ID: 946364098

View in Genome Browser
Species Human (GRCh38)
Location 2:219237825-219237847
Sequence GTCTAACAGCAGTGACTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946364098_946364105 23 Left 946364098 2:219237825-219237847 CCTTGAAGTCACTGCTGTTAGAC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 946364105 2:219237871-219237893 CTCCACCAAGATATCCAGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946364098 Original CRISPR GTCTAACAGCAGTGACTTCA AGG (reversed) Exonic
900953258 1:5871320-5871342 GTCTAAGAGCGGTGCCTCCATGG + Intronic
901829579 1:11883847-11883869 GTCCAACAGTGGTGAGTTCATGG - Intergenic
904400208 1:30251778-30251800 AGCTAACAGAAGTGACTTGAAGG + Intergenic
904842709 1:33383681-33383703 GCCTTACAGCAGTGAGTCCAGGG - Intronic
906185069 1:43856328-43856350 GTATAACAACACTTACTTCACGG - Intronic
908732019 1:67235982-67236004 AGCTGACAGAAGTGACTTCAAGG - Intronic
919268535 1:195306639-195306661 GTCTAAGAACAGTGATGTCAAGG + Intergenic
922271414 1:224038949-224038971 GTCAAACAGAAGAGACTTTAGGG + Intergenic
924830615 1:247590676-247590698 TTCTAACAGCAATGAGTTCAGGG - Intergenic
1062888152 10:1035329-1035351 AGCCAGCAGCAGTGACTTCAGGG - Intergenic
1071722828 10:88164554-88164576 GTCTGGCACCAGTGCCTTCATGG + Intergenic
1073503081 10:103959809-103959831 GTTTAACAGAGGTGTCTTCAAGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076475235 10:130747005-130747027 GACTAAAAGCAGTAACTTCTGGG + Intergenic
1077729436 11:4713873-4713895 CTGTAACAGCAGTCCCTTCATGG + Intronic
1079047830 11:17123651-17123673 GTCTTGCAGCAGAGACTTTATGG - Intronic
1079121352 11:17687661-17687683 GTGTAACAGCTTTGACTTTAGGG + Intergenic
1079714009 11:23721679-23721701 GACTCACAACAGTGCCTTCAAGG - Intergenic
1080700921 11:34643423-34643445 ATCCAACAGCAGTGAGTTTAGGG + Intronic
1085326202 11:75608309-75608331 GACTAACAGGAATGAATTCAGGG - Exonic
1087568523 11:99894597-99894619 ATCTAACTGCTGTGAATTCATGG - Intronic
1091760297 12:3082880-3082902 GCCTCACAGCAGTGATTTCAGGG - Intronic
1093222844 12:16444825-16444847 GTCTAACAGAAGTGAGCTCGTGG + Intronic
1097099152 12:56574167-56574189 TCCTGACAGCAGTAACTTCATGG + Intronic
1101807821 12:108080344-108080366 GTCAAAAAGCTGTGACTCCAAGG + Intergenic
1102262149 12:111449694-111449716 GGCTCACAGCAGTGGCTTCTAGG + Exonic
1103040220 12:117688775-117688797 TTACAGCAGCAGTGACTTCATGG - Intronic
1109018681 13:57055530-57055552 GTCTAATATCAGTGTCTTCAGGG - Intergenic
1113981965 13:114283659-114283681 GTTTAACAGCAGTGACTTCCTGG - Intronic
1114394272 14:22342697-22342719 TACTAACTGCAGTTACTTCAGGG - Intergenic
1115050002 14:29047147-29047169 GTCTAACAACATAGACTTCTTGG - Intergenic
1117114201 14:52492889-52492911 GACAAAAAGCAGAGACTTCAAGG - Intronic
1120817204 14:88873611-88873633 GTGTAACAGTAGTGATTTGAAGG + Intronic
1126317059 15:47381554-47381576 CTGTAACAGGAGTGACTTGAGGG + Intronic
1128438867 15:67683807-67683829 ATCCCACAGCAGTGACTCCATGG - Intronic
