ID: 946363508

View in Genome Browser
Species Human (GRCh38)
Location 2:219234052-219234074
Sequence CTCTCAATGCAGATGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946363508_946363511 7 Left 946363508 2:219234052-219234074 CCCAGCTACATCTGCATTGAGAG 0: 1
1: 1
2: 1
3: 10
4: 121
Right 946363511 2:219234082-219234104 CGCTAGCTTCTCCTCAGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946363508 Original CRISPR CTCTCAATGCAGATGTAGCT GGG (reversed) Intronic
903126570 1:21252316-21252338 GTCTCCATGGAGATGGAGCTAGG - Intronic
906193034 1:43910931-43910953 CTCTCAAGGCAGATGGACCTGGG - Intronic
912585805 1:110764053-110764075 CTCTAAATGCTTATGTAGTTTGG - Intergenic
917056552 1:170988339-170988361 CTCTCAATGCTGCTGCAGATGGG + Intronic
917074894 1:171194122-171194144 CTTTCAAGGCAAATGAAGCTAGG - Intronic
919360173 1:196582647-196582669 CTGTCAATGCTGCTGTATCTTGG - Intronic
923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG + Intergenic
1063328145 10:5126176-5126198 CCATCAATGCAGACATAGCTAGG + Intronic
1066438507 10:35415496-35415518 CTCTCAGAGGAGATGGAGCTGGG + Intronic
1067148488 10:43710755-43710777 CACAGAATGCAGATGTGGCTTGG + Intergenic
1073578901 10:104646055-104646077 ATCTCAGTTGAGATGTAGCTGGG + Intronic
1073613484 10:104968464-104968486 CTCTCAATGCAGATGTCTTTAGG - Intronic
1075673225 10:124278444-124278466 CCCTAAATCCAGGTGTAGCTTGG + Intergenic
1075680284 10:124326336-124326358 CTCTCCATACAGGTGGAGCTAGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1079114947 11:17634933-17634955 CTCTCACCACAGCTGTAGCTGGG - Exonic
1081544846 11:44064389-44064411 CTCTCAATACAGGTATGGCTGGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084659353 11:70537942-70537964 CTCTCAATGTAAATCCAGCTAGG - Intronic
1084927998 11:72529421-72529443 CTTACAATGCAGAAGTAGATTGG + Intergenic
1086433154 11:86755557-86755579 CTCTCACTACATATGTAGTTAGG + Intergenic
1089007560 11:115105275-115105297 CCCTCAAAGCAGGTGCAGCTGGG - Intergenic
1092977817 12:13762745-13762767 CTCTCACTCCATATGGAGCTGGG - Intronic
1093062551 12:14622932-14622954 TTCTCAATGAAGAGGTAACTTGG - Intronic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG + Intronic
1099822034 12:87724313-87724335 ATCTCATAGCATATGTAGCTTGG + Intergenic
1101812532 12:108120216-108120238 CCCTGAATGTAGATGTAGATGGG - Intergenic
1105926493 13:25013485-25013507 AGCTCATTTCAGATGTAGCTGGG + Intergenic
1115344079 14:32323509-32323531 CTCCCATTTCAGATGTAGCCAGG - Intergenic
1117118863 14:52547577-52547599 CTCTCTAGGCAGTTGTTGCTAGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117654675 14:57942785-57942807 CTCACAATGAAAATGTAGGTAGG + Intronic
1117790787 14:59339640-59339662 CTCACAATGCAGATGGTTCTGGG + Intronic
1120469554 14:84904767-84904789 CTCCCAAGGCAGATGTAGGCTGG + Intergenic
1121514796 14:94542497-94542519 CTCTCAATGCAGAGGCCACTGGG - Intergenic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1123480621 15:20628227-20628249 CTCTGTATGCAGATTTAGCAAGG + Intergenic
1123637390 15:22372140-22372162 CTCTGTATGCAGATTTAGCAAGG - Intergenic
