ID: 946362865

View in Genome Browser
Species Human (GRCh38)
Location 2:219229485-219229507
Sequence CAAGGCCAGACACGGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946362846_946362865 27 Left 946362846 2:219229435-219229457 CCTCCGTTACCCGCCGCGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362851_946362865 17 Left 946362851 2:219229445-219229467 CCGCCGCGAGCTCACTTAGGGCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362852_946362865 14 Left 946362852 2:219229448-219229470 CCGCGAGCTCACTTAGGGCTCCG 0: 1
1: 0
2: 1
3: 2
4: 53
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362847_946362865 24 Left 946362847 2:219229438-219229460 CCGTTACCCGCCGCGAGCTCACT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362857_946362865 -6 Left 946362857 2:219229468-219229490 CCGCAGGCACCCCTGGGCAAGGC 0: 1
1: 1
2: 2
3: 38
4: 299
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197
946362850_946362865 18 Left 946362850 2:219229444-219229466 CCCGCCGCGAGCTCACTTAGGGC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 946362865 2:219229485-219229507 CAAGGCCAGACACGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946362865 Original CRISPR CAAGGCCAGACACGGGGCCT GGG Intronic