ID: 946364119

View in Genome Browser
Species Human (GRCh38)
Location 2:219237947-219237969
Sequence TCCTATCCACAGGTGTTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946364119_946364124 -5 Left 946364119 2:219237947-219237969 CCCTGGAACACCTGTGGATAGGA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 946364124 2:219237965-219237987 TAGGAGATAGGATAGGAGCAAGG 0: 1
1: 0
2: 1
3: 24
4: 324
946364119_946364125 26 Left 946364119 2:219237947-219237969 CCCTGGAACACCTGTGGATAGGA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 946364125 2:219237996-219238018 CTAGCTCTTAGCCACTGCATAGG 0: 1
1: 0
2: 2
3: 14
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946364119 Original CRISPR TCCTATCCACAGGTGTTCCA GGG (reversed) Exonic
903245356 1:22011151-22011173 TCCTGACCTCAGGTGATCCATGG - Intronic
904338266 1:29811933-29811955 GCCTTTCCACAGGTGTGTCATGG + Intergenic
907618775 1:55953760-55953782 TCCTAATCACAGGTAATCCAGGG + Intergenic
912745765 1:112244062-112244084 TCCTTTGCACAGTTGCTCCAGGG + Intergenic
915488804 1:156240233-156240255 TCCTATCCACAGGGAACCCAGGG - Intronic
915567369 1:156723073-156723095 TGCTAACCACAGGTGTCCCAGGG - Exonic
917598280 1:176551764-176551786 TTCTATCCACAGAGGTTCCTGGG - Intronic
919427660 1:197452693-197452715 TCCAAGCCACAGGTCTTCCTAGG + Intronic
921707036 1:218334265-218334287 TTCTATCCAAAGGGTTTCCAAGG - Exonic
1063169274 10:3492237-3492259 GCCAATTCACAGATGTTCCATGG + Intergenic
1064774232 10:18757556-18757578 TCCTGACCTCAGGTGATCCATGG + Intergenic
1067185131 10:44020944-44020966 TCCTCTCCACAGCTGTTCCCAGG + Intergenic
1067696699 10:48541112-48541134 TCCTATGCACGTGTGGTCCATGG - Intronic
1067990106 10:51202221-51202243 TCCTCTACACAGATGATCCATGG + Intronic
1068739444 10:60451922-60451944 ACCTTTCCACAGGTCCTCCAGGG - Intronic
1070788607 10:79176618-79176640 TCCTATCCCCAGGTGCTTCTGGG - Intronic
1070797695 10:79226415-79226437 CCCTATCCACAGGTGCACCCAGG + Intronic
1071510585 10:86260081-86260103 TACTCCACACAGGTGTTCCATGG - Intronic
1073452900 10:103620019-103620041 TCCAACTCACAGGTGTCCCAAGG + Intronic
1073919013 10:108437730-108437752 TCCTAACCTCAGGTGATCAAAGG + Intergenic
1074857901 10:117486862-117486884 TCCTAGCCACAGGTGCTCCTTGG + Intergenic
1076239662 10:128894885-128894907 TCCCATCCCCATCTGTTCCAAGG + Intergenic
1078876659 11:15405910-15405932 TCCTTTCCAGAGGTGCTCCGTGG + Intergenic
1082832912 11:57632744-57632766 TCCTAACCTCAGGTGATCCTCGG + Intergenic
1083590249 11:63889454-63889476 TCCTACCAACAGTTGTCCCATGG - Intronic
1084794276 11:71494382-71494404 TCCTATGCACCTGTGCTCCATGG - Intronic
1085032380 11:73280628-73280650 TCCTGCCCACAGGTGTTCAGTGG - Intronic
1086466951 11:87064033-87064055 TGCTATCCAACGGTTTTCCAAGG + Intronic
1087577080 11:100002223-100002245 TCATTTCCCCAGTTGTTCCATGG + Intronic
1090399357 11:126439102-126439124 TCCTGACCTCAGGTGATCCAGGG - Intronic
1091635687 12:2194768-2194790 TCCTCCCCTCAGGTGCTCCACGG - Intronic
1093063368 12:14630675-14630697 TGGTATCCACAGGGGTTCCTGGG + Intronic
1093098147 12:14995347-14995369 TCCATTCCACACGTGTTCCCTGG - Intergenic
1097384488 12:58933508-58933530 CCCTATCCACAGGTGTCCCATGG + Intergenic
