGGGGACGGGGCCTGG - Intronic
1155258990 18:24023292-24023314 GCAAAGGCAGCGACGGGGCCAGG - Intronic
1157436676 18:47676272-47676294 GCAAAGCCAGACCCGGGTCTTGG - Intergenic
1159132340 18:64292937-64292959 GCAAGGGCAGCCATGGGGCTGGG + Intergenic
1160529361 18:79554557-79554579 GCTCTGCCAGACACTGGGCCGGG - Intergenic
1160624008 18:80190563-80190585 GCAGGCCCAGACACGGATCCTGG + Intronic
1160679793 19:407478-407500 GCCTGGCCCGACTCGGGGCCAGG + Exonic
1160968746 19:1758081-1758103 GCCAGGACAGAGACGGGGACAGG + Intronic
1161379212 19:3955848-3955870 GGAAGGCCAGAGACGGGGCTGGG + Intergenic
1161457758 19:4378065-4378087 GCAGGGCCAGGCACAGGGACAGG + Intronic
1162795837 19:13087200-13087222 GCAAGGCCATGCACAGGGCCTGG + Intronic
1162986991 19:14277317-14277339 GCAACCCCAGGCACAGGGCCTGG - Intergenic
1163028672 19:14529278-14529300 GTTAGGCCAGACGCGGGGGCGGG - Intronic
1164643494 19:29842978-29843000 GCAAGGTCCCACATGGGGCCTGG + Intergenic
1164862115 19:31570046-31570068 GAAAAGTCAGACATGGGGCCAGG + Intergenic
1165950433 19:39471295-39471317 GGAAGGGGAGACACGGGGCAGGG - Intronic
1166313827 19:41977791-41977813 GGAGGGCCAGACCCAGGGCCTGG + Intronic
1166752056 19:45168948-45168970 GCGAGGCCTGGCAAGGGGCCAGG - Intronic
1166778716 19:45328390-45328412 TCAAGGCCAGACCCAGGGCTGGG + Intergenic
1167003606 19:46760656-46760678 TCAAGACCAGACTAGGGGCCAGG + Intronic
1167523919 19:49972248-49972270 ACCAGGGCAGAGACGGGGCCGGG - Intergenic
1167703113 19:51062576-51062598 TCAATGCCAGACACAGTGCCTGG - Intronic
1168092842 19:54096906-54096928 CGAAGGCCAGACTGGGGGCCGGG - Exonic
1168241464 19:55091218-55091240 CCAGGGCCAGAGACGGGACCAGG - Exonic
925253266 2:2460709-2460731 GAAAAGCCTGACATGGGGCCCGG - Intergenic
928200155 2:29242784-29242806 ACAAGGCGAGACCCGGGGCTGGG + Intronic
937329725 2:121019004-121019026 GCAGGGCCAGCCACGAGGCTGGG - Intergenic
937345179 2:121121053-121121075 GCAAAGTCAGAGATGGGGCCCGG - Intergenic
937569137 2:123334559-123334581 GCTAGGCCAGACTGGGGCCCTGG - Intergenic
939403919 2:141731264-141731286 GCAGGCCCAGACACTGTGCCTGG - Intronic
940904504 2:159157079-159157101 GCAAGGCCAGAGAGGGAGCAGGG + Intronic
943015511 2:182505477-182505499 TCTGGGCCAGACACAGGGCCTGG + Intronic
946362864 2:219229484-219229506 GCAAGGCCAGACACGGGGCCTGG + Intronic
946386797 2:219388343-219388365 GCACGGCCTGACAAGGGGCGGGG - Intronic
947714998 2:232334908-232334930 GCCAGGCCTGACCCTGGGCCTGG - Intronic
947734074 2:232445859-232445881 GCCAGGCCTGACCCTGGGCCTGG - Intergenic
948456549 2:238107137-238107159 GCTGGGACAGACATGGGGCCTGG - Intronic
1169626524 20:7577402-7577424 GCAAGGTCAGAGATGGGGCTTGG + Intergenic
1171149102 20:22811000-22811022 CCAGGGCCTGACACGTGGCCTGG + Intergenic
1171773334 20:29344058-29344080 CCAATGCCAAACATGGGGCCTGG - Intergenic
1175119855 20:56709249-56709271 TCACAGCCAGACACGGGGGCAGG + Intergenic
1175388804 20:58613743-58613765 GAAAGGCCTGACACGGGCCCTGG + Intergenic