1127475433 15:59328096-59328118 CTCTCAAAGGAGATGGGGCTGGG + Intronic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1129273182 15:74430028-74430050 TTCTCAGTGTAGATGTAGATGGG - Intronic
1134185217 16:12079710-12079732 CTCTCTATCCAGAGGTAGATGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135139967 16:19912837-19912859 ATATCAATGAAGATGTAGCCTGG + Intergenic
1137569112 16:49553126-49553148 CTCTGAAGGCAGAAGGAGCTGGG + Intronic
1137614757 16:49839528-49839550 CTCTCAATGCACAGGTAACTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141767923 16:86070892-86070914 CTAAGAATGCAGCTGTAGCTAGG - Intergenic
1141795694 16:86272205-86272227 CTCTCTGTGAAGATCTAGCTTGG + Intergenic
1141804153 16:86331528-86331550 CTTGAAATGCAGATGTACCTGGG - Intergenic
1146687434 17:34850777-34850799 CTCTGGATGAAGATGTGGCTGGG - Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150434153 17:65141095-65141117 GTCTCAATGCAGCTGTGGGTCGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151032680 17:70759246-70759268 CTAAAAATGTAGATGTAGCTTGG - Intergenic
1151167951 17:72220563-72220585 CTCTCACTGCTCCTGTAGCTTGG + Intergenic
1153755521 18:8279311-8279333 CTCTCAAGCCTGATGTAGCAGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158128373 18:54126549-54126571 CTCTGAGTCCTGATGTAGCTAGG - Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1163693731 19:18751733-18751755 CACTCAATGCTGATGGAGGTGGG - Intronic
1165382454 19:35490672-35490694 CTCTTCATGCAGATGGGGCTGGG + Intronic
1166913807 19:46180107-46180129 CTCTCAATCAAGATGGAGTTAGG - Intergenic
925089842 2:1145339-1145361 CTCTCTTTGCATATGTAGCCTGG - Intronic
927432288 2:23036928-23036950 CTCTCAAAACAGATGTACCCTGG - Intergenic
929712967 2:44282995-44283017 ATCTGAATTCAGATGTAACTGGG + Intronic
931259530 2:60605153-60605175 CTGTCAAGGCAGATGTGTCTTGG - Intergenic
931882348 2:66580944-66580966 CTCTCAATGCTAATGTAGACAGG + Intergenic
932319983 2:70814944-70814966 CTCTCACTGCTGCTTTAGCTGGG - Intronic
933311430 2:80666094-80666116 CCCTCAATGAAGATGAAGCTGGG - Intergenic
935043276 2:99455083-99455105 TTCTCAATAGAGATCTAGCTAGG - Intronic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
948567805 2:238897611-238897633 CTCGCAGTGCAGATGTGGCCTGG + Intronic
1169344942 20:4822602-4822624 CTCGAAATGCAGAAGTAGCCGGG + Intronic
1171843348 20:30242246-30242268 CTGTTTATGGAGATGTAGCTAGG - Intergenic
1172649051 20:36490307-36490329 CTCCCAAGGCAGAAGCAGCTGGG - Intronic
1177250940 21:18590150-18590172 CTCTCAATGAAAATGTACCAGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
950609745 3:14118460-14118482 TTCTCACTGGAGATGTCGCTCGG - Intronic
950762363 3:15243357-15243379 CTCCAAATGAAGATGCAGCTAGG + Intronic
952321084 3:32278241-32278263 ATCTGACTGCAGATGAAGCTGGG + Intronic
954910809 3:54105986-54106008 CCCTCAAGGCATATGTACCTAGG - Intergenic
959783622 3:110266701-110266723 CTGTCAATGAAGATGTAGCTTGG - Intergenic
960335900 3:116417240-116417262 ATTTCAAAGCAGAGGTAGCTGGG + Intronic