1100206292 12:92353995-92354017 TCCTAGCCACAGTTGATACAGGG - Intergenic
1103248853 12:119482606-119482628 TCTTATCCTCAGCTGTTCAAAGG + Intronic
1103675504 12:122652675-122652697 TCCTGACCTCAGGTGTTCCAAGG + Intergenic
1104083422 12:125453671-125453693 TCCTTTACACTGGTGTTTCATGG - Intronic
1104138116 12:125959747-125959769 TGCTGGCCACAGGTGTTCCTCGG - Intergenic
1108106938 13:47020770-47020792 TCCTCTCCTCTGGTCTTCCAAGG - Intergenic
1109056618 13:57557900-57557922 TTCTTTCCCCCGGTGTTCCAGGG + Intergenic
1109759213 13:66804987-66805009 TACTAACCACAGGAGATCCATGG + Intronic
1111636295 13:90908181-90908203 CCTTATACACATGTGTTCCATGG + Intergenic
1115241444 14:31254255-31254277 TCCTGACCTCAGGTGATCCACGG + Intergenic
1115943324 14:38632587-38632609 TCCTGACCTCAGGTGATCCACGG + Intergenic
1120845717 14:89123075-89123097 TCCTCTCCACAAGTTTGCCATGG + Intergenic
1121874511 14:97439256-97439278 TCCTGACCTCAGGTGATCCAAGG + Intergenic
1121996542 14:98607489-98607511 TCCCTTCCACAGGTGATCCATGG + Intergenic
1202946302 14_KI270726v1_random:29955-29977 TCAGTTCCCCAGGTGTTCCATGG + Intergenic
1129914211 15:79254146-79254168 TCCTCTCCATAGGTGTATCATGG + Intergenic
1131451946 15:92548819-92548841 TCCCTTACAGAGGTGTTCCATGG + Intergenic
1136549109 16:30972876-30972898 TCGTAACCACAGGTTTTCCTAGG - Intronic
1136566990 16:31076550-31076572 TCCTTGCCACAGGTGGTACAGGG - Exonic
1140713366 16:77698776-77698798 TTCTATCAAAAAGTGTTCCATGG + Intergenic
1143095969 17:4478560-4478582 CTCTGTCCACAGGTGTTCCTGGG + Exonic
1143182195 17:4990255-4990277 TCCTCACCTCAGGTGTTCCAGGG - Exonic
1143576544 17:7797164-7797186 TCCTCTTCCCAGGTGTTCCAGGG + Exonic
1145062242 17:19740467-19740489 TCTTCTCCACAGGAGTTCTACGG - Exonic
1148121545 17:45215360-45215382 TCCCAACCTCAGGTGATCCACGG + Intergenic
1148437709 17:47695770-47695792 TCCCATCCACAGGTCTCCCTGGG + Exonic
1149525623 17:57353297-57353319 ACCTACCCACAGTTGGTCCAAGG - Intronic
1150288349 17:63966610-63966632 ACCTGTCCACAGGTGTGCAATGG - Intronic
1150464072 17:65376985-65377007 TCCTCTCTACAGGTGTATCAAGG - Intergenic
1151446579 17:74169822-74169844 TCCTGACCTCAGGTGTTCCAAGG - Intergenic
1154291223 18:13109146-13109168 TCCAATCCACCGGTGATCAACGG - Intronic
1155417995 18:25621658-25621680 CCCTTTCCATTGGTGTTCCAAGG + Intergenic
1160581800 18:79887424-79887446 TCCTCTCAGCAGGTGTTTCAAGG + Intronic
1164836539 19:31358474-31358496 TCCTATCCCCAGGTTCTCCTTGG - Intergenic
1165179740 19:33957349-33957371 TGGTAGCCTCAGGTGTTCCATGG + Intergenic
1166170295 19:41023595-41023617 TCCTGACCTCAGGTGATCCAAGG - Intergenic
1166611977 19:44206577-44206599 TCCTGACCTCAGGTGATCCAAGG + Intergenic
926796284 2:16621731-16621753 CCTTATCCAGAGGTGTTCCCTGG + Intronic
928694628 2:33836804-33836826 TCCGTGCCACAGGTGGTCCAGGG - Intergenic
929942605 2:46346539-46346561 CCCTATCCCCAGATATTCCAGGG + Intronic
930852467 2:55975426-55975448 TCCTTTCCACACATGTTCCATGG + Intergenic
931580689 2:63769302-63769324 TCCTACCCACAGAAGTTTCATGG - Intronic
932334332 2:70921328-70921350 TCATATCCCCAGGAGTTCCCAGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936453824 2:112655193-112655215 TCCCAACCTCAGGTGATCCACGG + Intronic
937236590 2:120435047-120435069 GCCCATCCCCAGGTGTTCCCAGG + Intergenic