1175840123 20:62021358-62021380 GCATGGCCAGGCACAGGGTCCGG + Intronic
1175889910 20:62311433-62311455 GCAAGCCCAGACCCCGGGCCTGG - Exonic
1175916076 20:62426630-62426652 GCACGGCCAGACAAGCGACCTGG - Intronic
1176000701 20:62830126-62830148 GTCAGGCCAGACTCGGGGCCAGG - Intronic
1180155729 21:45976735-45976757 GGAAGGACAGAAGCGGGGCCTGG + Intergenic
1180160033 21:45994977-45994999 ACAAGGCCAGACCCTGGGCACGG + Intronic
1180230139 21:46422181-46422203 GCAAGGCAGGACACAGGGCTTGG - Intronic
1180920972 22:19521526-19521548 GAAAGGACAGGCACGGGGCTGGG - Intergenic
1182283344 22:29230646-29230668 GACAGGCCAGCCAAGGGGCCTGG - Intronic
1183333557 22:37234184-37234206 GGAAGGCCAGACACGGGGTGAGG + Intronic
1183864692 22:40694902-40694924 ACAAGGCAAGACACGGAGCTGGG - Intergenic
1184479054 22:44736642-44736664 GGAAGGCCCGACCCGGGGCCCGG - Intronic
1184693319 22:46127243-46127265 GCAAGGCCAGAGCAGGGGCCGGG - Intergenic
1184801434 22:46762785-46762807 CCATGGCCAGCGACGGGGCCAGG + Exonic
1184817546 22:46883791-46883813 GCAAGGCCGGAAACAGAGCCTGG - Intronic
1184913387 22:47550720-47550742 ACAAGGCCAGACACGCAGCGGGG - Intergenic
1185343829 22:50302849-50302871 GCAAGGCTGGGCACAGGGCCTGG + Intronic
950210262 3:11117831-11117853 GCCAAGGCAGACACAGGGCCAGG + Intergenic
952879476 3:37974506-37974528 GCCAAGCCTGACACGAGGCCAGG - Intronic
954556242 3:51519790-51519812 GCAAGGCTGGAGATGGGGCCAGG - Intergenic
954626701 3:52025807-52025829 ACAGGGCCAGACACGTGGCAGGG - Intergenic
955004509 3:54956212-54956234 GCAAGGCAAGCCACTGGGCTTGG - Intronic
955161478 3:56468454-56468476 CCAGGGCCAGGCGCGGGGCCGGG + Intergenic
956889668 3:73599743-73599765 GCAAGGCCATTCATGGCGCCTGG + Intronic
957771022 3:84692556-84692578 GCAAGACCAGCCTCGGGGGCTGG + Intergenic
960595913 3:119407773-119407795 GCAAGGCCTGGCAGGGGGACTGG + Intronic
962738272 3:138344958-138344980 CCAAGGTCAGACACAGGGCCAGG - Intergenic
968048243 3:195635679-195635701 TCGAGGCGAGAAACGGGGCCTGG - Intergenic
968065213 3:195754598-195754620 GCAGGGCCAGGCAGGGGGTCAGG - Intronic
968088512 3:195885469-195885491 GTCAGGCCAGAGAAGGGGCCAGG - Intronic
968099161 3:195953941-195953963 TCGAGGCGAGAAACGGGGCCTGG + Intergenic
968464389 4:743209-743231 CCTAGGACAGGCACGGGGCCTGG - Intronic
969936189 4:10684344-10684366 GGAAAGCCAGCCATGGGGCCTGG + Intronic
971027089 4:22599351-22599373 GCCAGGCCCGAAACCGGGCCTGG + Intergenic
971474015 4:27055699-27055721 GCAGAGCCTGACACTGGGCCTGG + Intergenic
975278096 4:72526129-72526151 GCAAGGCCAGGGAAGAGGCCAGG - Intronic
975425870 4:74227018-74227040 GGAAGGGCAGACACTGGGGCTGG - Intronic
983894834 4:173070822-173070844 GCTAGGTCAGACATGGAGCCTGG + Intergenic
985703156 5:1385877-1385899 GCAGGGCCGGCCGCGGGGCCTGG + Intergenic
985733436 5:1564142-1564164 GGGAGGCCAGACACTGTGCCAGG - Intergenic
986338755 5:6773288-6773310 GAAAGGTCAGACACTGGGCCAGG - Intergenic
990033629 5:51292305-51292327 GCAAAACCTGACAGGGGGCCAGG + Intergenic