1128675644 15:69606613-69606635 AACTAACAGCACTCACTTCAAGG + Intergenic
1129946191 15:79541188-79541210 TTCTAACAGCAGAGCCTTGATGG - Intergenic
1134065369 16:11225026-11225048 GACTAATATCACTGACTTCACGG - Intergenic
1135327605 16:21536973-21536995 GTGTGACAGCAGTGGCCTCATGG - Intergenic
1136042200 16:27588807-27588829 GTATAACAGCAGTTATTTCTGGG - Intronic
1136243735 16:28960977-28960999 TTCTACCAGCAGTCTCTTCAAGG + Intronic
1136337957 16:29622993-29623015 GTGTGACAGCAGTGGCCTCATGG - Intergenic
1139162566 16:64528750-64528772 GTCTAAATGCAGTCACATCAGGG - Intergenic
1139505702 16:67397122-67397144 GTCCATCTGCAGTGACTTGAGGG - Intronic
1142040717 16:87892074-87892096 GTGTGACAGCAGTGGCCTCATGG - Intronic
1146071165 17:29683176-29683198 GTCTCAAAGCATTGACTTCCTGG - Intronic
1146889939 17:36500341-36500363 ATCTAACAGTGGTGACATCATGG - Intronic
1151378001 17:73704684-73704706 GGCTGACAGCAATGACTTCCAGG + Intergenic
1152158809 17:78654052-78654074 TTATAAAAGCAGTGTCTTCAGGG - Intergenic
1157471643 18:47993442-47993464 GTCTCCCAGCAGTCACTTCCTGG - Intergenic
1160779859 19:872906-872928 TTCTTACAGCAGAGGCTTCATGG + Intronic
1161214202 19:3085164-3085186 CACTCACAGCAGTGCCTTCATGG - Intergenic
1161627130 19:5333931-5333953 GTTTAACAGCAGTCATTTGATGG - Intronic
1166659365 19:44636106-44636128 GAGTAACAGCAGAAACTTCAAGG + Intronic
1168001233 19:53447544-53447566 GTCCAACAGCACTGACACCATGG - Intronic
924984418 2:256301-256323 GTCTATCAACAGTGACTGGAAGG - Intronic
925886882 2:8401180-8401202 TTAGGACAGCAGTGACTTCACGG - Intergenic
925976126 2:9143300-9143322 GCCTGGCAGCAGTGACTTCGGGG + Intergenic
927771723 2:25868275-25868297 TTCAAACATCAGTGAGTTCAAGG + Intronic
927805495 2:26143218-26143240 GTTGATCAGCAGTGACTACAGGG - Intergenic
930037573 2:47096762-47096784 GTCTAGGATCATTGACTTCAGGG + Intronic
931135613 2:59396277-59396299 GTCTAACAGAATGGACTTGATGG - Intergenic
932141150 2:69279377-69279399 TTCTAAGAGCAGTGACTATATGG + Intergenic
935483108 2:103617621-103617643 GTCTAACTCCTGTGACTACAAGG + Intergenic
935853380 2:107247778-107247800 GTTTAGCAGGAGTGCCTTCAGGG - Intergenic
939682144 2:145150357-145150379 GTCTTAAAGCAATGACTTTAGGG - Intergenic
940721002 2:157281462-157281484 TGCTACCAACAGTGACTTCAGGG - Intronic
943902789 2:193462765-193462787 TTCTACCAGCAGTTACTTTAAGG - Intergenic
946364098 2:219237825-219237847 GTCTAACAGCAGTGACTTCAAGG - Exonic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
948540288 2:238686409-238686431 GGCAAACAGCAGTGTCCTCAAGG + Intergenic
1175572466 20:60034468-60034490 GGCTATGAGCAGAGACTTCAAGG - Intergenic
1182208492 22:28653124-28653146 GACTAAAAGCAGTGACTTCTGGG + Intronic
952491032 3:33872837-33872859 GTCTCACAGAACTGACGTCAAGG - Intergenic
956292550 3:67676663-67676685 GTCTAACAGGGGTGAAATCATGG - Intergenic
959738079 3:109684196-109684218 GTCAAAACCCAGTGACTTCAAGG + Intergenic
960380760 3:116958428-116958450 GCCAAATAGCAGTCACTTCAAGG + Intronic
970261970 4:14234653-14234675 TACTAACAGCAGTGAATTCCAGG + Intergenic
