ID: 946366733

View in Genome Browser
Species Human (GRCh38)
Location 2:219253385-219253407
Sequence ATGCATACACAGAGGAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946366733 Original CRISPR ATGCATACACAGAGGAAAGG GGG Intronic
901074587 1:6545559-6545581 ATGCAAACAGAGTTGAAAGGAGG + Intronic
901254916 1:7815392-7815414 ATGCTAACACAGAAGAAAGCGGG + Intronic
902132649 1:14276623-14276645 AGACACACACAGAGGAAAGATGG - Intergenic
902159233 1:14516263-14516285 AAGCCAACACAGAGAAAAGGAGG - Intergenic
902159345 1:14517329-14517351 AAGCCAACACAGAGAAAAGGAGG + Intergenic
902211519 1:14908030-14908052 AAGAATACACAAAGGAAAGTAGG - Intronic
902311924 1:15587518-15587540 AAGCATGAACAAAGGAAAGGAGG - Intronic
902775965 1:18675212-18675234 AGGCAGCCACAGAGGAAAGAAGG - Intronic
903382328 1:22905922-22905944 ATGCACACAAAAAGGAAAAGCGG - Intronic
905442543 1:38004676-38004698 ATGCAGAGACAGAGAAAGGGAGG - Intronic
906385743 1:45367286-45367308 ATGCATACACAGCTGAAAGAAGG + Intronic
906771049 1:48484426-48484448 ACACATACACAGAGAAAATGAGG - Intergenic
907688508 1:56638024-56638046 ATGAATACAGAGATGAAAGTGGG - Intronic
908745522 1:67372649-67372671 ATGCCATCACAGAGGAAAAGGGG + Exonic
908932615 1:69334872-69334894 AGGCATCCACAGTGGCAAGGGGG + Intergenic
909418428 1:75434123-75434145 GTGAGAACACAGAGGAAAGGAGG - Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909677220 1:78252100-78252122 TTTCAGCCACAGAGGAAAGGAGG + Intergenic
909798352 1:79773091-79773113 ATGCATATACATAAGAAAGCTGG - Intergenic
909817181 1:80010157-80010179 ATGCATACATACATAAAAGGGGG + Intergenic
909890084 1:80994472-80994494 AGGCATACACAAAAGAAAAGAGG - Intergenic
910642897 1:89482758-89482780 ATGCTTCCACAGTGGAAAGTAGG + Intergenic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
911423036 1:97669892-97669914 AGACATACACAGAAGAAAAGAGG - Intronic
912012769 1:104990030-104990052 ATTCATACACAGAAAAAAGCAGG + Intergenic
912297296 1:108482620-108482642 ATCCATACACTGAGTAAAGAAGG + Intergenic
912312974 1:108641525-108641547 ATGAATTCACAGAGAAAATGTGG + Intronic
913217615 1:116633621-116633643 ATACAGAGACAGAGGGAAGGGGG - Intronic
913347102 1:117819933-117819955 AGACATACACAGAGTATAGGTGG + Intergenic
913941072 1:125106314-125106336 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
913993351 1:143635173-143635195 GTGGAAACACAGAGGAATGGAGG + Intergenic
915094829 1:153454938-153454960 ATGGATATAAAGAGGAGAGGGGG - Intergenic
915865747 1:159496243-159496265 AGGCATACAAATTGGAAAGGAGG - Intergenic
916245462 1:162683347-162683369 AGGCATACAGATTGGAAAGGAGG + Intronic
917264166 1:173202245-173202267 ATACACACACAGAGGAGAGTTGG - Intronic
917341826 1:173987462-173987484 ACACATACACAGAGTAATGGGGG - Intronic
917784150 1:178434341-178434363 ATGTATACACACAGTGAAGGTGG - Intronic
917801627 1:178576058-178576080 ATGCACACACAGAGGACTGACGG - Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918938782 1:190961940-190961962 ATGCATTCAAATAGGAAAAGAGG + Intergenic
919307488 1:195861160-195861182 CAGCATACACAAAGGCAAGGTGG - Intergenic
919345863 1:196377492-196377514 TTGCATACAAAGAGGAAAATGGG - Intronic
923337391 1:232982315-232982337 CTGCACCCACAGAGAAAAGGTGG - Exonic
923885771 1:238153599-238153621 CTGCATACACAGTAGAAAGGTGG + Intergenic
924236339 1:242002506-242002528 ATACATACACTGAGGAACAGTGG - Intergenic
924934871 1:248759161-248759183 AAGCAAACACAGAGAGAAGGCGG - Intergenic
1062883620 10:998952-998974 ACGTGTACACAGAGGAAATGAGG + Intronic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063019851 10:2116966-2116988 GTGCAAACACACAGAAAAGGGGG - Intergenic
1063217947 10:3940855-3940877 ACACATACACAAAGGGAAGGTGG + Intergenic
1063277673 10:4588707-4588729 CTTCATAAACAGACGAAAGGTGG + Intergenic
1064515926 10:16147867-16147889 ATGCATACACCGTGGAAATGGGG + Intergenic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1066301294 10:34099662-34099684 AAGCATCCAAATAGGAAAGGAGG + Intergenic