937834807 2:126461217-126461239 TCCTATCCTCAGGTGTATCTGGG - Intergenic
944154605 2:196596194-196596216 TCCTTTCTACAGATGTGCCAAGG + Intergenic
946364119 2:219237947-219237969 TCCTATCCACAGGTGTTCCAGGG - Exonic
948024809 2:234768567-234768589 TCCTTTCCCCTGATGTTCCAGGG - Intergenic
948348202 2:237316946-237316968 TCCTGACCTCAGGTGATCCACGG + Intergenic
1170735053 20:19007176-19007198 TCCTAGCCCCAGGAGTTTCAGGG - Intergenic
1171522336 20:25785486-25785508 TCCCATTCCCAGGTGGTCCAGGG - Intronic
1171530084 20:25847431-25847453 TCCCATTCCCAGGTGGTCCAGGG - Intronic
1171554491 20:26070397-26070419 TCCCATTCCCAGGTGGTCCAGGG + Intergenic
1173211880 20:41040541-41040563 TCCAAACCACAAGTGCTCCAGGG + Intronic
1175703077 20:61154631-61154653 TCTCAGCCACAGGTGTGCCAAGG - Intergenic
1176107742 20:63397563-63397585 TTCTTTCCACAGCTGTCCCATGG + Intergenic
1176656141 21:9590484-9590506 TCCCATTCCCAGGTGGTCCAGGG - Intergenic
1179064879 21:38015472-38015494 TCGTCACCACAGGTGTTCAAGGG - Intronic
1181282129 22:21727771-21727793 TCCTCTACACAGGTGCCCCAGGG - Intronic
1182136220 22:27906119-27906141 TCCTATGCAGAGGCATTCCATGG - Intronic
1182536849 22:31010266-31010288 TCCTGACCTCAGGTGATCCATGG + Intergenic
1183900626 22:41003233-41003255 CCCCAGCCACAGGTTTTCCAGGG + Intergenic
1184235836 22:43182577-43182599 TCAGGTCCTCAGGTGTTCCAGGG + Intronic
950252493 3:11478079-11478101 CCCTACCCACAGGTATTACATGG - Intronic
952830212 3:37558516-37558538 TCCTATGTACAGGTGTGCCTGGG + Intronic
953487583 3:43316851-43316873 TCCTTTCCACTGCTGTTCCCTGG + Intronic
956066414 3:65401543-65401565 AACAATCCCCAGGTGTTCCATGG + Intronic
956290934 3:67658869-67658891 TCCTAGTCACAGGTGTTCAAGGG - Intergenic
957431926 3:80121461-80121483 TCCTTTCCATAGTTGTTCCTTGG + Intergenic
958927735 3:100177583-100177605 TGCTATACAAAGGTGTTTCAAGG - Intronic
962043725 3:131733976-131733998 TCCTCACGATAGGTGTTCCAAGG + Intronic
962936282 3:140083786-140083808 TCCTGCCCACAGATGTCCCATGG - Intronic
968842784 4:3020230-3020252 TCCTGACCTCAGGTGATCCACGG + Intronic
969018712 4:4123918-4123940 TCCTGACCTCAGGTGATCCACGG - Intergenic
970875126 4:20860362-20860384 TCTTAACCTCAGGTGATCCATGG + Intronic
971155314 4:24075411-24075433 TCATATCCAGAAATGTTCCATGG + Intergenic
973991754 4:56415841-56415863 TCCTAACCTCAGGTGATCCTCGG - Intronic
976953185 4:90859519-90859541 TCCTATAAACAAGTATTCCAAGG - Intronic
980279246 4:130697886-130697908 TTCTATCCCCAGATGCTCCAAGG + Intergenic
981288323 4:143045752-143045774 TCCTGTCCCCAGTGGTTCCATGG + Intergenic
984287021 4:177743752-177743774 TCCTATCAATATGTTTTCCAAGG + Intronic
985020967 4:185689817-185689839 TCCTATCCACAAGTGATCACTGG - Intronic
985082754 4:186283299-186283321 TCCCATCCATCTGTGTTCCATGG + Intronic
985360347 4:189169712-189169734 TCCTGACCTCAGGTGTTCCTCGG + Intergenic
988559449 5:32267147-32267169 TCCTTACCTCAGGTGATCCACGG - Intronic
989436500 5:41419277-41419299 TCCTATCATCAGGAATTCCAAGG + Intronic
992162676 5:74017782-74017804 TCTCAGGCACAGGTGTTCCAGGG - Intergenic
994332002 5:98517415-98517437 TGCTATCCACAGGTTTTCTGTGG + Intergenic
996870374 5:128185157-128185179 TCCTATCCACACGTGCTTAACGG - Intronic