991437875 5:66615003-66615025 GCAAGGCCTTACAAGGGTCCTGG - Intronic
991778138 5:70105769-70105791 TCAAGACCAGACTAGGGGCCAGG + Intergenic
991857428 5:70981235-70981257 TCAAGACCAGACTAGGGGCCAGG + Intronic
991870586 5:71106113-71106135 TCAAGACCAGACTAGGGGCCAGG + Intergenic
998586983 5:143437842-143437864 GCAAGGGCAGGAACAGGGCCAGG - Intergenic
998639967 5:143998217-143998239 GCAAGTCCAGCCACAGGGACTGG + Intergenic
1001478001 5:172064639-172064661 GCAAAGGCAGAGAGGGGGCCTGG + Intronic
1001652006 5:173322680-173322702 GCAAAGCCAGACTTGGGACCTGG - Intronic
1002121268 5:177006444-177006466 GCAAGGCCAGCCCCGGCGTCCGG + Intronic
1002559360 5:180071366-180071388 CCAGGGCCAGAGCCGGGGCCGGG + Intronic
1002660181 5:180786413-180786435 CCACGGCCATACACGGTGCCTGG - Intergenic
1003174924 6:3747239-3747261 GCAAGGCCAGACATGGGGTGTGG - Intronic
1004924351 6:20403372-20403394 TCAAGGGCAGGCCCGGGGCCCGG - Intronic
1005912882 6:30326563-30326585 GCCTGGCCAGAGCCGGGGCCTGG + Intronic
1005993623 6:30918850-30918872 ACAAGGCCAGAGACGCTGCCTGG + Exonic
1007718020 6:43868552-43868574 GAAAGCTCAGACTCGGGGCCTGG - Intergenic
1008556792 6:52680092-52680114 CCAGGGCGAGACACAGGGCCAGG - Intronic
1011216518 6:85011765-85011787 GCATGGCCAGACCCTGGGCTAGG + Intergenic
1016956535 6:149632450-149632472 GCAAAGACAGACACGGAGCTTGG + Intronic
1017725620 6:157274522-157274544 GCGCGGCCAGACGCGGGACCTGG + Intergenic
1018660985 6:166087362-166087384 GCAGAGCCAGACACAGGGCCAGG + Intergenic
1018690848 6:166342849-166342871 GCAAGGCCCCTCGCGGGGCCCGG - Intergenic
1018859586 6:167701151-167701173 GCAAGGCCAGACGGGGAGCACGG + Intergenic
1019312405 7:369239-369261 GCAAGAGCAGACACGGGCCTCGG + Intergenic
1019557827 7:1641372-1641394 GGAAGGCCACACATGGGGCAGGG - Intergenic
1023122666 7:36925385-36925407 CCAAGGCCAGACACGGCACAGGG - Intronic
1023885286 7:44349657-44349679 GCAGAGCCAGGCATGGGGCCAGG - Intergenic
1024597987 7:50955982-50956004 GCAAGGTCAGACCTGGTGCCTGG - Intergenic
1027047101 7:74998306-74998328 GCAAAGACAGAAATGGGGCCGGG + Intronic
1028153968 7:87408114-87408136 GAAAGGCCAGACACTAGCCCTGG - Exonic
1028985235 7:97004114-97004136 GGAGGGCCAGACTGGGGGCCAGG - Intergenic
1030073018 7:105713713-105713735 GCCATGTCAGACATGGGGCCTGG + Intronic
1031933103 7:127706551-127706573 GAAAGGCAAGATACTGGGCCAGG - Intronic
1034458736 7:151186536-151186558 GCAAGGCCAGACAGTGCCCCTGG - Exonic
1035605282 8:926391-926413 GCAGGGCCTGCCACAGGGCCAGG - Intergenic
1035732559 8:1863162-1863184 GTCAGGGCAGACACAGGGCCAGG - Intronic
1035745992 8:1962413-1962435 GCAAGGCCAGGCTTGGTGCCAGG - Intergenic
1035814075 8:2519959-2519981 GCCAGGCCAGTCACTGAGCCGGG + Intergenic
1036424723 8:8633765-8633787 CCAAGGCCACACACAAGGCCTGG + Intergenic
1036607188 8:10317972-10317994 ACAAGGTCTGACAAGGGGCCTGG - Intronic
1037691178 8:21182959-21182981 GGAAGTCCAGAAAGGGGGCCAGG - Intergenic
1039605934 8:38880732-38880754 GCAAGCCCAGGAAGGGGGCCTGG - Intergenic
