ID: 946366386

View in Genome Browser
Species Human (GRCh38)
Location 2:219251757-219251779
Sequence CACAGCTACCACCCTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946366386_946366392 -10 Left 946366386 2:219251757-219251779 CCTCCCCCAGGGTGGTAGCTGTG 0: 1
1: 0
2: 1
3: 24
4: 254
Right 946366392 2:219251770-219251792 GGTAGCTGTGGCCAGATGCATGG 0: 1
1: 0
2: 1
3: 29
4: 200
946366386_946366393 -6 Left 946366386 2:219251757-219251779 CCTCCCCCAGGGTGGTAGCTGTG 0: 1
1: 0
2: 1
3: 24
4: 254
Right 946366393 2:219251774-219251796 GCTGTGGCCAGATGCATGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946366386 Original CRISPR CACAGCTACCACCCTGGGGG AGG (reversed) Intronic
900103175 1:971427-971449 CACAGCTGCCTCCCTGGGGCGGG - Intronic
901057737 1:6456552-6456574 CACAGCTACCTCCTTGGCTGAGG + Intronic
901228555 1:7629275-7629297 CCCAGATTCCACCCTGGTGGGGG + Intronic
901455373 1:9360117-9360139 CAGAGCTGCCACCCTGGGTGAGG + Intronic
901786823 1:11630180-11630202 CACAATGACCACCCTGGGGTGGG - Intergenic
902424924 1:16312707-16312729 CACATGTACCACTCTGGTGGGGG + Intronic
902476614 1:16691900-16691922 CACAGCTACCTCCTTGGCTGAGG - Intergenic
903229095 1:21911221-21911243 CACAGCTGCTGCCCTTGGGGAGG - Intronic
903454985 1:23481355-23481377 TAGAGCTACAAGCCTGGGGGTGG + Intronic
904905642 1:33895557-33895579 CCCAGCCACCACCCGTGGGGTGG - Intronic
904912691 1:33947260-33947282 CAGGGCTCCCACCCTGGGGGAGG - Intronic
905505476 1:38476091-38476113 CACAGAGACAAACCTGGGGGTGG - Intergenic
910732142 1:90409688-90409710 CAAAGGTACCACTCTGGTGGGGG - Intergenic
911047188 1:93638274-93638296 CCCAGCTCCCTCCCTGGGGTGGG + Intronic
912410379 1:109477074-109477096 CAGAGGTTCCACCATGGGGGTGG - Intronic
915012192 1:152698120-152698142 CACGGGGACCAGCCTGGGGGGGG + Intergenic
915599226 1:156912314-156912336 TACAGCTCCCATCCTGGGGATGG - Exonic
915860357 1:159437700-159437722 GACAGCCACCCCCCTGGGGCTGG - Intergenic
916401992 1:164459243-164459265 TACAGCTACCAGCCTGAGCGAGG + Intergenic
918541312 1:185636206-185636228 CACAGGTTCTACCCTGGAGGGGG + Intergenic
919625602 1:199907272-199907294 CCCACCTACCGCCCTGGGTGAGG + Intergenic
920492944 1:206432162-206432184 CACAGCTAACACCCTGGTCTAGG - Intronic
923731971 1:236560421-236560443 CACTGCTGCCAGCCTGAGGGGGG + Intronic
1062768842 10:84304-84326 CTCTGATCCCACCCTGGGGGCGG - Intergenic
1063141892 10:3263103-3263125 CACAGCTACGAGACTGGAGGTGG - Intergenic
1063232434 10:4078355-4078377 CACAGCTTCTGCCCTGGGGCAGG - Intergenic
1063438548 10:6053961-6053983 CACACCTTCCACCATGGGGCAGG + Intronic
1067809886 10:49418199-49418221 AACGGCTCCCGCCCTGGGGGTGG + Intergenic
1068543891 10:58325920-58325942 CACAGGTACCACCCTGGGAATGG + Intergenic
1069756065 10:70775080-70775102 CTCAGCTCCCACCCTGGAGGGGG - Intronic
1069815005 10:71188234-71188256 CACAGCTACCACTCTGGACTTGG - Intergenic
1072235323 10:93448600-93448622 CACAGCCACCAGCCTGGTTGAGG - Intronic