997571935 5:134936249-134936271 TCCTCTCCACAGATGTCCAAGGG - Intronic
1002306586 5:178287173-178287195 CCCTAACCCCAGGTGTGCCATGG + Intronic
1005028375 6:21485922-21485944 TCCTATTCACAAATGTTACAAGG - Intergenic
1005253456 6:23973196-23973218 TGCTAGCCACAGGTGCCCCAGGG + Intergenic
1006845354 6:37057633-37057655 TCCTCTTCACATGTGCTCCACGG - Intergenic
1009443946 6:63716949-63716971 ACATATTTACAGGTGTTCCAAGG + Intronic
1013953053 6:115808186-115808208 TCCTGGACACAGCTGTTCCAAGG + Intergenic
1016299267 6:142611767-142611789 TCCTGACCTCAGGTGATCCATGG + Intergenic
1017525012 6:155234835-155234857 TCCTGGCCCCAGGTGTTCTAGGG - Intronic
1019166865 6:170102958-170102980 TCCTCTCCACATGGGTTCCGCGG - Intergenic
1019648898 7:2145733-2145755 TCCCACCCAGAGGAGTTCCAAGG - Intronic
1020954700 7:14726364-14726386 TCCTGACCTCAGGTGATCCATGG + Intronic
1022437931 7:30408051-30408073 TCCTGACCTCAGGTGATCCACGG + Intronic
1023620070 7:42062072-42062094 TCCTGTGCACAGGTTTTCCAAGG - Intronic
1023958858 7:44910363-44910385 TCCTGGCCTCAGGTGATCCATGG - Intergenic
1025282825 7:57640663-57640685 TCCCATTCCCAGGTGGTCCAGGG - Intergenic
1026177134 7:68007807-68007829 TCCTGACCTCAGGTGATCCATGG + Intergenic
1030502005 7:110371062-110371084 TCCTATTCTCATGTCTTCCATGG - Intergenic
1031019493 7:116611805-116611827 TCCTGACCTCAGGTGATCCACGG - Intergenic
1032401160 7:131625364-131625386 TCCTGTGCACAGGCGCTCCATGG - Intergenic
1033414769 7:141152119-141152141 TTTTATCCACATGTGCTCCAGGG - Intronic
1035426953 7:158784368-158784390 TCCTACCCCCAGCTGGTCCAGGG + Intronic
1035991215 8:4492314-4492336 TCCTCGCCTCAGGTGATCCAAGG + Intronic
1036087378 8:5626978-5627000 TCATATTGACAGGTGTTCCTGGG - Intergenic
1039870268 8:41540036-41540058 ACCCATCCTCAGGTGTCCCAGGG + Intronic
1047278504 8:123424598-123424620 TCCCAACCTCAGGTGATCCAAGG + Intronic
1050637830 9:7630907-7630929 TCCCATTCACAAGTGTTGCAGGG + Intergenic
1053080864 9:35175389-35175411 TCCTATACACTGGAGTTCCTTGG - Intronic
1056035298 9:82598475-82598497 TTCTGTCCACAGCTGTTCCAAGG + Intergenic
1059395287 9:114030582-114030604 CCCTACCCACAAGTCTTCCAAGG - Intronic
1061090412 9:128422856-128422878 TCCCGTCCCCAGGTGTGCCACGG + Exonic
1062265896 9:135686313-135686335 TCCCAGCCACCGCTGTTCCAGGG - Intergenic
1203633857 Un_KI270750v1:93944-93966 TCCCATTCCCAGGTGGTCCAGGG - Intergenic
1185756606 X:2658611-2658633 TCCTCTCCACATTTGTTCCTGGG - Intergenic
1185854346 X:3520283-3520305 TCCTCCCCACAGGCTTTCCAAGG - Intergenic
1189200866 X:39194683-39194705 TCCTCTGCACAGGAGTCCCATGG - Intergenic
1190785604 X:53645238-53645260 TCCTTTCAACAGGTGTTTCTTGG - Intronic
1197412614 X:126138305-126138327 TCCTCTCCACATCTGTTCCTGGG + Intergenic
1197882368 X:131180443-131180465 TCTCATTCACAGGTTTTCCAAGG - Intergenic
1198570166 X:137946392-137946414 TCCTACCCAAAGGTGTTCTGTGG - Intergenic
1200750931 Y:6943502-6943524 TCCTATCACCAGGTTTTGCAGGG - Intronic
1200809151 Y:7464214-7464236 TCCTCCCCACAGGCTTTCCAAGG + Intergenic
1202265147 Y:23010401-23010423 TCTGATCCACAGGTGTTTGATGG + Intergenic
1202418138 Y:24644143-24644165 TCTGATCCACAGGTGTTTGATGG + Intergenic
1202452648 Y:25025943-25025965 TCTGATCCACAGGTGTTTGATGG - Intergenic