ID: 946367898

View in Genome Browser
Species Human (GRCh38)
Location 2:219261544-219261566
Sequence TGCTAGTGAAGAATTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946367892_946367898 22 Left 946367892 2:219261499-219261521 CCTCAAGCAAGTGCAAGGGTGAA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 946367898 2:219261544-219261566 TGCTAGTGAAGAATTGGGCAGGG 0: 1
1: 0
2: 0
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946367898 Original CRISPR TGCTAGTGAAGAATTGGGCA GGG Intronic
900735499 1:4297203-4297225 TGCTTGGGAAGAATGGGGGATGG + Intergenic
906573197 1:46862406-46862428 TGCCAGTGATGGACTGGGCAGGG - Intergenic
908690793 1:66777598-66777620 TTCTAGTAAAGATTTGGGGAGGG + Exonic
910766104 1:90783807-90783829 TGAAGGTGATGAATTGGGCAGGG - Intergenic
911458542 1:98159309-98159331 TGCTCATTAAGAATGGGGCAAGG - Intergenic
911662741 1:100521933-100521955 TCCAAGTGAAGAATGGGGCATGG + Intergenic
911714768 1:101119146-101119168 TGGGAGTGAAGAATTGATCAGGG - Intergenic
913250332 1:116908086-116908108 TTCTAGGGAAGAATTGGGATGGG + Intergenic
918432726 1:184478996-184479018 TCCTGGTGAAGAATTGGGAATGG + Intronic
921970061 1:221137909-221137931 AGCTAGTGAAGAGTGGGGCAGGG - Intergenic
1063830563 10:9947552-9947574 TGCCAGTGAAGAAATGGGAAAGG + Intergenic
1066626561 10:37412935-37412957 TGCTAATGAAGTTTTGGGCATGG + Intergenic
1068433024 10:56957456-56957478 GGCTAGTGAGGTATTGGACAGGG - Intergenic
1068517725 10:58044870-58044892 TGCAAGTGATGAAGTGGGTAGGG + Intergenic
1069569563 10:69486126-69486148 TGCCTGTGAAGGACTGGGCACGG + Intronic
1070032850 10:72693244-72693266 TGCAAGAGATGAATTTGGCATGG + Intronic
1070504845 10:77104040-77104062 AGCTAGTAAAGAGTTGGGCTGGG - Intronic
1070673193 10:78392628-78392650 TCCTAGGGAAGCATTGGGAAAGG + Intergenic
1071754021 10:88515547-88515569 TGCTATGAAAGAATAGGGCAAGG - Intronic
1071827520 10:89340050-89340072 TGGTAGTGAGGAAATGGGCCAGG + Exonic
1077426688 11:2483168-2483190 TGCATGTGAAGAACTGTGCAGGG + Intronic
1080083390 11:28249105-28249127 TACTAGTCAAGAATTAAGCATGG + Intronic
1080861182 11:36151512-36151534 AGCTAGTAAACAATTGGGCTGGG + Intronic
1088886215 11:114009132-114009154 TGAAAGTGAAGAAGTGGGAAAGG - Intergenic
1089592635 11:119554242-119554264 TACTAGTGAGGAAGTGGGAAAGG + Intergenic
1095714669 12:45329774-45329796 TGCTAGAGGAAAATTGTGCATGG - Intronic
1098600133 12:72321299-72321321 TTCTAGGAAAGAATTGGGGATGG + Intronic
1099668628 12:85661648-85661670 TGCTGATGAACAAGTGGGCAGGG - Intergenic
1099711872 12:86237257-86237279 TGCTAGTGAATAATAGAGCTAGG - Intronic
1100297826 12:93279016-93279038 TGCTAGTGAATAGTGGGCCATGG - Intergenic
1100693195 12:97061758-97061780 TTTTAGTGAGGAATTGGGAAAGG + Intergenic
1108715138 13:53071445-53071467 TGCTAGTAAATAGTTGAGCAAGG - Intergenic
1112966885 13:105208119-105208141 TGCTAGAGATGAATTTTGCATGG - Intergenic
1113713459 13:112486909-112486931 AGCTGGTGAAGACTTGGGCGGGG - Intronic
1116971838 14:51074627-51074649 TGCTAGGAAAGAAAAGGGCAGGG - Intronic
1117042394 14:51778881-51778903 TCCTAATGAAGAAGTGAGCAGGG - Intergenic
1117342229 14:54802353-54802375 TGCTGGGGAAGAATTGGGCTAGG + Intergenic
1118475184 14:66109776-66109798 TGCCAGTGAAGAAGTAGGCATGG + Intergenic
1118724649 14:68620452-68620474 AGCTAGTGCAGAAGTGAGCAAGG - Intronic
1121114778 14:91335943-91335965 CGCAGGTGATGAATTGGGCATGG - Intronic
1121223979 14:92307983-92308005 TGCTGGAGAAGAACTGGGCAAGG + Intergenic
1121952082 14:98179981-98180003 AGCTAGTGAAGAATGGGCCCTGG - Intergenic
1128500873 15:68226936-68226958 TGCTAGGGAAGAGTGGGACAGGG + Intronic
1128764973 15:70245829-70245851 TGATAGTGAAGAACAGGGGAGGG + Intergenic
1129574654 15:76729609-76729631 TGCTAGTGAATAATGGGGTCAGG - Intronic
1130975108 15:88768064-88768086 TGGTTGGGAAGATTTGGGCAGGG - Intergenic
1134108180 16:11498946-11498968 TGCTGGTGAGGAATGGGGCTGGG + Intronic
1134510003 16:14838562-14838584 TGCTAGTGTAGGAAAGGGCATGG - Intronic
1134974191 16:18557614-18557636 TGCTAGTGTAGGAAAGGGCATGG + Intronic
1135656261 16:24253077-24253099 AGCTAGTGAAGTAGTTGGCACGG - Intergenic
1138523898 16:57590726-57590748 TGCTAGGGAGGAAATGGGCTTGG - Intronic
1139604471 16:68008219-68008241 TGATACTAAAGAATTGGGCTGGG - Intronic
1144023745 17:11259741-11259763 TGCCAGTTAATATTTGGGCATGG - Intronic
1144330619 17:14220773-14220795 TGGTACTGAAGAATTGCTCATGG + Intergenic
1146285673 17:31572727-31572749 TGCTAGTGGAGAATATGGCTGGG + Intronic
1147037112 17:37689932-37689954 AGCCTGTGAAGAAGTGGGCAGGG - Intronic
1149292569 17:55231655-55231677 TGCTAATGAATAGTCGGGCAAGG + Intergenic
1151073987 17:71249841-71249863 TGTCAGCGAAGAATGGGGCATGG + Intergenic
1151400488 17:73852734-73852756 TGATAGAGAAGAAAGGGGCAGGG - Intergenic
1152287378 17:79420962-79420984 AGCTGGTGAAGACTCGGGCATGG + Intronic
1158267671 18:55677996-55678018 TCCTAGTAAAGAGTTGGACATGG - Intergenic
1158932152 18:62332972-62332994 TCCGAGTGGAGAATCGGGCAGGG + Intronic
1159994238 18:74947424-74947446 TGGTAGTGCTGAATTTGGCAGGG + Intronic
1162796462 19:13089925-13089947 CGCTAGTGAGGCACTGGGCAGGG - Intronic
1168542301 19:57223212-57223234 TTCGAGCGAAGAAATGGGCAAGG + Intergenic
1168542384 19:57223950-57223972 TTCGAGTGAAGAAATGGGTAAGG - Intergenic
926283495 2:11469067-11469089 TGCTAGGGCAGAATGGGGCATGG + Intergenic
929371838 2:41234775-41234797 AGCTAAAGAAGAACTGGGCATGG + Intergenic
930873802 2:56192153-56192175 TGCAAGTAAAGTATTGTGCAGGG + Intronic
930873811 2:56192263-56192285 TGCAAGTAAAGTATTGTGCAGGG + Intronic
932652558 2:73574666-73574688 AGTAAGTGAAGAATTGGGAATGG + Intronic
934093055 2:88571219-88571241 TGCTAGTAAAGAAAAGGGAAGGG + Intronic
936503147 2:113082399-113082421 TTCAAGTGCAGAACTGGGCAGGG + Intergenic
937559620 2:123205893-123205915 TCCTAGTGGAGAACTGGGCTGGG - Intergenic
941506114 2:166347785-166347807 TGCCTGTGAAGAATGGGGCTGGG - Intronic
941568312 2:167137216-167137238 TGCTAATGATGGACTGGGCATGG + Intronic
945605012 2:211918276-211918298 TTTTAGTGAGGAAATGGGCAAGG + Intronic
946367898 2:219261544-219261566 TGCTAGTGAAGAATTGGGCAGGG + Intronic
946469868 2:219948795-219948817 TTCTAGTGAAGAATTTGGAAGGG + Intergenic
947249205 2:228082336-228082358 TGTAAGTGAAGAAATGTGCATGG - Intronic
947679779 2:232019870-232019892 TGCTAATAAAGAAATGGGAAGGG + Intronic
948327720 2:237139948-237139970 TGCTTGTGAGGAATGAGGCATGG + Intergenic
948743005 2:240060478-240060500 CACTATTGAAGAATTGGGTAAGG - Intergenic
1169197923 20:3693315-3693337 AGCTAGTGGAGCACTGGGCAAGG - Intronic
1174662140 20:52222556-52222578 TGCCAGAGAGGAAGTGGGCAAGG - Intergenic
1177146900 21:17416591-17416613 TGGTAGTGAGGAACTGGGAAGGG + Intergenic
1178350320 21:31868567-31868589 TGACAGTGAAGAGGTGGGCAGGG + Intergenic
1179163796 21:38919374-38919396 CCATAGTGAAGAATTGGCCAAGG - Intergenic
1181259650 22:21588305-21588327 TGACAGTGAAGAATTAGGGAAGG - Intronic
1181279618 22:21709830-21709852 TGCAAGTCATGAATTGAGCATGG + Intronic
954443868 3:50536216-50536238 TGCTGGTGAACAATGGGGCATGG + Intergenic
955954292 3:64272633-64272655 TCTTAGGAAAGAATTGGGCAAGG + Intronic
956860850 3:73322221-73322243 TGCTAGAGTAGAATAGGACATGG - Intergenic
958988456 3:100811798-100811820 TGCTAGGGAAGAAACGGGAATGG + Intronic
963315412 3:143753504-143753526 TGCTTGTGCAGCATTAGGCAAGG - Intronic
964074750 3:152680280-152680302 AGCTAGTGAAGGATGGAGCATGG - Intergenic
964290523 3:155174570-155174592 TGCTATTTAAGAATTGTGCTTGG + Intronic
964934487 3:162065165-162065187 TCCTTTTGAAGAATAGGGCAGGG + Intergenic
968687323 4:1970071-1970093 TGCGAGTGACGCCTTGGGCAGGG + Intronic
970452194 4:16180647-16180669 TGCTAGAGAATAATGGGGAAAGG - Intronic
972842506 4:42948362-42948384 TGCTACTGAAGAAATGGAAAGGG - Intronic
972992621 4:44840578-44840600 TGCTGGTGGAGACTTGGCCAAGG - Intergenic
975939736 4:79628386-79628408 AGCTAGTCATGAATAGGGCACGG + Intergenic
976557968 4:86470973-86470995 TGCTAACGAAGAATTAGGCTGGG + Intronic
983651812 4:170043237-170043259 TGCAAGTGCAGAGTTGGGCAAGG - Intergenic
987045111 5:14100456-14100478 TGTTCGTGAAGAATTAGACAAGG - Intergenic
988518187 5:31922969-31922991 GGCTAGTGAAGAGCTGGGCGTGG - Intronic
990674867 5:58172421-58172443 TGCACGGGAAGAATTGGGCTTGG + Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
991112477 5:62916576-62916598 TGGTGGTGAAGAATTGGTGAGGG + Intergenic
992584876 5:78228310-78228332 TACTTGAGAAGAATTGAGCATGG - Intronic
993493695 5:88583738-88583760 TGCTACTGAAGAATTCATCATGG + Intergenic
994403560 5:99314923-99314945 TGCTCTTGAAGGATTGCGCATGG - Intergenic
994884779 5:105546217-105546239 TGCTGCCCAAGAATTGGGCAGGG + Intergenic
995530296 5:113085613-113085635 TGCTTGTGAAGAATAGGTGATGG - Intronic
996151315 5:120038735-120038757 TGCAAGTGAACAAATGGGCATGG + Intergenic
998472843 5:142396791-142396813 TGCAAATGAAGACTTGGCCAGGG + Intergenic
1003629203 6:7771653-7771675 TTCTACTGAAGACTTAGGCAGGG + Intronic
1004505655 6:16244750-16244772 TGCTAGTGAACAACTGGCCTGGG + Intronic
1004718476 6:18242616-18242638 TGCTAGTGACTAATGGGCCAAGG - Intronic
1005870258 6:29970181-29970203 AGCTAATGAGGAATTGGGGAAGG + Intergenic
1006035903 6:31211940-31211962 TGCTACAAAAGAACTGGGCATGG + Intergenic
1007219186 6:40265097-40265119 TGATAGGGAAGAATTGGCCTTGG - Intergenic
1010068028 6:71708956-71708978 TGATGCTGAAGAATGGGGCAGGG - Intergenic
1010363343 6:75020578-75020600 TGCTTGTGTAGGATTGGACATGG - Intergenic
1010495815 6:76532910-76532932 TGTTGGTGAAGAATGGGGCATGG + Intergenic
1017333656 6:153229171-153229193 TGCTAGTGAAGAATAGGCTGGGG + Intergenic
1022649076 7:32258527-32258549 TGTTAATGGAGAATTTGGCAGGG - Intronic
1023139811 7:37090728-37090750 TGTTTGTGAAGAACTGGGCAGGG - Intronic
1027430207 7:78104163-78104185 TGCTTGTGAGGAATGGAGCAGGG + Intronic
1029128132 7:98309441-98309463 TGCTGGTGGAGGATTGGGCGCGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042534041 8:69841066-69841088 TGCTGGTCAAGAATTGTGTAGGG - Intergenic
1042852615 8:73231587-73231609 TCCTAGGGAAGACTGGGGCAGGG + Intergenic
1046939643 8:119918410-119918432 TGCTAGTGAAACATTTGGCATGG + Intronic
1048374969 8:133815272-133815294 TGCTAGTGAACATTTGGCCATGG + Intergenic
1048777633 8:137964978-137965000 AGCTAGTGAAGAGCAGGGCAAGG - Intergenic
1050071063 9:1814670-1814692 ATCTAGTGAAGAATTAGGAAAGG + Intergenic
1052005154 9:23338464-23338486 TGTTAGAGAAGAATGGGTCAGGG - Intergenic
1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG + Intergenic
1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG + Intergenic
1054635284 9:67484519-67484541 TGCCAGTGCAAAATTGGACATGG - Intergenic
1057949139 9:99356057-99356079 TGCTAGGGAAGATTTGAGCAGGG - Intergenic
1058177971 9:101760170-101760192 TGCTAGTGGTGAATGGGGTAGGG - Intergenic
1062069120 9:134545941-134545963 TCCTAGTGAAGTATTGCGCATGG + Intergenic
1187478080 X:19629423-19629445 TGCTAGGGATGAAGTGGGTAGGG + Intronic
1190454160 X:50609390-50609412 TGCTACAGAAGAAATGGGGAAGG + Intronic
1191631649 X:63328583-63328605 TGGTAGACAAGGATTGGGCAGGG + Intergenic
1192434167 X:71132461-71132483 TGCTGGGGAAGAATTGGAGAAGG + Exonic
1194773227 X:97930361-97930383 TGCTAGTGAAAAACAAGGCATGG + Intergenic
1196116285 X:112003097-112003119 TGCTAGCCAAGCATTGGGCTAGG + Intronic
1200086661 X:153610427-153610449 AACTAGTGAAGAACTGGGCTCGG + Intergenic
1200825460 Y:7634431-7634453 TGCTAGCAAAGGATTAGGCAAGG + Intergenic
1202119564 Y:21509294-21509316 TGGCACTGAAGAAGTGGGCAGGG + Intergenic
1202122016 Y:21532834-21532856 TGGCACTGAAGAAGTGGGCAGGG + Intronic
1202156990 Y:21896548-21896570 TGGCACTGAAGAAGTGGGCAGGG - Intronic
1202159436 Y:21920089-21920111 TGGCACTGAAGAAGTGGGCAGGG - Intergenic
1202185884 Y:22185004-22185026 TGGCACTGAAGAAGTGGGCAGGG - Intergenic
1202205476 Y:22401392-22401414 TGGCACTGAAGAAGTGGGCAGGG + Intronic
1202234597 Y:22696664-22696686 TGCTAGCAAAGGATTAGGCAAGG - Intergenic
1202308562 Y:23499504-23499526 TGCTAGCAAAGGATTAGGCAAGG + Intergenic
1202562239 Y:26171082-26171104 TGCTAGCAAAGGATTAGGCAAGG - Intergenic