1073005895 10:100324242-100324264 CAAAGGTACCACCCTGGTGTTGG - Intronic
1075703515 10:124484370-124484392 CACAGCCCCCACCCTGGGAAAGG - Intronic
1076037412 10:127211767-127211789 CAGGGCTCCCATCCTGGGGGTGG - Intronic
1076685189 10:132195521-132195543 CACAGCTTCCAGCCTGGAGGTGG + Intronic
1077138936 11:1015052-1015074 CACAGCAACCACCCAGGGACTGG - Intronic
1077156060 11:1092240-1092262 CACAGTTACAACCCAGTGGGGGG + Intergenic
1077314249 11:1910007-1910029 CACAGCAACCACATTGGGGTGGG - Intergenic
1077637596 11:3854641-3854663 CCCAGCTACCTCTCTGGTGGAGG - Intronic
1077699894 11:4431653-4431675 CACTGCTGCCACACTGGTGGTGG - Intergenic
1081621521 11:44621715-44621737 CACAGCTTCCACCCTCAGGAAGG + Intergenic
1083632824 11:64104521-64104543 CACTGCTACCACCTTTAGGGAGG - Intronic
1083662625 11:64258832-64258854 CTCAGCTTCCTCTCTGGGGGAGG + Intronic
1084023838 11:66435556-66435578 CATAGTTCCCACCCTGGGGAGGG + Exonic
1085346377 11:75770629-75770651 CACAGCTCCCAGCCTGTGGATGG - Intronic
1088504014 11:110511746-110511768 CACCGCTACCACCCTAGGCCAGG + Intergenic
1089620289 11:119718220-119718242 CTCAGCCACAACCCTGGGGAAGG + Intronic
1090587830 11:128233540-128233562 CACAGCTACCTCTCTGGGCTCGG - Intergenic
1090993248 11:131839825-131839847 CACTGCTACCACCCTGGCCTGGG - Intronic
1091178078 11:133579533-133579555 CGCAGCCCCCACCCTGGGGACGG - Intergenic
1091225219 11:133953082-133953104 CACAGCCAGCACCCTGGCTGGGG + Intronic
1091675644 12:2487157-2487179 CACAGCTAGCCCCTTTGGGGTGG - Intronic
1092184688 12:6470322-6470344 CACAGCTAGCACCCCACGGGCGG - Intronic
1092258023 12:6937513-6937535 TACATCTACCACCTTGGGAGGGG - Exonic
1095862464 12:46933292-46933314 CAAATGTACCACCCTGGTGGGGG + Intergenic
1097192405 12:57225846-57225868 CACTCCTTCCACTCTGGGGGCGG + Exonic
1100371663 12:93974412-93974434 CACAGCTACTTCCCTGTGGTTGG - Intergenic
1100483566 12:95003435-95003457 GACAGAGACCAGCCTGGGGGTGG + Intronic
1100610950 12:96192161-96192183 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1101873251 12:108582406-108582428 CACAGCCACCCCCCGGGGGCAGG + Intergenic
1101913668 12:108879807-108879829 TCCTGCTGCCACCCTGGGGGAGG - Intronic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1103295557 12:119883614-119883636 CAAATGTACCACCCTGGTGGAGG - Intergenic
1103532441 12:121611701-121611723 GACTGCTATCACCCTGGGGTTGG - Intergenic
1104472955 12:129045332-129045354 CACACCTCCCCTCCTGGGGGTGG - Intergenic
1105015815 12:132786359-132786381 CACTGCTGCCACCCTGGGCTCGG + Exonic
1105242462 13:18620307-18620329 CACAGCCAAGGCCCTGGGGGAGG - Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1106783879 13:33087836-33087858 CACAGCTTCCTCCATGGGTGAGG + Intergenic
1109001386 13:56810655-56810677 CACAGGAACCAACCTGGGGAAGG + Intergenic
1110468001 13:75825390-75825412 GTCAGCTGCCACCCTGAGGGAGG - Intronic
1110782284 13:79480702-79480724 CACATGTACCACTCTGAGGGGGG + Intergenic
1114522417 14:23347687-23347709 CACTGCTACCAGCCTGTGGGAGG - Exonic
