ID: 946369374

View in Genome Browser
Species Human (GRCh38)
Location 2:219271306-219271328
Sequence CTGTAGACACCTGGGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 2, 1: 0, 2: 4, 3: 23, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946369374_946369387 25 Left 946369374 2:219271306-219271328 CCCAGCCCCCCAGGTGTCTACAG 0: 2
1: 0
2: 4
3: 23
4: 185
Right 946369387 2:219271354-219271376 CCTGACCACCCACACCACCCTGG 0: 2
1: 8
2: 8
3: 38
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946369374 Original CRISPR CTGTAGACACCTGGGGGGCT GGG (reversed) Intronic
900753426 1:4415874-4415896 TTGTAGACTCCTGGTGGCCTTGG - Intergenic
901114270 1:6829010-6829032 CTTTAGCCTCCTGGGTGGCTGGG + Intronic
901862327 1:12082222-12082244 CTTGAAACACATGGGGGGCTTGG + Intronic
902375767 1:16029307-16029329 CTGTGCACACCTGGGGGTCAGGG - Intronic
902407966 1:16196634-16196656 ATGTGAACACCTGTGGGGCTGGG - Intergenic
903811839 1:26038984-26039006 CTGTAGTCAGATGGGAGGCTGGG + Exonic
904871575 1:33622374-33622396 CTGGGGACATCTGGGGGCCTTGG - Intronic
912698319 1:111857598-111857620 CTGGAGTCCCCTGGAGGGCTGGG - Intronic
913110917 1:115656410-115656432 CTGCAGTCACCTGGGATGCTGGG + Intronic
915572254 1:156751133-156751155 GGGTAGACACCTGGCGGGCACGG - Intronic
915613592 1:157016108-157016130 CAATAGACACCTGGGGGTTTAGG - Intronic
916788285 1:168102413-168102435 CTGTAAACCCCTGGTGGGCAGGG + Intronic
917815604 1:178706746-178706768 CTGTAGAGTCCTGGGGACCTGGG - Intergenic
919854067 1:201693910-201693932 TTTTAGACACCTTGGGGGCTGGG + Intronic
923467257 1:234260446-234260468 CAGAAGTCACCTGGGGAGCTTGG + Intronic
924704843 1:246492338-246492360 CTGGAATCACCTGGGGAGCTTGG - Intronic
1063454493 10:6173659-6173681 CTCCAGAGATCTGGGGGGCTAGG + Intronic
1063489016 10:6446479-6446501 CTTTAGCCTCCTGGGGAGCTGGG + Intronic
1065039022 10:21671835-21671857 CTGTAGCCTCCTGAGGAGCTGGG - Intronic
1075697857 10:124449222-124449244 CCGGAGACGCCTGCGGGGCTGGG - Intronic
1077204758 11:1336902-1336924 CTCGAGACACCTGAGGGCCTGGG - Intergenic
1078098211 11:8313354-8313376 CTGGGGACACCTGTGGGCCTTGG - Intergenic
1080639758 11:34151929-34151951 CTGCAGACGACTGGGGGCCTAGG + Exonic
1081011740 11:37821586-37821608 CTGTAGAGGGGTGGGGGGCTAGG - Intergenic
1083241065 11:61389169-61389191 CAGTAAAAACCTTGGGGGCTGGG - Intergenic
1083803924 11:65062537-65062559 CTGTGGACAGCTGGGGAGCAGGG - Intergenic
1084008989 11:66337399-66337421 CTGAGAACACCTGGGGGGCCTGG + Exonic
1085781509 11:79413259-79413281 CTGTAGACACCTTGGGAACTGGG - Intronic
1086733964 11:90283170-90283192 CTGTGGAAACCTGGGGCGCTGGG - Intergenic
1087268004 11:96082263-96082285 CTGTGAACTCCTGGAGGGCTGGG - Intronic
1088572007 11:111231419-111231441 CTCTAGAAACCTGGGGAGATGGG + Intergenic
1089393408 11:118117389-118117411 GTGTATACTCCTGGGGTGCTCGG - Exonic
1089951703 11:122534331-122534353 TTGTAGACACTTGGGTGGGTGGG - Intergenic
1090576786 11:128113398-128113420 CTGTCGGCAGGTGGGGGGCTGGG + Intergenic
1090972875 11:131657974-131657996 CTGAAGAGACCTGAGGGGCCAGG + Intronic
1091335809 11:134764844-134764866 CTGTGAAGACCTGAGGGGCTTGG + Intergenic
1093049269 12:14487608-14487630 CTGTAGACACCTGGTGAGTCTGG + Intronic
1096119130 12:49075606-49075628 CTGTGGATACCTGGGGGCCTTGG - Intergenic
1096127225 12:49128776-49128798 CTGTGGAAACCTGGGGTGCTGGG + Exonic
1096134175 12:49185828-49185850 CTGTGGAAACCTGGGGCGCCGGG + Exonic
1096144961 12:49272393-49272415 CTGTGGAAACCTGGGGCGCCGGG - Exonic
1096570668 12:52521286-52521308 TGGAACACACCTGGGGGGCTGGG - Intergenic
1100689769 12:97027567-97027589 CTGTAAGCACCTGGAGGGCAAGG + Intergenic
1101089966 12:101275205-101275227 CTGTAGCTACCAGGGAGGCTGGG + Intergenic
1103841881 12:123871783-123871805 CTGTAGATACCTGGAGGCCTGGG + Intronic
1105307233 13:19177445-19177467 CCGTGGAGACCTGGGGGGCTGGG + Exonic
1105475132 13:20722007-20722029 CTGGAGCCGCCTGGAGGGCTCGG + Exonic
1106125741 13:26898588-26898610 CTGTAGAAACGTTGGGGGCAAGG + Intergenic
1107886822 13:44880661-44880683 GTGTAGACACCTGGCGGGGGTGG - Intergenic
1109188472 13:59297680-59297702 CTGTCGAGGGCTGGGGGGCTAGG + Intergenic
1112828228 13:103417095-103417117 CTGTAGACACCTAGGTAGGTTGG + Intergenic
1113294045 13:108938533-108938555 CTGCAGAGAACTTGGGGGCTAGG - Intronic
1113358756 13:109609132-109609154 CTGAAGACACGTGAGGGCCTGGG + Intergenic
1113823169 13:113229971-113229993 CTGTATACACCAGGGGTTCTGGG + Intronic
1114261324 14:21038722-21038744 CTGTAGATAAATGGGGAGCTGGG + Intronic
1117092664 14:52266926-52266948 CTGTAGAGAGCTGGGGGGAAGGG - Intergenic
1118605476 14:67499901-67499923 CTGAAGACACCTGGGGGCTGCGG + Intronic
1118988916 14:70780499-70780521 CTGCAGACACGTGGGAGGTTTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119600894 14:75976114-75976136 GTTCAGACACCTGGGTGGCTAGG + Intronic
1119645653 14:76346538-76346560 CTCAAGACACCATGGGGGCTTGG + Intronic
1119886881 14:78150935-78150957 CTGGAGACCCCTGGGGGTCCAGG - Intergenic
1122702397 14:103598642-103598664 CAGTAAGCACCTGGGGGGCTTGG + Intronic
1122854535 14:104553893-104553915 ATGTCCACACCTGGGGGGTTTGG - Intronic
1123076758 14:105671306-105671328 CTGTAGGAAATTGGGGGGCTGGG + Intergenic
1124723225 15:32131895-32131917 CTGTTGACACCTGGGAGGGATGG + Intronic
1127585151 15:60371318-60371340 CAGTAGAAACCTGGGGGTCATGG + Intronic
1127847287 15:62881906-62881928 CTGAAGAGACCTGGGGGGCGGGG + Intergenic
1129776607 15:78241135-78241157 CTGTGGAGACCTGGGTGGGTGGG - Intronic
1131087515 15:89589196-89589218 CTGGAGTGACCTGGGGGTCTAGG + Intronic
1132589096 16:718581-718603 CTGTGGACACCTGGGGAGGGGGG + Exonic
1132942619 16:2515424-2515446 CTGTAAACACCTGTGGGGTGGGG + Intronic
1134064573 16:11219588-11219610 CTGGTGACTTCTGGGGGGCTGGG - Intergenic
1136847689 16:33589733-33589755 CTTTAAATACTTGGGGGGCTGGG + Intergenic
1139445025 16:66992346-66992368 CTGTAGAGACCTGGGGGCATGGG + Intronic
1142177306 16:88651101-88651123 CCGCGGTCACCTGGGGGGCTGGG - Exonic
1203109397 16_KI270728v1_random:1438382-1438404 CTTTAAATACTTGGGGGGCTGGG + Intergenic
1143869960 17:9951045-9951067 CTGGACACACCTTGGGGACTCGG - Intronic
1145279189 17:21455825-21455847 GTCTGGAGACCTGGGGGGCTGGG + Intergenic
1145398668 17:22514622-22514644 GTCTGGAGACCTGGGGGGCTGGG - Intergenic
1146266699 17:31457698-31457720 GTGTGGCCACCTGCGGGGCTGGG - Intronic
1147749658 17:42722199-42722221 CTTTAGCCTCCTGGGGGGCTGGG - Intronic
1147988642 17:44320427-44320449 CTGCAGCCACCTGGTGGGGTGGG + Exonic
1148739746 17:49886094-49886116 CTGGAGAAACCTCAGGGGCTTGG + Intergenic
1149370586 17:55990417-55990439 CTGTGAACACCTGGAGGGCTGGG - Intergenic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1150331283 17:64296517-64296539 TTGAGGACACCTGTGGGGCTAGG - Intergenic
1152408431 17:80110335-80110357 CTGGAGGCCCCTGGGGGGCTGGG - Intergenic
1152750370 17:82059809-82059831 AAGCAGACACCTGGAGGGCTTGG - Intronic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1154538783 18:15503523-15503545 ATGTGGACACTTGGAGGGCTTGG + Intergenic
1155166722 18:23237836-23237858 CTGCAGACACCAGAGGGGCCTGG + Intronic
1157698601 18:49745020-49745042 CTGGAGCCACATGGGTGGCTGGG + Intergenic
1158243025 18:55398812-55398834 CTGTAAACTCCTGGAGGGCAGGG - Intronic
1161582982 19:5090855-5090877 CAGGAGACACCTGGTGGGCAGGG - Intronic
1165137342 19:33677919-33677941 CACTGGGCACCTGGGGGGCTTGG + Intronic
1165980756 19:39720490-39720512 CTGTAGAGGGGTGGGGGGCTAGG + Intergenic
1168172525 19:54597918-54597940 CTGTGCTCACCTGGTGGGCTTGG - Intronic
925009525 2:471602-471624 TTGTAGACACCAGGTGGGGTGGG - Intergenic
925989782 2:9245324-9245346 CTGGAGACACCTGGGGTGGGTGG + Intronic
927208183 2:20623131-20623153 CTGGGGAGAACTGGGGGGCTGGG + Intronic
928027592 2:27752793-27752815 CTGTAGGCGCCTGTGGGGGTGGG - Intergenic
929000786 2:37345054-37345076 CTGGAGACGCCAGGGGGGCTGGG + Intronic
929575548 2:43049668-43049690 CTGGTGAGACCTGGGGGGTTGGG - Intergenic
930680887 2:54255747-54255769 CTCTAGAAACCTGTGGGGCAGGG - Exonic
930943176 2:57038344-57038366 CTGTAAATACTTGGGTGGCTTGG + Intergenic
937059573 2:118971247-118971269 CTGTAGATCCCTGGGAGTCTTGG - Intronic
938298615 2:130194304-130194326 CTGTGGAGACCTGGGGGGCTGGG + Exonic
938376665 2:130812272-130812294 CTGTTGGGGCCTGGGGGGCTGGG - Intergenic
938458116 2:131480209-131480231 CTGTGGAGACCTGGGGGGCTGGG - Exonic
938780217 2:134577727-134577749 CTGTAAATACCTGGTGGGCACGG - Intronic
939511619 2:143113448-143113470 CTGTAGACAGCTGGGGGCAGGGG - Intronic
940416071 2:153421456-153421478 CTGTGGAAACCTGCAGGGCTAGG + Intergenic
940437832 2:153675538-153675560 CTGTTGGCAGGTGGGGGGCTGGG + Intergenic
941079251 2:161041128-161041150 CTGTAGAGAAATGGGAGGCTTGG - Intergenic
943330995 2:186558948-186558970 CTGGAGAGACCTGGAGGGTTAGG - Intergenic
944512452 2:200477895-200477917 CTGCAGACACCTCGGAGGCCAGG + Exonic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
946579703 2:221115070-221115092 CTGTAATCAGCTGGGGGACTTGG - Intergenic
1174157423 20:48524799-48524821 CTGGGGACCCCTGGGGGACTTGG - Intergenic
1176623811 21:9074930-9074952 CTGGAGAGACCTGGGCGGCGTGG - Intergenic
1177759081 21:25382510-25382532 CTGTAGACACCGGGGTTGGTTGG - Intergenic
1178589211 21:33895115-33895137 CTGGAGACCCCTGGCGCGCTAGG - Exonic
1178739300 21:35182931-35182953 CTGTCGAGGACTGGGGGGCTAGG - Intronic
1179097604 21:38329543-38329565 CTGGAGCCACTTGGGGGCCTTGG + Intergenic
1179983256 21:44907291-44907313 CAGCAGACCCCTGGGGGGCAGGG + Intronic
1180615659 22:17124256-17124278 CTTTAGCCTCCTGGGTGGCTAGG - Intronic
1180674996 22:17580913-17580935 CTCTGGACACCTGTGGGGCTGGG + Intronic
1180751325 22:18126494-18126516 CAGTAGAGACCTGGGGGGCTGGG - Exonic
1180935952 22:19625536-19625558 CCATACACACCTGGGGTGCTCGG - Intergenic
1181170898 22:21009291-21009313 CCATGGAGACCTGGGGGGCTGGG + Intergenic
1181463758 22:23099866-23099888 CTGGAGGCACCTGAGGGGGTAGG + Intronic
1181508856 22:23379888-23379910 CTGGAGACCGCTGCGGGGCTAGG - Intergenic
1183401084 22:37605067-37605089 ATGGAGACACGTGGGGGCCTTGG + Intergenic
1184094269 22:42308203-42308225 CTATAGGCACCTTGGGGGCCAGG - Intronic
1184552212 22:45210478-45210500 TTCTGGACACCTGGGAGGCTGGG - Intronic
1184750425 22:46483000-46483022 ATGTAGACAGCTGAGTGGCTTGG - Intronic
949490666 3:4585916-4585938 CTGTAGGGGGCTGGGGGGCTAGG - Intronic
949533592 3:4979126-4979148 CCGCAGACACCTGGGGGCCGGGG + Exonic
950094098 3:10318355-10318377 CTGTAGGAGCCTGAGGGGCTGGG + Intronic
952407054 3:33014208-33014230 GTGCAGCCACCTGGGGGGCTGGG - Exonic
953419400 3:42742762-42742784 CAGGAGACACCTGGGGACCTGGG - Intronic
955339238 3:58112179-58112201 CTGTCTACACCAAGGGGGCTGGG + Exonic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
958072487 3:88632272-88632294 CTGAGGACACCAGGGGGGGTTGG - Intergenic
958155049 3:89746142-89746164 CTGTCGACAGGTCGGGGGCTGGG - Intergenic
959384922 3:105692045-105692067 CTGTAAATTTCTGGGGGGCTGGG + Intronic
961752140 3:129102996-129103018 CTGTGGACTCCTGGGGGTCCCGG + Intronic
969461440 4:7331217-7331239 CTGGAGACTGCTGTGGGGCTCGG + Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
974780213 4:66544260-66544282 CTGTACACACCTGGGGCTTTGGG + Intergenic
975097196 4:70470251-70470273 CTGTTGGCAGGTGGGGGGCTGGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
980567985 4:134571003-134571025 CTGTCGGCAGTTGGGGGGCTAGG - Intergenic
981238996 4:142452050-142452072 CTGTCGGCAGGTGGGGGGCTAGG - Intronic
981415531 4:144488405-144488427 CTGTAGAAGGGTGGGGGGCTGGG + Intergenic
983733666 4:171030627-171030649 CTGTCGGGAGCTGGGGGGCTGGG + Intergenic
986282721 5:6336708-6336730 CTGCAGACATCTGGAGGGCCAGG - Intergenic
986300727 5:6476529-6476551 ACGGAAACACCTGGGGGGCTCGG + Intronic
987966787 5:24887636-24887658 CTGTTGGCAGGTGGGGGGCTGGG + Intergenic
988420922 5:31005398-31005420 CTGTTGGCATCTGGGGGGCTAGG - Intergenic
988693235 5:33593674-33593696 CTGTAGGGAGTTGGGGGGCTAGG + Intronic
989150172 5:38291191-38291213 CTGTAGACTCCTTGGGGGCATGG + Intronic
990391560 5:55326845-55326867 CTGTAGAGAGGTGGGGGGCTAGG - Intronic
991161937 5:63513273-63513295 CTGTCGAGGGCTGGGGGGCTTGG + Intergenic
993852008 5:93022221-93022243 CTGGAGACAGATGAGGGGCTGGG + Intergenic
994310689 5:98267037-98267059 CTGTTGGGAGCTGGGGGGCTGGG + Intergenic
998270338 5:140700728-140700750 CTGTAGACACCTGGACCGCGAGG + Intronic
1000160474 5:158592564-158592586 CTGTAGGCGGGTGGGGGGCTAGG - Intergenic
1001801778 5:174550654-174550676 CTGCAGCAACCTGGGAGGCTTGG + Intergenic
1002833840 6:848755-848777 CTCTATGTACCTGGGGGGCTGGG + Intergenic
1006735041 6:36267591-36267613 CTTCAGGCACCTGGGGGGCTGGG - Intronic
1007078995 6:39085465-39085487 CTGTAGACACCAGGAAGGCTGGG + Intronic
1007322779 6:41039306-41039328 CTTTAGACAGCTGGGAGGCAGGG - Intronic
1008395100 6:50997090-50997112 CTGTAGGAGGCTGGGGGGCTAGG - Intergenic
1014292622 6:119576291-119576313 CCCTAGACACCTGGGGTGTTAGG + Intergenic
1014856087 6:126402513-126402535 CTGTAGACAAGTGGGTGGGTGGG - Intergenic
1017180743 6:151549540-151549562 CTGAAGAGAACTGGGTGGCTGGG - Intronic
1017882945 6:158574040-158574062 CTGAAGACACCTGGGTCTCTGGG - Intronic
1018726860 6:166619534-166619556 CTGCAGGCACCTGGGGCCCTGGG - Intronic
1019738291 7:2661037-2661059 CTGTGGGCTCCTGGGGGTCTTGG - Intronic
1019939395 7:4277245-4277267 CTGTGGACACCTGGGCGGCCAGG - Intergenic
1021773766 7:24031220-24031242 GTGTGGACAGCTGGGGAGCTAGG + Intergenic
1022955029 7:35372868-35372890 CTGTAGGGACCTGTGGGGATAGG - Intergenic
1027511224 7:79082777-79082799 CTGTAGATCCCTTGGGGGTTGGG + Intronic
1030331198 7:108272894-108272916 CTGTTGGCAGGTGGGGGGCTGGG - Intronic
1032898875 7:136283567-136283589 CTCTAGACCCCTGAGGGGATTGG - Intergenic
1036538579 8:9678237-9678259 CTGTAGACATTTGGGGGCATGGG + Intronic
1039792300 8:40885726-40885748 CTGGAGACACTTGGGGTGCCAGG - Intronic
1047785224 8:128147857-128147879 ATGCAGACACCTGGAGGCCTGGG - Intergenic
1048048052 8:130791773-130791795 CTGTAAACACCTGTGGGGCTCGG - Intronic
1049172543 8:141170705-141170727 CAGGAGCCACCTGGGGGGCAGGG + Intronic
1049435164 8:142583174-142583196 CTGAAGAGAACTGGGGGCCTGGG + Intergenic
1049501818 8:142971269-142971291 CTGTGGGGACCTGGGGGGGTTGG - Intergenic
1051494104 9:17699472-17699494 CTGTACACACGTGTGGGGATTGG - Intronic
1053173052 9:35904666-35904688 CTGCAGACTCCTGGGGCCCTGGG - Intergenic
1054426572 9:65078006-65078028 ATGTGGACACTTGGAGGGCTTGG + Intergenic
1056680579 9:88714298-88714320 CAAAAGAGACCTGGGGGGCTTGG - Intergenic
1057274282 9:93668028-93668050 TTTTAGACAGATGGGGGGCTTGG + Intronic
1057346260 9:94253642-94253664 CAGTAGACACCTATGCGGCTTGG - Intergenic
1057847541 9:98537076-98537098 CTGAAGCCACCTGGAGAGCTTGG + Intronic
1059545372 9:115170704-115170726 CTGTAGCCACCAGGGGAGCAGGG - Intronic
1060941438 9:127545254-127545276 CTGTGGAGACCTGGGAGGCCGGG - Intronic
1185533283 X:839019-839041 CTGGACAAACCTGGGGGGGTGGG + Intergenic
1186507308 X:10103375-10103397 CTGTAGACAGATGGAAGGCTAGG + Intronic
1186872211 X:13784169-13784191 CTGGAATCACCTGGGGAGCTTGG + Intronic
1187296096 X:18002144-18002166 CTGTAGAAACTTGGGGGCTTGGG + Intergenic
1187977758 X:24720352-24720374 CTGTAAGCTCCTGGAGGGCTGGG + Intronic
1193807117 X:86008251-86008273 CTGTCGGCAGGTGGGGGGCTGGG + Intronic
1193816238 X:86107654-86107676 CTGCACACAGCTGGGGGGCCTGG + Intergenic
1194949600 X:100109545-100109567 CTGTAGAGGGGTGGGGGGCTAGG - Intergenic
1200367173 X:155679041-155679063 CTGTAGGGGCGTGGGGGGCTGGG + Intergenic
1201189620 Y:11435896-11435918 CTGTGGACACCACGGGGGATGGG + Intergenic