1039855437 8:41408190-41408212 GATAGGCCAGACACCGTGCCAGG + Intergenic
1040111320 8:43568310-43568332 GCAAGGCCAAAGAGGAGGCCTGG - Intergenic
1040111860 8:43570266-43570288 GCAAGGCCAAAGAGGAGGCCAGG - Intergenic
1040112298 8:43571917-43571939 GCAAGGCCAAAGAGGAGGCCGGG - Intergenic
1048867708 8:138772982-138773004 GCTAGGCCACACGCGGCGCCGGG - Intronic
1048881292 8:138874783-138874805 GCAAGAGCAGATACGGGGCAGGG + Intronic
1049508911 8:143018222-143018244 GCGAGGCCGGACAGGGGACCAGG - Intronic
1049601404 8:143509476-143509498 GCACTGCCAGCCATGGGGCCGGG + Intronic
1052337874 9:27338162-27338184 GCAAGGCCACAGACAGGGGCGGG - Intronic
1053453297 9:38211274-38211296 CCAAGGCCAGGCACTGGGCCTGG + Intergenic
1054883778 9:70173777-70173799 GCAAGGAGAGACACCAGGCCAGG + Intronic
1056969950 9:91193485-91193507 GCCAGGCCCGGCACGGGGCTCGG + Intergenic
1057173235 9:92976308-92976330 GGGATGCCAGACACTGGGCCTGG + Exonic
1057739159 9:97697033-97697055 GCAAGCCGAGTCCCGGGGCCCGG - Intronic
1058246513 9:102632350-102632372 GGATGGCCAGACAGGGGACCTGG + Intergenic
1058314948 9:103554033-103554055 GCATGGCCAGACTGGGGTCCTGG - Intergenic
1060546119 9:124460511-124460533 GAAAAGACAGACACAGGGCCAGG - Intronic
1060795480 9:126509924-126509946 GCAGGACCCAACACGGGGCCTGG + Intergenic
1061884292 9:133583851-133583873 GCAACGCCCGAGACGGCGCCAGG + Intronic
1061923321 9:133794112-133794134 GCAAGACCACACTCAGGGCCCGG + Intronic
1062520039 9:136953983-136954005 CCAGGGCCACACACGGGCCCAGG - Intronic
1062534523 9:137015602-137015624 ACAAGGCCAGACCCAGGGTCAGG + Intronic
1186507020 X:10101567-10101589 GCCAGGGCAGTCCCGGGGCCAGG + Intronic
1188496575 X:30788887-30788909 GCAAGGCAAGGCACGAGGCATGG - Intergenic
1188496855 X:30790935-30790957 GCAAGGCAAGGCACAGGGCAAGG - Intergenic
1188497304 X:30793957-30793979 GCAAGGCAAGACAAGGTGCAAGG - Intergenic
1188497535 X:30795599-30795621 GCAAGGCAAGACACGGCACAAGG - Intergenic
1188498413 X:30801679-30801701 GCAAGGCAAGGCACAGGGCAAGG - Intergenic
1188498867 X:30804856-30804878 GCAAGGCAAGGCACAGGGCAAGG - Intergenic
1188498908 X:30805125-30805147 GCAAGGCAAGACACAAGGCATGG - Intergenic
1188499072 X:30806224-30806246 GTAAGGCAAGACACAGGGCAAGG - Intergenic
1188499077 X:30806246-30806268 GCAAGGCAAGACACCAGGCAAGG - Intergenic
1188499125 X:30806584-30806606 GCAGGGCAAGACACGAGGCGAGG - Intergenic
1189717405 X:43881055-43881077 GCAACACCAGGCACAGGGCCTGG + Intronic
1190055007 X:47176166-47176188 GCCAGGCCACACCCAGGGCCAGG - Intronic
1191256628 X:58282318-58282340 GCAAGGCCAAAGAGGAGGCCAGG - Intergenic
1193551333 X:82896460-82896482 TCAAGGCCGGGCACGGGGGCTGG - Intergenic
1196928396 X:120656777-120656799 GAGAGGGCAGACACAGGGCCGGG - Intergenic
1199721884 X:150548023-150548045 GGAAGGGCAGACACGGGTGCTGG - Intergenic
1200076599 X:153554334-153554356 GCAAGGCCACACTTGGGGACAGG + Intronic
1201432546 Y:13919599-13919621 GCATGGCCAGACTCGGTGTCAGG + Intergenic