1114920557 14:27322560-27322582 CAAATCTACCACTCTGGTGGTGG - Intergenic
1118448999 14:65880254-65880276 CCCAGTAACCACGCTGGGGGTGG + Intergenic
1118503252 14:66383463-66383485 CACAGCCACCACCAGGGGTGGGG + Intergenic
1119195315 14:72713384-72713406 CCCAGGGAGCACCCTGGGGGTGG - Intronic
1120240334 14:81942606-81942628 CAAAGCTAGCATCCTGGGTGTGG - Intergenic
1120658499 14:87224810-87224832 CAAATGTACCACCCTGGTGGGGG + Intergenic
1121274014 14:92655824-92655846 CACAGCGTCCATCCTGGGGCAGG + Intronic
1122424998 14:101600795-101600817 CACAGATGCCACCACGGGGGTGG - Intergenic
1122693519 14:103542318-103542340 CAGCCCTACCACCCTGGGCGGGG + Intergenic
1122712023 14:103665858-103665880 CACAGGCGCCACCCTGGAGGTGG + Intronic
1123023660 14:105413614-105413636 CTCTGCTGCCACCATGGGGGAGG - Exonic
1123488836 15:20764284-20764306 CACAGCCAAGGCCCTGGGGGAGG + Intergenic
1123545335 15:21333371-21333393 CACAGCCAAGGCCCTGGGGGAGG + Intergenic
1125134753 15:36328621-36328643 CACAGCTCTCACCCAGGGAGTGG + Intergenic
1126271273 15:46820118-46820140 CAGATCTAACACCCTGGGGATGG - Intergenic
1126408342 15:48345946-48345968 CAAATATACCACCCTGGTGGGGG - Intergenic
1129254480 15:74326432-74326454 CACAGCAACCCCCCTTGGGGTGG + Intronic
1129413159 15:75360893-75360915 CCAAACTTCCACCCTGGGGGTGG - Intronic
1129694539 15:77733183-77733205 CTCAGCTGCCATCCTGTGGGTGG - Intronic
1129866229 15:78910793-78910815 CTCAGTTACCACCCTGGGCCTGG + Intergenic
1131268315 15:90931893-90931915 CACAGACACCACCCTGGATGAGG - Exonic
1131443598 15:92477113-92477135 CACAGCCACCAGCATGGGGTGGG + Intronic
1202953680 15_KI270727v1_random:60642-60664 CACAGCCAAGGCCCTGGGGGAGG + Intergenic
1132457705 16:33314-33336 CTCTGATCCCACCCTGGGGGTGG - Intergenic
1132839953 16:1974103-1974125 CACAGGTACCAGCCTGGGGAAGG + Exonic
1132880632 16:2160326-2160348 CGCAGCATCCACCCTGGGGAAGG - Intronic
1133139762 16:3735271-3735293 CACAGCCACTCCCTTGGGGGCGG + Intronic
1134468849 16:14503692-14503714 GATAGCTACCACCCTGAGGCAGG - Intronic
1134865605 16:17604144-17604166 CAGGGCTACCACCTCGGGGGAGG + Intergenic
1136025064 16:27463741-27463763 CAGAGCGGCCACCCTGGAGGTGG + Intronic
1139956056 16:70693561-70693583 CCCTGCCACCACCCTGGCGGGGG + Intronic
1140355026 16:74297805-74297827 CATAGATACGACCCTGGGGGCGG - Intronic
1142286685 16:89174284-89174306 CCCAGATTCCAGCCTGGGGGAGG + Intronic
1142335725 16:89489265-89489287 CACAGCTACCGCCCTGCCAGGGG + Intronic
1142994847 17:3754577-3754599 CACAGCAGCCACCCAGGGGAGGG - Intronic
1143292700 17:5843592-5843614 CTCAGCTACGTCCATGGGGGTGG + Intronic
1144223384 17:13120554-13120576 CCCAGCCACCACCCAGGGGGAGG - Intergenic
1144245295 17:13356805-13356827 CAAATGTACCACCCTGGTGGAGG - Intergenic
1145941859 17:28746918-28746940 TCCAGCTGCCATCCTGGGGGAGG + Intronic
1148467748 17:47875039-47875061 CAAAGCTGCCCCCCTGGTGGTGG - Intergenic
1149663112 17:58346372-58346394 CTCAGCTGCCACCTTGAGGGGGG + Intronic
1149851464 17:60038132-60038154 TACAGCTACCACACTGTGGAGGG - Intergenic
1151292034 17:73157239-73157261 CACAGTCTCCTCCCTGGGGGAGG + Intergenic
1151585112 17:75004093-75004115 CACGGCTTCCACCCTGGGGGAGG - Exonic
1152341787 17:79729672-79729694 CACAGCCACCACCCTGGTCCGGG + Intergenic
1152840763 17:82566674-82566696 CACAGCTGCCACCCTGAGGTTGG + Intronic
1152961732 18:84123-84145 CTCTGATCCCACCCTGGGGGTGG - Intergenic
1154446484 18:14439570-14439592 CACAGCCAAGGCCCTGGGGGAGG + Intergenic
1155619537 18:27761551-27761573 AACACCTTCAACCCTGGGGGAGG - Intergenic
1158137522 18:54224000-54224022 TTCAGGTACCTCCCTGGGGGCGG - Exonic
1158282186 18:55840275-55840297 CAAAGCTTCCACCCTGTGGTAGG + Intergenic
1160909614 19:1468640-1468662 CACAGCTGGCACCCCGGGCGTGG - Exonic
1161015588 19:1981199-1981221 CACAGCCACCGCCCTGGGCACGG - Exonic
1161153665 19:2721610-2721632 CCCAGCTCCCACCCCGAGGGAGG - Intronic
1162302141 19:9850096-9850118 CACAGCCCCCACACTGGCGGGGG - Intergenic
1163237603 19:16038510-16038532 CACAGCTACCTCCCACTGGGAGG + Intergenic
1164817193 19:31213606-31213628 CAAAGGTACCACCCTGGTGGGGG + Intergenic
1166093592 19:40525954-40525976 CACATTTCCCACCCTGTGGGAGG + Intronic
1168145643 19:54418953-54418975 CCCAGCTGCCAGCCTGGGAGGGG + Intronic
1168590814 19:57633160-57633182 CACAAGTCCCGCCCTGGGGGGGG - Intronic
1202710635 1_KI270714v1_random:17741-17763 CACAGCTACCTCCTTGGCTGAGG - Intergenic
926854140 2:17233951-17233973 TACAGCTACAACCCTGATGGTGG - Intergenic
927044400 2:19262609-19262631 CACACCTACAAACCTGGGGGTGG + Intergenic
928221329 2:29405669-29405691 GACAGCCACCACACTGGGAGAGG + Intronic
929444713 2:41992752-41992774 CACAGCTCTCAGCCTGGTGGTGG - Intergenic
931938724 2:67228629-67228651 CGCAGGTACCACCCAGGAGGAGG + Intergenic
935658250 2:105443291-105443313 CCCAGCTACCAGCCTGGGTGAGG + Intergenic
936577756 2:113669788-113669810 AGCACCTACAACCCTGGGGGTGG + Intergenic
937998103 2:127710436-127710458 CACAGCCTCCACCCAGGGGCAGG + Intronic
941240225 2:163027085-163027107 CAAAGCTTCCACACTGGGGAAGG - Intergenic
941309923 2:163914470-163914492 CAAAGCTACCACACTGGAGAAGG - Intergenic
942113733 2:172707256-172707278 CTCAGATTCCACCCTGGGAGCGG + Intergenic
942171923 2:173297728-173297750 CACAGCCACAACCCTGGTGCCGG - Intergenic
942620149 2:177836598-177836620 CAAAGCTTCCACACTGGGGTAGG - Intronic
943031999 2:182696660-182696682 CAAATCTACCACTCTGGGAGGGG + Intergenic
946023668 2:216659038-216659060 CAGAGCTGCTACCCTGGGGACGG + Intronic
946247181 2:218394538-218394560 CCCAGCGCCCACACTGGGGGTGG - Intronic
946366386 2:219251757-219251779 CACAGCTACCACCCTGGGGGAGG - Intronic
947537279 2:230948120-230948142 CACAGCTTCCTCCCTTGGTGAGG + Intronic
947719659 2:232362828-232362850 CACAGCTGCCATCCTGGGCTGGG - Intergenic
948159448 2:235812215-235812237 CACAGCTGACTCCCTGGAGGTGG - Intronic
948464941 2:238147829-238147851 CACAGGCACCACCCTGGACGTGG + Exonic
948978819 2:241482187-241482209 CACAGTTACTACCCTAGGGCTGG + Intronic
1168757318 20:326296-326318 CACCGCTACCACCGGGGGGGCGG - Exonic
1171226139 20:23443611-23443633 CACATCTGCCAGCCTGGGAGTGG + Intronic
1172127277 20:32632162-32632184 CACAAATACCGCACTGGGGGAGG + Intergenic
1172484286 20:35288947-35288969 CACAGCCACCACCTGGGTGGGGG + Exonic
1173051056 20:39562247-39562269 CACAGCTACCACCCAGTGTAAGG - Intergenic
1174420716 20:50397354-50397376 CACAGCTACCACCGAGGTGCAGG + Intergenic
1175281174 20:57805021-57805043 CACAGCCACCACCCAGGGCCAGG + Intergenic
1175720133 20:61280785-61280807 CACAGCGGCCTCCCTGGTGGGGG + Intronic
1176449498 21:6850273-6850295 CACAGCCAAGGCCCTGGGGGAGG - Intergenic
1176827668 21:13715297-13715319 CACAGCCAAGGCCCTGGGGGAGG - Intergenic
1180260959 21:46668310-46668332 CTCAGCTGTCACCCTGGGTGTGG - Intergenic
1181101838 22:20545968-20545990 CAGAGATACAACCCTGAGGGTGG - Intronic
1181778692 22:25178008-25178030 CTCAGCTTCCATCCTGCGGGAGG - Intronic
1181845596 22:25706401-25706423 CAGAGCTACTGCCCTGGGGACGG - Intronic
1182285774 22:29245980-29246002 CACTGTGACCACCCTGAGGGTGG - Intronic
1182766619 22:32762253-32762275 CACTGCTATAACCCTGGGGAAGG - Intronic
1183458222 22:37934159-37934181 CACAGCCACCACACGGGGGCTGG - Intronic
1183952457 22:41359150-41359172 CACAGCCCCCACCTTGGGTGTGG - Exonic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
1185280531 22:49967946-49967968 CACAGCTATGCCCCTGAGGGTGG - Intergenic
1185422476 22:50742874-50742896 AGCACCTACAACCCTGGGGGTGG - Intronic
952339268 3:32431966-32431988 GACACCTCCTACCCTGGGGGTGG + Intronic
953374935 3:42420708-42420730 CAGAGGTCCCAGCCTGGGGGAGG + Intergenic
953832403 3:46311854-46311876 CACAGCTACCCCCATAGGAGTGG - Intergenic
954432474 3:50478215-50478237 CTCAGCTGCCAGCCTGGGGAGGG + Intronic
954933332 3:54303600-54303622 CAGAGTTAACACCCTGGGTGAGG - Intronic
955349124 3:58180943-58180965 CCCAGCTCCCAGCCTGGGGCTGG + Intergenic
955653788 3:61222338-61222360 CACACCTACCACCAGGGAGGTGG + Intronic
956761592 3:72448605-72448627 CACAGCTGCCTCCTTAGGGGAGG + Intergenic
958699125 3:97566239-97566261 CACAGTTATCACCAAGGGGGTGG + Intronic
960141313 3:114154307-114154329 CACATCTCCCACCCTGGGACAGG - Intronic
963440553 3:145334145-145334167 CAAAGCTTCCACCCTGCGGAAGG - Intergenic
963923820 3:150930495-150930517 CTCAGCTACCACTCTGAGGATGG - Intronic
963941568 3:151101117-151101139 CATTGCTACCACCCTGAGTGTGG - Intronic
965368541 3:167830099-167830121 AAAAACTACCACCCTGGGTGTGG + Intergenic
965961391 3:174432163-174432185 AACAGCTACTACCCTAGGGCTGG - Intergenic
966818088 3:183905496-183905518 CACAGCCACCACCCTGTGCTGGG - Intergenic
967941321 3:194768720-194768742 CACAGCCACCTCCGTGCGGGGGG - Intergenic
968062763 3:195738810-195738832 CACACCTGGCACCCTGGGGAAGG + Intronic
968425327 4:519432-519454 TACACCTACCACCCTGGATGGGG - Intronic
968623403 4:1614828-1614850 CACAGCTCCCACCCAGAGGCAGG + Intergenic
968811171 4:2800290-2800312 CAGAGCTGCCTCCCTGGGGAGGG + Intronic
969337484 4:6520206-6520228 CACATCTCCCACCCTGGGGCAGG - Intronic
969694381 4:8726344-8726366 CAGAGCCAGCAACCTGGGGGTGG + Intergenic
972379878 4:38509841-38509863 CAAATCTACCACCCTGGCAGAGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
975353188 4:73368755-73368777 CACAGCCACCCACCTGGGGACGG + Intergenic
979560652 4:122097789-122097811 CAAAGGTACCACTCTGGTGGAGG - Intergenic
980115332 4:128673454-128673476 CAAAGCTTCCACACTGTGGGAGG - Intergenic
983874800 4:172863305-172863327 CACAGCTTCCACCATGGGCCTGG + Intronic
984153461 4:176164036-176164058 CACACACACCACCCTGGAGGTGG + Intronic
985794679 5:1953193-1953215 CACAGCACCCAACCTGGGGTGGG + Intergenic
989538142 5:42587499-42587521 CATAGCTTCCAGCCTCGGGGTGG - Intronic
991499266 5:67259906-67259928 CATTGCCACCACCCTGGTGGAGG - Intergenic
992330625 5:75714293-75714315 AATAGCTAGAACCCTGGGGGTGG + Intronic
997411941 5:133697239-133697261 CCCATCTACCACCCTGAGGAAGG + Intergenic
999416904 5:151406163-151406185 CACAGCTTCCTCTCTTGGGGTGG + Intergenic
1000255153 5:159530452-159530474 CACTGCTTGTACCCTGGGGGAGG + Intergenic
1001267341 5:170283474-170283496 CATAGCTACAGCCCTAGGGGAGG + Intronic
1002065254 5:176648414-176648436 GACAGATGCCACCCTGGGAGGGG - Intronic
1002549753 5:179978749-179978771 CACAGCTCCCATTCTTGGGGTGG - Intronic
1003030429 6:2596436-2596458 CACTGCTGCCACCCAGTGGGCGG - Intergenic
1003097170 6:3151458-3151480 CTCAGCCACCACATTGGGGGTGG - Intronic
1006812301 6:36827718-36827740 CACAGCCAAAAGCCTGGGGGAGG + Intronic
1006933892 6:37704249-37704271 CAGAGATACCTCCCTAGGGGAGG - Intergenic
1011706098 6:90003013-90003035 CACTGCTATCACCCTGGTGTAGG + Intronic
1012607653 6:101177901-101177923 CTCATATACCACCCTGGGGGCGG - Intergenic
1012748669 6:103127876-103127898 CAAAGCTTCCACCCTGTGGAAGG + Intergenic
1015891248 6:137971798-137971820 CACAGCTGTCAGCCTGGAGGTGG - Intergenic
1016373682 6:143399066-143399088 CTCAGCCACCACCCTGGGCCAGG + Intergenic
1017717626 6:157223481-157223503 CACTGCCACCACGCGGGGGGGGG - Intergenic
1018240740 6:161771436-161771458 CACAGGTAGCAGCTTGGGGGAGG + Intronic
1019646101 7:2129835-2129857 CACAGCCACCACCGTCGGAGGGG + Intronic
1020016694 7:4835622-4835644 CAGTGCTCCCACACTGGGGGTGG - Intronic
1025250260 7:57347111-57347133 CACAGCTACCACCGAGGTGCAGG - Intergenic
1025797925 7:64757375-64757397 CAAAGCTTCCACCCTGTGGAAGG + Intergenic
1026916844 7:74125370-74125392 GAGAGCTACCACCCTCGGTGGGG + Intergenic
1027230521 7:76269152-76269174 CCCAGCCACCAGCCTTGGGGCGG + Intronic
1028151311 7:87376467-87376489 CACAAATGTCACCCTGGGGGTGG - Intronic
1032395727 7:131588418-131588440 CACAGCTTCCTCTCTGGGGATGG + Intergenic
1033270766 7:139930852-139930874 CACAGCTGCCACCCTGGCTGAGG - Intronic
1035039816 7:155919612-155919634 CACAGGCAGGACCCTGGGGGTGG - Intergenic
1036205271 8:6800928-6800950 CCCAGGTTCCAGCCTGGGGGCGG + Intergenic
1037817752 8:22120786-22120808 CACAGCAAAGCCCCTGGGGGAGG + Exonic
1037822403 8:22141383-22141405 CACAGCTTCCACCACAGGGGCGG + Intronic
1038604514 8:28985887-28985909 CAAAGGTACCACTCTGGGGCTGG - Intronic
1039204908 8:35141395-35141417 CACAGCCGTCACCCTGGGGTAGG + Intergenic
1046131767 8:109975040-109975062 CCCAGCGAACACCCCGGGGGAGG - Exonic
1048016978 8:130506469-130506491 CACAGCTCCCACACTGGATGTGG + Intergenic
1048153446 8:131916942-131916964 CACAGCTTCCTAGCTGGGGGAGG + Intronic
1049944394 9:580362-580384 CAAAGCTTCCACACTGTGGGAGG + Intronic
1054906576 9:70418849-70418871 GACAGCTAACACCCAGGGGCTGG + Intergenic
1056762293 9:89424154-89424176 CACAGCTACTTCCCTGGGAGAGG + Intronic
1059089763 9:111343363-111343385 CAAATGTACCACCCTGGAGGGGG + Intergenic
1060910813 9:127348804-127348826 CACAGATACCCCCGTGGGAGCGG - Intronic
1061108859 9:128552746-128552768 CCCAGCTCCCACCCGGGGGTCGG - Intronic
1061750364 9:132772869-132772891 CACAGCTACCACCCTGGTCCAGG + Intronic
1061824136 9:133247341-133247363 CCCAGCTGCCCCCCAGGGGGTGG - Intergenic
1062736418 9:138139981-138140003 CTCTGATCCCACCCTGGGGGTGG + Intergenic
1203519689 Un_GL000213v1:34244-34266 CACAGCCAAGGCCCTGGGGGAGG + Intergenic
1189281097 X:39820705-39820727 CACAGGTACCACCTGGGTGGTGG - Intergenic
1189301047 X:39952552-39952574 AACAGCAACCAGCCTGGGGCAGG + Intergenic
1189369540 X:40416802-40416824 GACAGGCACCTCCCTGGGGGAGG - Intergenic
1190318843 X:49167451-49167473 CACAGCTTCCCTCCTGTGGGGGG - Intronic
1190344373 X:49323568-49323590 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190345464 X:49333112-49333134 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190347813 X:49533706-49533728 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190348914 X:49543262-49543284 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190350016 X:49552818-49552840 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190351119 X:49562371-49562393 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190352220 X:49571929-49571951 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190353321 X:49581478-49581500 CACAGTAACCTCCCTGTGGGTGG + Intronic
1190355526 X:49600549-49600571 CACAGTAACCTCCCTGTGGGTGG + Intronic
1193075884 X:77355244-77355266 CCCAGGTACCACCCAGGGAGAGG + Intergenic
1194261564 X:91701959-91701981 CACTGCTACCACTCTGGGCAAGG + Intergenic
1194539443 X:95153034-95153056 TACAGCCACCAGCCTGGGAGAGG - Intergenic
1195676409 X:107510509-107510531 CCCAGCTACCAACGTGGGGGAGG + Intergenic
1197378439 X:125710076-125710098 CACAGAAAGCACCCTGGGGTGGG - Intergenic
1198361934 X:135904007-135904029 CACAGCTGTCCCTCTGGGGGAGG + Intronic
1199245363 X:145598548-145598570 GACAGCTACCAACCTGGGAGTGG + Intergenic
1200021105 X:153209881-153209903 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1200398656 X:156006086-156006108 CTCTGATCCCACCCTGGGGGTGG + Exonic
1200580213 Y:4940763-4940785 CACTGCTACCACTCTGGGCAAGG + Intergenic