970959862 4:21859048-21859070 ATCTAAGAGCAGTGATTTCGAGG - Intronic
972465069 4:39347652-39347674 TTCTACCAGCAGTTCCTTCATGG - Intronic
972596924 4:40537647-40537669 GTGTAAGAGCAGTGAGTTTAAGG - Intronic
973856803 4:55019593-55019615 CTCTAACAGTAGGGTCTTCATGG + Intergenic
974703651 4:65483806-65483828 GTTTCACAGCTTTGACTTCAGGG - Intronic
978111990 4:104975391-104975413 GTCTAACAATACTCACTTCAGGG + Intergenic
979486196 4:121273325-121273347 GTCAAAGCTCAGTGACTTCAAGG + Intergenic
981728332 4:147871300-147871322 ATATAACAGCAGTTACTTGAGGG + Intronic
982011173 4:151107559-151107581 AACAAACAGCAGAGACTTCAAGG - Intronic
984050697 4:174861596-174861618 GTCTAAAAGAAGAGACTGCAAGG - Intronic
990024338 5:51167128-51167150 GTCAAGCAACAGTGAGTTCAAGG + Intergenic
1000775013 5:165408746-165408768 GTTTAAGAGCAGTTGCTTCAGGG - Intergenic
1002706406 5:181163510-181163532 GTCCAACAGCAGTGGCTGCTTGG + Intergenic
1002707107 5:181169411-181169433 GTCCAACAGCAGTGGCTGCTTGG + Intergenic
1016061702 6:139637281-139637303 ATCCCACAGCAGTGACTGCATGG - Intergenic
1017087140 6:150724081-150724103 GTCTAGCACCAGTGACTGCAAGG + Intronic
1018140666 6:160831167-160831189 GTCTCACTGCAGTGTCTTCCGGG + Intergenic
1018670844 6:166175871-166175893 GGATAACAGTACTGACTTCACGG - Intergenic
1021117593 7:16761181-16761203 GTATAAAAGCAGTGGCATCACGG + Intronic
1022688537 7:32621219-32621241 GTCTATAGTCAGTGACTTCAAGG + Intergenic
1028142349 7:87288132-87288154 GTCTGGCTACAGTGACTTCATGG + Intergenic
1031109820 7:117594955-117594977 GCATACCAGCAGTGACTACATGG + Exonic
1033453327 7:141481077-141481099 GTCCAGCAGCGGTGACTGCAGGG - Intergenic
1037015236 8:13896791-13896813 GACTAAGAGCAGTGTCATCAAGG + Intergenic
1039205341 8:35146843-35146865 TATTAACAGCAGTGTCTTCAGGG - Intergenic
1039372831 8:37003984-37004006 GGCTATCAGGAGTGGCTTCATGG + Intergenic
1040620527 8:49086817-49086839 TTCTAACAGCAATAACTACATGG - Intergenic
1041346113 8:56899862-56899884 AATTAACAGCACTGACTTCATGG - Intergenic
1042808880 8:72802317-72802339 TTCTAAGAGCAGTGACTATATGG - Intronic
1049589062 8:143447396-143447418 TTCCAAAATCAGTGACTTCATGG + Intronic
1050168329 9:2789595-2789617 GTTTAACAGCAGTTACTGCCTGG - Intronic
1050172188 9:2832577-2832599 GTCATACAGCTGTGACCTCAGGG + Intronic
1056411361 9:86330758-86330780 GTCTAAAATCAGTGACCTAAAGG - Intronic
1061611655 9:131750637-131750659 GACTGACAGCAGTGATTTCATGG - Intergenic
1185521705 X:745134-745156 CTCTAAGAGCAGAGCCTTCACGG + Intergenic
1188245509 X:27832019-27832041 TTCCTAGAGCAGTGACTTCAAGG + Intergenic
1188810850 X:34652855-34652877 GTATAACAATAGTGACTTCCAGG + Intronic
1189250518 X:39597836-39597858 GTTTAACAGCAATGAATCCAAGG - Intergenic
1189719920 X:43905488-43905510 GGCTTACAGCAGTGACTTGAGGG + Intergenic
1195243859 X:102979082-102979104 GTCCCACAGCTGGGACTTCATGG - Intergenic
1196861474 X:120032955-120032977 TTCTAACAACAGTCTCTTCAGGG - Intergenic
1199762567 X:150916355-150916377 GTCTACCAGCCTTGATTTCAAGG - Intergenic