1067407037 10:46032602-46032624 AAGCAAACACAGAGGAATGTGGG + Intergenic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1068161494 10:53271222-53271244 AGGCAGATATAGAGGAAAGGGGG + Intergenic
1068379005 10:56223860-56223882 ATGAATAAAAAAAGGAAAGGAGG + Intergenic
1068615611 10:59112168-59112190 AGGCAGACAAAGAGGAAAGGGGG - Intergenic
1068789455 10:61011054-61011076 ATGCATACACTGAGGAAAGGTGG + Intergenic
1071064394 10:81613867-81613889 ATGATCACACAGAGGAAAAGTGG - Intergenic
1071307985 10:84315988-84316010 ATGCATAGGCAGAGGTAGGGGGG - Intergenic
1071532200 10:86399096-86399118 AACCGTTCACAGAGGAAAGGCGG - Intergenic
1072258204 10:93641226-93641248 ATGAAAACAGAAAGGAAAGGGGG - Intronic
1073167189 10:101466198-101466220 ACACATACACAAAGGAAATGGGG - Intronic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1074672681 10:115812099-115812121 ATGCAAACACAAAAGAAAGCTGG - Intronic
1075399766 10:122152362-122152384 AAGCAAACACAAATGAAAGGGGG + Intronic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1076411157 10:130252023-130252045 GTGCAGACACACAGGGAAGGAGG - Intergenic
1077480930 11:2814232-2814254 ATGCAGAGATAGAGGGAAGGAGG + Intronic
1078342688 11:10510423-10510445 TTGCAAACACAAAGGAAAGTAGG - Intergenic
1079949187 11:26780675-26780697 AAGCATAAACATAAGAAAGGAGG + Intergenic
1080270922 11:30449918-30449940 ATGACTAGACAGAGGAAAGGGGG - Intronic
1080582209 11:33652892-33652914 ATACATAGACAGACGAAAGCAGG - Intronic
1085857704 11:80194457-80194479 AAGAATTCACAGAGGAAATGTGG + Intergenic
1088970021 11:114765691-114765713 AGGTATACACAGATGAAAGTAGG - Intergenic
1088996933 11:115008919-115008941 ATGCACAGGGAGAGGAAAGGAGG + Intergenic
1090436421 11:126690417-126690439 ATCCATCCACTGAGGGAAGGGGG - Intronic
1091541452 12:1466213-1466235 ATGTATACACCAAGGAGAGGGGG - Intronic
1093747858 12:22763588-22763610 AAGCATACATAGAGGAAATCAGG - Intergenic
1094168608 12:27467398-27467420 ATTCATACACATATGAAAGTTGG - Intronic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1096280355 12:50247349-50247371 ATCCAGAGACAGAGGGAAGGAGG - Intronic
1098002135 12:65956024-65956046 AGACATACAAAGAGGGAAGGAGG + Intronic
1098992428 12:77078457-77078479 GTGCATGCACAGAGAAAAGGAGG + Intergenic
1099887445 12:88549063-88549085 CTGCATACAGAGAGAAAAGCTGG + Intronic
1100361376 12:93882766-93882788 ATGCACACAAAGAGGGAAGCAGG + Intronic
1100561967 12:95756272-95756294 ATCCATTCACAGAATAAAGGTGG - Intronic
1101048125 12:100832152-100832174 AAGCTTACACAGAGGATTGGGGG - Intronic
1101751798 12:107588103-107588125 ACACAGACACAGAGGAAAGAGGG - Intronic
1101937518 12:109070156-109070178 ATGCAAGCCGAGAGGAAAGGTGG + Intronic
1102409426 12:112704429-112704451 ATGGAGAGACAGAGGGAAGGTGG + Intronic
1102824217 12:115933693-115933715 GTGCAAACAGAGAGGAGAGGGGG - Intergenic
1103167910 12:118786186-118786208 ATCCATACAAAGAGGAACTGAGG + Intergenic
1103429492 12:120870785-120870807 ATTCATAGACAGTGGAATGGTGG + Intronic
1104709274 12:130974011-130974033 ATGCAGACGCAGAGGGTAGGTGG + Intronic
1105303142 13:19152704-19152726 ATGCACAGACAGAGGTAGGGGGG + Intergenic
1105817488 13:24050518-24050540 AGGCACACAGACAGGAAAGGAGG + Intronic
1106045835 13:26140660-26140682 AGGCATACAAATAGGAAAAGAGG + Intronic
1106421406 13:29589137-29589159 ATGCATCCTCTAAGGAAAGGGGG + Intronic
1107296919 13:38919006-38919028 ATGCATCCAAATAGGAAAAGAGG - Intergenic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108420202 13:50240745-50240767 ATGCATACCCAAAGGGCAGGGGG - Intronic
1110954040 13:81530666-81530688 AAGCATATACAAAGGAAAGAAGG + Intergenic
1110988844 13:82010989-82011011 TTGTATTCACAGAAGAAAGGAGG + Intergenic
1112153089 13:96785716-96785738 ATGCATACACACACAAAAAGAGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113065147 13:106365736-106365758 AGGCATACAGAGTGAAAAGGAGG + Intergenic
1113106380 13:106775876-106775898 ATGTTTACACATAAGAAAGGAGG - Intergenic
1113400193 13:109985405-109985427 ATGAATAGAGAGAGGAAATGGGG + Intergenic
1114408293 14:22476494-22476516 TTGCTTACCCATAGGAAAGGTGG - Intergenic
1115027787 14:28764451-28764473 ATGGAGAGACAGAGGAATGGAGG + Intergenic
1115154479 14:30322284-30322306 ATACATACATAGAGAAAAGAAGG - Intergenic
1116450690 14:45061350-45061372 ATGCATACAGATTTGAAAGGAGG - Intronic
1116704447 14:48278932-48278954 TAACATACAAAGAGGAAAGGGGG + Intergenic
1117803958 14:59470849-59470871 AGCCATCCACAGAGGGAAGGAGG + Intronic
1118111431 14:62724925-62724947 ATGCAAACACACAGCAAAGCCGG + Intronic
1118124366 14:62883820-62883842 ATAGATACAAAGAGGAAAGTTGG + Intronic
1118179042 14:63472653-63472675 AGGAATAAACAAAGGAAAGGTGG + Intronic
1119151099 14:72360216-72360238 ATTCATAGAAAGAAGAAAGGAGG + Intronic
1119579176 14:75760029-75760051 ATGCACACAGATTGGAAAGGAGG + Intronic
1120355795 14:83432052-83432074 ATGGAACCACAAAGGAAAGGAGG + Intergenic
1121937561 14:98034266-98034288 GGGGATACACAAAGGAAAGGAGG + Intergenic
1122827738 14:104379106-104379128 ATGCAGAAAGAGAGGAAGGGAGG + Intergenic
1123473553 15:20571581-20571603 GGGCATACACAGAAGAAATGGGG - Intergenic
1123644456 15:22428772-22428794 GGGCATACACAGAAGAAATGGGG + Intergenic
1123665772 15:22608680-22608702 GGGCATACACAGAAGAAATGGGG + Intergenic
1123733851 15:23166592-23166614 GGGCATACACAGAAGAAATGGGG - Intergenic
1123751988 15:23363973-23363995 GGGCATACACAGAAGAAATGGGG - Intronic
1124482917 15:30092337-30092359 GGGCATACACAGAAGAAATGGGG - Intronic
1124489370 15:30144408-30144430 GGGCATACACAGAAGAAATGGGG - Intronic
1124520659 15:30404881-30404903 GGGCATACACAGAAGAAATGGGG + Intronic
1124537998 15:30561338-30561360 GGGCATACACAGAAGAAATGGGG - Intronic
1124544458 15:30613399-30613421 GGGCATACACAGAAGAAATGGGG - Intronic
1124754159 15:32393919-32393941 GGGCATACACAGAAGAAATGGGG + Intronic
1124760651 15:32446247-32446269 GGGCATACACAGAAGAAATGGGG + Intronic
1124777980 15:32602815-32602837 GGGCATACACAGAAGAAATGGGG - Intronic
1125838315 15:42773768-42773790 ATGAATGGAAAGAGGAAAGGTGG + Intronic
1126018053 15:44372504-44372526 ATGCTTACAAAGATGACAGGTGG - Intronic
1126406136 15:48324466-48324488 ATGAGTACACAGAGAGAAGGTGG + Intergenic
1128650693 15:69410668-69410690 AGGCATTGTCAGAGGAAAGGAGG + Intergenic
1128900083 15:71412500-71412522 ATACATACGTAGATGAAAGGAGG - Intronic
1129579115 15:76786689-76786711 AGACATACAGACAGGAAAGGAGG + Intronic
1130565594 15:84992270-84992292 AGGTATAGAAAGAGGAAAGGAGG + Intronic
1130706421 15:86237155-86237177 AGGCAGATACAGAGGAAAGAGGG - Intronic
1130984526 15:88836405-88836427 ATGCATCAACAGGGGAAGGGTGG - Intronic
1132155247 15:99491553-99491575 ATGTGAAGACAGAGGAAAGGTGG - Intergenic
1132794569 16:1713041-1713063 GTGCAGAGACAGAGGAAAGCCGG - Intronic
1132930574 16:2456969-2456991 ATGCATACACAGTGAGGAGGAGG + Exonic
1133062758 16:3185474-3185496 AGGCATACACAAAGGGAAGATGG + Intergenic
1133885014 16:9819091-9819113 AAGGATACACAGAGTAAATGTGG + Intronic
1134431129 16:14207641-14207663 AGGCATGGCCAGAGGAAAGGTGG + Intronic
1135426999 16:22346811-22346833 ATGCATACAACGAGGAAAGGAGG - Exonic
1137085314 16:36113692-36113714 ATGAAAAGACAAAGGAAAGGAGG - Intergenic
1137985792 16:53106851-53106873 ATACATACACAAAGGAAAGATGG + Intronic
1138202698 16:55101786-55101808 AGGCATACACAGAAGGCAGGTGG + Intergenic
1138295510 16:55881873-55881895 CTGCATAACCAGAGGTAAGGTGG + Intronic
1138860999 16:60757220-60757242 ATGCATAGAAAGAAGAAAAGTGG - Intergenic
1138937488 16:61746815-61746837 AAGCATAGACTGAGGAAAAGCGG - Intronic
1139158395 16:64472863-64472885 GAACATACACTGAGGAAAGGAGG + Intergenic
1139590550 16:67930690-67930712 CTGCAGACACGGAGGAAAAGTGG - Intronic
1141650721 16:85391575-85391597 ACATAGACACAGAGGAAAGGCGG - Intergenic
1143865260 17:9918635-9918657 AGGCATAGGCAGAGGAAGGGAGG - Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1146034299 17:29391575-29391597 ATGTATACACAGAAGGGAGGGGG + Intronic
1148988359 17:51644091-51644113 ATTCATACAAGGAGGAAAGAGGG - Intronic
1149127648 17:53254828-53254850 ATGGACACACAGAGGAAAACCGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1150589127 17:66546570-66546592 AGGCACACACAGAGGGAAGATGG - Intronic
1151057812 17:71053910-71053932 ATACATACAGTGAGGAAAGCGGG + Intergenic
1151222362 17:72622541-72622563 ATCCATAAACAGAGAAATGGAGG - Intergenic
1152837097 17:82540479-82540501 ATGGCTACACAGGGGAAAGGGGG - Intronic
1203190504 17_KI270729v1_random:181635-181657 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1153984828 18:10342806-10342828 GTGCATGCTCAGAGGAGAGGAGG - Intergenic
1157013091 18:43676539-43676561 ATGCATCCAAAGTGGAAAGAAGG + Intergenic
1158963130 18:62602809-62602831 ATGCAGACAGAGAGGAGATGAGG + Intergenic
1159951654 18:74488488-74488510 AGACATACACAGAGGGAAGATGG + Intergenic
1161501647 19:4619515-4619537 ACGCAGAGACAGAGGAGAGGCGG - Intergenic
1162235860 19:9309292-9309314 ATGCATAAAGAGGGGACAGGAGG + Intronic
1162968704 19:14167656-14167678 AAGCAAACACAGAGAGAAGGTGG + Intronic
1163169229 19:15519163-15519185 ATGTGGGCACAGAGGAAAGGGGG + Intronic
1164956329 19:32389729-32389751 ATGTATACACAATGGAAAGCTGG + Intergenic
1166242172 19:41501895-41501917 AGGCAGACAGAGAGGAAAAGGGG + Intergenic
1166352013 19:42203714-42203736 AGGCATGCAGAGAGGACAGGAGG + Intronic
1166410429 19:42552876-42552898 ATGCATTCACAGAGGAACCCAGG + Intronic
1166924256 19:46255438-46255460 AAGCATCCAGAGAGAAAAGGAGG + Intergenic
1167295532 19:48646806-48646828 ATGGATACGGAGAGGAAGGGCGG + Intergenic
1167339914 19:48909175-48909197 AGGCACACAGAGAGGAAAGATGG - Intronic
1167646896 19:50710836-50710858 ATGCAGACACAGGGGAACTGAGG + Intronic
1202668744 1_KI270709v1_random:28039-28061 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
925827783 2:7867023-7867045 ATGTGTGCAAAGAGGAAAGGAGG - Intergenic
926413947 2:12631237-12631259 ATGACTACACAGAAGATAGGAGG - Intergenic
926812269 2:16765588-16765610 CTGCACACACAAAGGGAAGGGGG - Intergenic
927383949 2:22511422-22511444 ATACAGACACAGAGGGAAGTTGG - Intergenic
927595497 2:24393304-24393326 ATGAATAAACATAGTAAAGGGGG - Intergenic
927691101 2:25208783-25208805 ACGCAGACACAGAGGGAAAGTGG + Intergenic
928246122 2:29629098-29629120 CTGCATACACAAAGGCAATGGGG + Intronic
928483069 2:31703271-31703293 AGGCATCCAAATAGGAAAGGAGG + Intergenic
928824229 2:35399723-35399745 ATGAAAACAGAGAGGACAGGAGG - Intergenic
929241772 2:39660801-39660823 ATCCATACACAAAGAAAAGGTGG + Intergenic
929333837 2:40716004-40716026 ATGAATTCAGAGAGGAAAGTGGG + Intergenic
929577525 2:43061706-43061728 ATGGCTACATAGAGAAAAGGGGG - Intergenic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
930134308 2:47885857-47885879 ATCCACAGATAGAGGAAAGGAGG - Intronic
931603059 2:64022795-64022817 ATAAATACAGAGGGGAAAGGGGG + Intergenic
932578200 2:72974217-72974239 ATGCATACACACACAAAATGGGG - Intronic
932824962 2:74930656-74930678 ATGGATATACAGGGTAAAGGAGG - Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935186429 2:100737973-100737995 AGGCATACAGATTGGAAAGGAGG + Intergenic
935668818 2:105537903-105537925 ACTCATACACACAGGAAAGTGGG + Intergenic
935787062 2:106559008-106559030 ATGTCTACACAGAGTAAAGGTGG + Intergenic
937013706 2:118584296-118584318 ATGCATACTCAGGGGAAATGGGG + Intergenic
937091276 2:119208025-119208047 AGGCATACAGAGAGGAAATATGG - Intergenic
939452343 2:142390483-142390505 ATGACAACACAGAGGAAAGTAGG - Intergenic
939989873 2:148867433-148867455 ATGCAACCACAGAGGAGAGGTGG - Intergenic
940981286 2:160006518-160006540 ATGCATTCATACTGGAAAGGGGG - Intronic
941365909 2:164611287-164611309 AAGCTAACACAGAAGAAAGGAGG + Intronic
943487549 2:188505356-188505378 TTCAATACAGAGAGGAAAGGTGG - Intronic
943802499 2:192079304-192079326 ATGAAAAGAAAGAGGAAAGGAGG - Intronic
944953597 2:204781168-204781190 ATGCACAAAAAGAGGAAAGAGGG - Intronic
945146643 2:206745120-206745142 AGACACACACAGAGGAAAGATGG + Intronic
946366733 2:219253385-219253407 ATGCATACACAGAGGAAAGGGGG + Intronic
946888010 2:224243883-224243905 AGGCTCACACAGAGGGAAGGGGG + Intergenic
947258153 2:228189320-228189342 ATGAATAGACCAAGGAAAGGAGG - Intergenic
948056810 2:235014731-235014753 ATTTATACAAAGAGGAAATGTGG - Intronic
948558342 2:238833710-238833732 ATGCACACACAGAAGTAAAGAGG - Intergenic
948606094 2:239136415-239136437 ATGAATAGACAGAGAAAATGTGG - Intronic
1169011880 20:2257872-2257894 ATAATTACACAGAGGAAATGAGG - Intergenic
1170479625 20:16753155-16753177 ATGTCTACCCAGAGAAAAGGGGG + Intronic
1170548681 20:17456762-17456784 AGGGATACACAGAGGATAGAGGG - Intronic
1171040726 20:21760388-21760410 ATGAAAACAGAGAGGAAAGAAGG - Intergenic
1171481927 20:25460837-25460859 TTGGCTACAGAGAGGAAAGGGGG - Intronic
1172008857 20:31834690-31834712 AGGCACACACAGAGGGAAGGAGG - Intergenic
1172305250 20:33876057-33876079 ACTAATACACAGAGGAAAGAAGG + Intergenic
1172593110 20:36131466-36131488 ATGCATGGACAGAGGACAGTTGG - Intronic
1172692861 20:36802625-36802647 AAGCTAACACAGAGGAAAGCAGG + Intronic
1173583814 20:44166748-44166770 ATGCATCCACAGAGGGAGAGAGG + Intronic
1174862252 20:54102098-54102120 AGGCATACGTAGAGGAAAGGGGG + Intergenic
1175169704 20:57071556-57071578 ATAAATACACAAAGGAAAGCGGG + Intergenic
1175514855 20:59562733-59562755 ATGGATAGACAGAGCAAATGTGG + Intergenic
1176997529 21:15573909-15573931 ATTTATACAAAGAGCAAAGGAGG + Intergenic
1177472328 21:21575072-21575094 AAGAATACACAGAGTAAAGATGG + Intergenic
1178234413 21:30824660-30824682 AGGCTGAAACAGAGGAAAGGTGG + Intergenic
1181681239 22:24497217-24497239 ATGCATACACGTAGGAAAATAGG + Intronic
1182015481 22:27035851-27035873 ATGTGAACACCGAGGAAAGGTGG + Intergenic
1182027767 22:27134029-27134051 AGGCAGACAAAGAGGAAAAGAGG + Intergenic
1182531059 22:30957838-30957860 TTGTATACACAGAGGTAAAGAGG + Intronic
1182714711 22:32348330-32348352 ATGGATACACACAGGAGAGTTGG - Intergenic
1182929492 22:34159182-34159204 AGGCAGACACACAGGAAACGGGG + Intergenic
1183662982 22:39232404-39232426 ATCCATGTACAGAGGACAGGAGG + Intronic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
1184312988 22:43660381-43660403 ATGCCTACTGAGAGAAAAGGTGG + Intronic
1185100469 22:48838224-48838246 AGGCATACGCAGAGGAACGCAGG - Intronic
949684580 3:6553519-6553541 GTACAGACACAGAGGGAAGGGGG - Intergenic
950350001 3:12340494-12340516 ATTGAAACACAGAGGGAAGGAGG - Intronic
950472348 3:13194016-13194038 ATGCAGAGACTCAGGAAAGGGGG - Intergenic
951154186 3:19329170-19329192 CTCCATAAACAGAGGAAATGTGG - Intronic
951163010 3:19449366-19449388 ATGAATTCACAGAGAAAAAGAGG - Intronic
951781476 3:26368069-26368091 ATCCATAAGCAGAAGAAAGGAGG + Intergenic
952190721 3:31020538-31020560 ATGGATACAAGGAGGAAATGGGG - Intergenic
952609957 3:35196709-35196731 AAGAAGAAACAGAGGAAAGGAGG - Intergenic
952662402 3:35867574-35867596 ATGCATACACAAAGGACTGTGGG - Intergenic
952919192 3:38273388-38273410 ACGCACACACAGAGGGAGGGAGG - Intronic
953157061 3:40385545-40385567 ATGCAAGCAGAGAGGAAAGCTGG + Intergenic
953709063 3:45254660-45254682 TCCCATTCACAGAGGAAAGGAGG - Intergenic
953823154 3:46226613-46226635 AGGCATACAGATTGGAAAGGAGG - Intronic
954768183 3:52940551-52940573 ATACATAAATGGAGGAAAGGGGG + Intronic
956133435 3:66075678-66075700 AAGCAAACAGAGAGGAAAGCAGG + Intergenic
956528238 3:70188007-70188029 ATGCCTCCCCAGGGGAAAGGTGG - Intergenic
956731315 3:72199130-72199152 ATGCTTTCACAGAGGAAACATGG + Intergenic
957181516 3:76884924-76884946 ATGAAGACACAGAGGAGAGATGG + Intronic
958095831 3:88942963-88942985 ATGCATACAAAAAGGTATGGGGG - Intergenic
959795556 3:110423916-110423938 ATACATTCACAGAGCATAGGTGG + Intergenic
960034340 3:113087275-113087297 AGGCATCCACGGAGGAGAGGGGG - Intergenic
960760411 3:121067902-121067924 ATGCAAACACAAAGTAAAGATGG - Intronic
961019600 3:123493988-123494010 ATCCAGTCACATAGGAAAGGAGG - Exonic
961666963 3:128498536-128498558 ATGCATAGACAGAGAAGAGCAGG - Intergenic
961928424 3:130508246-130508268 GTGAATACACAGAGAGAAGGCGG + Intergenic
962242026 3:133757720-133757742 ATGGCAACACAGAAGAAAGGAGG - Intronic
963725355 3:148914136-148914158 ATGCACAAACAGAGAAAAGAAGG + Intergenic
964061144 3:152525464-152525486 ATTCATACACAGTGGAATTGTGG - Intergenic
964391422 3:156201745-156201767 ATCCATACACACATGAGAGGTGG + Intronic
967237563 3:187400578-187400600 ATACATACACAGAGAAGTGGTGG - Intergenic
967430246 3:189375668-189375690 ATGAATAGACAGAGCAAAGAGGG - Intergenic
967686674 3:192425260-192425282 AAGCAAACACAAATGAAAGGTGG + Intronic
969327848 4:6454003-6454025 ATTTAAACACAGAGGAAAGGAGG - Intronic
970131390 4:12875593-12875615 ATGAAGACACAGGGGGAAGGTGG + Intergenic
970169302 4:13273867-13273889 AGGCATCCAAAGAGGAAAAGAGG + Intergenic
970277577 4:14418320-14418342 ATGCAGAAACAGAGCAAATGTGG - Intergenic
970513569 4:16804993-16805015 ATGAATACACAGAGAGAAGGTGG - Intronic
970587199 4:17526070-17526092 ATTCATAGAAAAAGGAAAGGAGG - Intronic
971304297 4:25466498-25466520 AGACATACACAGGGGGAAGGTGG - Intergenic
971345994 4:25812332-25812354 ATGCCTACACTGTGGCAAGGGGG - Intronic
971356755 4:25902009-25902031 ATGCATACAGCGTGAAAAGGGGG + Intronic
971507642 4:27383802-27383824 ATGGAAACACAGTGGAATGGTGG + Intergenic
972076653 4:35098606-35098628 ATGCAAATACAGAGGGAAGTTGG + Intergenic
972107211 4:35504151-35504173 AGGGATACAGAGAGGAAGGGAGG - Intergenic
972211683 4:36846148-36846170 ATGCATAAAAAGAAAAAAGGAGG + Intergenic
973029374 4:45316558-45316580 ATGGAGAGAGAGAGGAAAGGTGG + Intergenic
974496399 4:62634064-62634086 ATGCATTCATACAGGAAAAGAGG + Intergenic
975057371 4:69951118-69951140 ATACATACACAGAGGAAATATGG - Intergenic
975271388 4:72438084-72438106 CTGCACACACAGAGTAAAGATGG - Intronic
975746164 4:77476968-77476990 AAGCATCCACATAGGAAAAGAGG + Intergenic
976264068 4:83173685-83173707 AGGCATACAGAGGGCAAAGGAGG - Intergenic
977034406 4:91931615-91931637 ATGCATATATTGAGTAAAGGTGG + Intergenic
978266341 4:106830518-106830540 ATGCATTCAAATAGGAAAAGAGG + Intergenic
978958300 4:114642013-114642035 ATCAATAAAAAGAGGAAAGGGGG + Intronic
982944544 4:161603455-161603477 GTGCAAACACAAAGAAAAGGTGG + Intronic
982998626 4:162383197-162383219 ATGAATACACAAAGGTAGGGAGG + Intergenic
983842337 4:172472679-172472701 ACTCAGACACAGAGGGAAGGTGG + Intronic
983964864 4:173797825-173797847 ATGTATACCCTGAGGAAAAGGGG - Intergenic
984449920 4:179886504-179886526 AGGCATCCAAACAGGAAAGGAGG + Intergenic
984615597 4:181893506-181893528 ATGCATCCTAAGAGGAATGGTGG - Intergenic
985323612 4:188741998-188742020 TTGTATACACAGTGGAAAGCTGG - Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986215600 5:5716262-5716284 ATGCATACACGAAGGGTAGGAGG + Intergenic
986630375 5:9766809-9766831 AAGCATACAGAGAGGGAGGGAGG + Intergenic
987463672 5:18246700-18246722 ATGAATACACAGAGCACAGAGGG - Intergenic
988464506 5:31475538-31475560 ATGCATACACACAGAACAGCAGG + Intronic
989281981 5:39655006-39655028 AGGCAGACAGAGAGGAAAAGGGG + Intergenic
990642515 5:57803619-57803641 AGGAATACATAGAAGAAAGGAGG - Intergenic
991426390 5:66496601-66496623 CTCCATACACAGAGGTAGGGAGG + Intergenic
991567289 5:68018708-68018730 ATGGAAACACAGAGTAAAAGTGG + Intergenic
991588780 5:68226854-68226876 ATGAAACCACAGGGGAAAGGGGG + Exonic
992409729 5:76493380-76493402 ATGGAGACACACAGGGAAGGAGG - Intronic
992541843 5:77773764-77773786 ATCAATAAACAAAGGAAAGGTGG + Intronic
993047734 5:82887416-82887438 ATGCAGAGAAAGAGGACAGGAGG + Intergenic
993600174 5:89912742-89912764 ATCAATAGAGAGAGGAAAGGAGG + Intergenic
993732770 5:91442097-91442119 AAGCCTACAGAGAGGAAAGATGG - Intergenic
994090758 5:95807891-95807913 ATGCATACACAATGGAAAACAGG + Intronic
995027997 5:107446877-107446899 ATAAATACACAAAGGAAGGGTGG + Intronic
995292410 5:110472077-110472099 ATGCATCCACATAGGAAAGGAGG + Intronic
995624288 5:114059577-114059599 ATGCATAAACAAAGGGAAGGTGG + Intergenic
996846912 5:127909982-127910004 TGGCATCCACAGAGGAAATGAGG - Intergenic
998890087 5:146736640-146736662 ATGTACACACCTAGGAAAGGGGG - Intronic
999086948 5:148901120-148901142 AAGCATACTCAGCGGAATGGGGG + Intergenic
999384775 5:151146285-151146307 ATGACTACACATAGGAAATGGGG + Intronic
1000549697 5:162645256-162645278 ATGTATCCACAGTGGAAAAGTGG - Intergenic
1001171049 5:169419364-169419386 AGGCATACACAGAGGTCAGTGGG + Intergenic
1001317252 5:170652589-170652611 AGCCAGAAACAGAGGAAAGGGGG + Intronic
1002003225 5:176210583-176210605 AGGCATCCAGATAGGAAAGGTGG - Intergenic
1002223228 5:177700363-177700385 AGGCATCCAGATAGGAAAGGTGG + Intergenic
1002306376 5:178286275-178286297 CTGCCTACACAGAGGAAGTGGGG + Intronic
1003429003 6:6022000-6022022 AGGCATGCACAGAGGGAAGATGG + Intergenic
1003494519 6:6652525-6652547 AGGCATAGACAGAGGACAGCAGG - Intronic
1003745988 6:9003061-9003083 AGGCATTCACAAATGAAAGGAGG + Intergenic
1004314491 6:14574008-14574030 ATACCTCCACAGAGGAAAAGAGG + Intergenic
1005825852 6:29631618-29631640 AGGCATACAGAGAGGAATGGTGG + Intronic
1006425134 6:33958945-33958967 AGGGATCCACAGAGGAAGGGGGG - Intergenic
1007218002 6:40256183-40256205 ATTCAGGCACAGAGGAAAGTGGG + Intergenic
1007301682 6:40872416-40872438 CTGCATTCACTGAGGCAAGGAGG - Intergenic
1010950413 6:82030510-82030532 AGACATGCACAGAGGGAAGGTGG - Intergenic
1011724293 6:90193354-90193376 TTGGATACACACAGGAAAAGAGG + Intronic
1012333506 6:98024380-98024402 ATCCATACACATAAGAAAGTAGG - Intergenic
1013505260 6:110793843-110793865 CTGAACAGACAGAGGAAAGGAGG + Intronic
1014676520 6:124373861-124373883 ATGCAGACAGAGAGTAAAGGCGG + Intronic
1015393106 6:132705697-132705719 ATGCATCCAAATTGGAAAGGAGG + Intronic
1015864891 6:137718023-137718045 GCTCATACACAGAGAAAAGGCGG - Intergenic
1016062955 6:139649249-139649271 AAATATACAAAGAGGAAAGGAGG + Intergenic
1016217827 6:141624643-141624665 ATACACACACAGAGGAAAGCTGG - Intergenic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1016733137 6:147448179-147448201 AGGCAGACAGAGAGGAAAAGGGG + Intergenic
1017145940 6:151235078-151235100 AGCAATACACAAAGGAAAGGTGG - Intergenic
1017312240 6:152987370-152987392 TTGTATACACAGTGGAAAGCTGG + Exonic
1017518752 6:155182695-155182717 ATATATAGACAGAGGGAAGGAGG + Intronic
1018335367 6:162781422-162781444 GTGTCTACACAGAGGAAAGAAGG + Intronic
1018795746 6:167184376-167184398 CTGAACACCCAGAGGAAAGGGGG - Intronic
1018820569 6:167370688-167370710 CTGAACACCCAGAGGAAAGGGGG + Intronic
1019170861 6:170132463-170132485 CTGGGTACAAAGAGGAAAGGGGG + Intergenic
1021662236 7:22931169-22931191 ATGAAGACACACAGGAAAGAAGG + Intergenic
1023489027 7:40717585-40717607 ATGCCTACACAGATAAAAAGGGG - Intronic
1023734051 7:43219356-43219378 AGGCAGACAGAGAGGAAAAGGGG - Intronic
1024010996 7:45266611-45266633 AGGCATACGTAGAGGAAAGATGG - Intergenic
1024466161 7:49713438-49713460 ATGCACAGTCAGAGGTAAGGAGG + Intergenic
1024688172 7:51770772-51770794 ATGAACACACTGAGGAAAGGGGG + Intergenic
1024783263 7:52876438-52876460 ATGCATACACAAACAATAGGTGG + Intergenic
1025064700 7:55843324-55843346 ATGTAAACATAGAGGAAAGCTGG + Intronic
1025319253 7:58075586-58075608 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025477672 7:60946055-60946077 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025554449 7:62287605-62287627 ATGAAAAGACAAAGGAAAGGAGG - Intergenic
1025560332 7:62365669-62365691 ATGAAAAGACAAAGGAAAGGAGG + Intergenic
1025997669 7:66538231-66538253 CTGCATACACTGGGGAAAAGGGG - Intergenic
1027725230 7:81796988-81797010 ATACATACAGAGAAGAAAGCGGG + Intergenic
1030206691 7:106958371-106958393 AAGCATATACAGTGCAAAGGGGG + Intergenic
1030795809 7:113786018-113786040 AGGCAGAAAAAGAGGAAAGGGGG + Intergenic
1031963679 7:128011852-128011874 ATGCTTCCACAAAGAAAAGGGGG + Intronic
1033702043 7:143848709-143848731 AGGCATCCAAATAGGAAAGGGGG + Intergenic
1034590758 7:152137095-152137117 GTGCTTGCACAGAGGAAATGAGG + Intronic
1034729898 7:153378005-153378027 ATGCATATACACAGAAATGGGGG - Intergenic
1035059318 7:156057253-156057275 GTGCAGAGAGAGAGGAAAGGGGG - Intergenic
1035100782 7:156394673-156394695 GTGCAGACACAGAGGGCAGGGGG + Intergenic
1035543442 8:459735-459757 ATGCATATGGAGAGGACAGGAGG + Intronic
1035619264 8:1025027-1025049 ATGCACACACACAGGAGAGGGGG - Intergenic
1036406473 8:8459820-8459842 AGGCATCCTCAGAAGAAAGGAGG + Intergenic
1036974370 8:13394533-13394555 TTGGTTGCACAGAGGAAAGGTGG + Intronic
1037011393 8:13847123-13847145 ATGCATACTTAGAAGAAATGTGG + Intergenic
1037771481 8:21802793-21802815 ATGCATATACATAGAAATGGAGG + Intronic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1038857392 8:31348559-31348581 AAGCATGCACTGGGGAAAGGAGG + Intergenic
1038873564 8:31522535-31522557 ATACAGAGACAGAGGAAGGGGGG + Intergenic
1040924286 8:52660588-52660610 ATACATACACAAAAGGAAGGGGG + Exonic
1041549796 8:59087741-59087763 TTGCATGCAGAGAGGAAAGGGGG - Intronic
1042459922 8:69052792-69052814 ATACATCCAAATAGGAAAGGAGG + Intergenic
1042521622 8:69718353-69718375 AGGCATTCAGATAGGAAAGGAGG - Intronic
1043133703 8:76493991-76494013 ATGCATCCAAATTGGAAAGGAGG - Intergenic
1043932961 8:86111460-86111482 ATGAATGGACAAAGGAAAGGTGG - Intronic
1044441041 8:92223884-92223906 ATGCATAAAGACTGGAAAGGAGG - Intergenic
1044647712 8:94461721-94461743 ACACATACACAGAGCAAAGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046918850 8:119706111-119706133 ATGGTTCCATAGAGGAAAGGAGG + Intergenic
1046997924 8:120544984-120545006 TTGCATAAACAGAGGAAATTTGG + Intronic
1047413703 8:124645980-124646002 AGACATTCACAGTGGAAAGGAGG - Intronic
1047433663 8:124816212-124816234 ATGCATCCCCAGTTGAAAGGTGG - Intergenic
1048102208 8:131365088-131365110 ATTGATACACAGAGGACAGAGGG - Intergenic
1048534314 8:135278115-135278137 ATGCCTGCACAGAGGATTGGAGG - Intergenic
1049315729 8:141966300-141966322 ACACACACACAGAGGAGAGGAGG + Intergenic
1049398848 8:142415828-142415850 ATGCCTTGACAGAGGTAAGGAGG + Intergenic
1051219863 9:14836915-14836937 ATGCAGATAGAGAGGAAAAGGGG + Intronic
1052003394 9:23316294-23316316 CTGCAGACAGAGAGGCAAGGAGG + Intergenic
1052613236 9:30802777-30802799 ATGCATTCAAAGAGGTAAGGGGG - Intergenic
1055811301 9:80151320-80151342 AGGCATCCACATAGGAAAAGAGG - Intergenic
1059357553 9:113711701-113711723 GTGCAAAGACAGGGGAAAGGTGG + Intergenic
1059659781 9:116389534-116389556 AGGCATAGACAGTGGAAAGGGGG - Intronic
1059858236 9:118425913-118425935 CTTCATACACAGAGGAAATACGG - Intergenic
1060153073 9:121300860-121300882 ATGGGTACAGAGAGGAGAGGGGG + Intronic
1061219040 9:129238207-129238229 ATTGGTACTCAGAGGAAAGGAGG - Intergenic
1061350998 9:130064784-130064806 AGGCACACACAGAGGGAAGAAGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1185484165 X:469575-469597 CCGCAGACACAGAGGGAAGGCGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186074600 X:5864419-5864441 ATGCATACACACAGAGAAGATGG - Intronic
1186989181 X:15049341-15049363 ACACAAACACAGAGGAAAGATGG + Intergenic
1187688869 X:21843714-21843736 AAGCATACAAAGTGGAAAGAAGG + Intronic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188924111 X:36018322-36018344 AGGCATACAAATTGGAAAGGAGG - Intergenic
1190097482 X:47493278-47493300 ATGCATAGAGTGAGGAATGGGGG + Intergenic
1191662357 X:63664859-63664881 ATACACACACAGAGGACAGGGGG + Intronic
1192017196 X:67344015-67344037 ATGCATGAACAGAGGCATGGAGG - Intergenic
1192054253 X:67757288-67757310 ATGCACACACACAATAAAGGTGG - Intergenic
1192700429 X:73464404-73464426 ATGCATCCAAATTGGAAAGGAGG - Intergenic
1193247106 X:79242216-79242238 ATACAGACACAGAAGAAAAGAGG - Intergenic
1195500320 X:105590341-105590363 ATGCATCCAAATAGGAAAAGAGG - Intronic
1196535852 X:116843218-116843240 ATGCTTACACATAGGAAACAAGG + Intergenic
1197654448 X:129101416-129101438 GTGCATGCACAGAAGAGAGGAGG + Intergenic
1197815988 X:130499341-130499363 ATGCATGCAGACAGGAACGGAGG - Intergenic
1197974039 X:132146271-132146293 AAGCATACAGAATGGAAAGGAGG + Intergenic
1198169078 X:134087603-134087625 AGGCATGCACATAGGAAAAGAGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198725945 X:139677066-139677088 ATGCACACTAAGAGGAAAAGTGG + Intronic
1200067465 X:153510740-153510762 AGGCAGACAGAGAGGAAAGGAGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201553792 Y:15247318-15247340 ATGCAGAAACAAATGAAAGGTGG + Intergenic