965474386 3:169136998-169137020 CTCTCAGTACAGATTTTGCTGGG - Intronic
966780611 3:183581014-183581036 CCCTCAATGCAGAGGAGGCTGGG - Intergenic
971391612 4:26191423-26191445 CTCCCAATGCAGATGTTACCTGG - Intronic
972260871 4:37407323-37407345 CTCACAGTGTAGATTTAGCTGGG - Intronic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
972775599 4:42237034-42237056 CTCTAAGTGCTGATGTAGCCAGG - Intergenic
973544325 4:51965706-51965728 CACTCAATGCAGATGTAGCTGGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974134140 4:57792993-57793015 CTCACACTGCAGGTCTAGCTTGG - Intergenic
979664218 4:123293206-123293228 CTATCACTGCAGACGTGGCTGGG - Intronic
979665581 4:123307299-123307321 TTCAAAATGCAGATGGAGCTGGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983504388 4:168536800-168536822 TTTTCAATGCTGATGTAGTTAGG - Intronic
987744459 5:21951885-21951907 GTCTGAATGAAGATGTACCTAGG - Intronic
991764669 5:69962009-69962031 GTCTGAATGAAGATGTACCTAGG - Intergenic
991782655 5:70156144-70156166 GTCTGAATGAAGATGTACCTAGG + Intergenic
991843901 5:70837080-70837102 GTCTGAATGAAGATGTACCTAGG - Intergenic
991875098 5:71156458-71156480 GTCTGAATGAAGATGTACCTAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
998483137 5:142479613-142479635 CTCTCAAGGCAGAAATAGCTGGG - Intergenic
1000217533 5:159176643-159176665 CTCTGTATGCAGATTTAGCAAGG + Exonic
1002836610 6:869963-869985 ATCTCCATGCACATGTTGCTGGG - Intergenic
1008730706 6:54479458-54479480 CAGTCAATGCAGAAGTAGATAGG + Intergenic
1012072158 6:94636669-94636691 CTCTCCATGCTTATGTAGATTGG + Intergenic
1012979003 6:105810568-105810590 CTCTGAATGCAGCTTTAGCTAGG - Intergenic
1016569121 6:145492810-145492832 CTCTCTCTGCTGATGGAGCTGGG + Intergenic
1016980096 6:149846090-149846112 CTCTCACTGCGGATGAAGGTGGG - Intronic
1017710317 6:157161847-157161869 CTGTCACTGTAGATGTAGCTGGG - Intronic
1020150247 7:5676480-5676502 TACTCAATGCAGGTGCAGCTCGG - Intronic
1022513808 7:30962872-30962894 CCCTAAATCCAGATGTAGCGGGG + Intronic
1024123548 7:46268891-46268913 CTATCAATACAAATGTAGCCTGG - Intergenic
1032305825 7:130732459-130732481 CTCTCCTAGCAGAGGTAGCTGGG + Exonic
1033571061 7:142628752-142628774 TTCTCAGTGCATATGTGGCTTGG - Intergenic
1035098066 7:156372670-156372692 CCCTCAATTCAGATGTTGATTGG - Intergenic
1036085196 8:5605981-5606003 CTCTCAGTGCAGAGGTATCAAGG + Intergenic
1037729009 8:21507702-21507724 GACTCAATGCAGATGAGGCTGGG - Intergenic
1042461437 8:69073568-69073590 CTCTCAAATCAGATGGACCTGGG - Intergenic
1042718297 8:71799896-71799918 CTTTCAATGCATATTTAGCATGG + Intergenic
1047166070 8:122439854-122439876 ATTTCAATGCAGATGTTGATGGG + Intergenic
1050755720 9:9000893-9000915 CTCACAATGGAGAGGTAGCAGGG + Intronic
1051756978 9:20412229-20412251 TTCTTAATGCAGATGTTACTTGG - Intronic
1058273762 9:103011099-103011121 CTCTCAATGCATATATACCAAGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1192619562 X:72664124-72664146 TTCTCAATTTAGATGTAGATTGG + Intronic
1199915559 X:152336339-152336361 CTCCTAATGAATATGTAGCTTGG + Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic