ID: 946371810

View in Genome Browser
Species Human (GRCh38)
Location 2:219285758-219285780
Sequence TCACCTCTGCCTAGTCCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946371810_946371817 7 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371817 2:219285788-219285810 TCACCCTGAAGAGGTGGGATAGG 0: 1
1: 0
2: 1
3: 20
4: 199
946371810_946371820 12 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371820 2:219285793-219285815 CTGAAGAGGTGGGATAGGACCGG 0: 1
1: 0
2: 5
3: 24
4: 260
946371810_946371815 1 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371815 2:219285782-219285804 GCTGGCTCACCCTGAAGAGGTGG 0: 1
1: 0
2: 3
3: 15
4: 220
946371810_946371821 13 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371821 2:219285794-219285816 TGAAGAGGTGGGATAGGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 279
946371810_946371825 26 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371825 2:219285807-219285829 TAGGACCGGGGGACCCCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 91
946371810_946371822 14 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371822 2:219285795-219285817 GAAGAGGTGGGATAGGACCGGGG 0: 1
1: 0
2: 0
3: 13
4: 197
946371810_946371814 -2 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371814 2:219285779-219285801 GAGGCTGGCTCACCCTGAAGAGG 0: 1
1: 1
2: 1
3: 26
4: 183
946371810_946371826 29 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371826 2:219285810-219285832 GACCGGGGGACCCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 205
946371810_946371823 15 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371823 2:219285796-219285818 AAGAGGTGGGATAGGACCGGGGG 0: 1
1: 0
2: 1
3: 12
4: 179
946371810_946371816 2 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371816 2:219285783-219285805 CTGGCTCACCCTGAAGAGGTGGG 0: 1
1: 0
2: 2
3: 29
4: 261
946371810_946371824 25 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371824 2:219285806-219285828 ATAGGACCGGGGGACCCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946371810 Original CRISPR TCACCTCTGCCTAGTCCTGA GGG (reversed) Exonic
900098538 1:951078-951100 GCACCTCTGCCTGCTCCTGTAGG - Intronic
901039235 1:6354298-6354320 ACACCTTGGCCAAGTCCTGAAGG + Intronic
903774163 1:25782227-25782249 TCACCTCTGCCTACCACTGTGGG + Intronic
903928969 1:26851271-26851293 TCAGCCCTGCCTCCTCCTGAGGG - Intronic
904392521 1:30195389-30195411 TCACATCACCCTAGACCTGAAGG + Intergenic
905769140 1:40626081-40626103 TCACCTGTGCCTGCTCCTGGTGG - Exonic
906000631 1:42421431-42421453 TCATCCCTGCCAAGTCCAGATGG - Exonic
906817768 1:48896729-48896751 ATACCTCTGCCTAGTCCAAAAGG + Intronic
907177075 1:52534244-52534266 TCAGCTCTGCCAGTTCCTGAGGG + Intronic
914335948 1:146715090-146715112 TCACCTCTGCCTGATCCCGTGGG + Intergenic
916141660 1:161705219-161705241 TAGCCTCTGCCTAACCCTGAGGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919120060 1:193328486-193328508 TCACCGCAGCCTAGACCTGCTGG + Intergenic
920375035 1:205503768-205503790 TCATCTCTGCTTCCTCCTGAGGG - Intergenic
920665240 1:207958860-207958882 TCACCTGTGCCGAGCCCTCAAGG - Intergenic
921104736 1:211964877-211964899 TTGCCCATGCCTAGTCCTGAAGG - Intronic
921551095 1:216536582-216536604 TCACCTCTTCCTTGTTGTGATGG + Intronic
922401875 1:225267851-225267873 TCCCCTCTGCCTTGGCTTGAGGG - Intronic
922403931 1:225291763-225291785 TCACCTCTCCCCAGTCAGGATGG - Intronic
1068070355 10:52186399-52186421 TCACCTCCTGCTATTCCTGAAGG + Intronic
1069620512 10:69834707-69834729 TCTGCTCTGCCTTGTCCGGAGGG - Intronic
1070309225 10:75261274-75261296 GCACCTCTAGCTTGTCCTGAGGG + Intergenic
1070834394 10:79438774-79438796 TCTCCTCTGCTTTGTCCTGCTGG - Intronic
1070915523 10:80152032-80152054 TCGCCTCACCCTAGTCCTGGTGG - Exonic
1071049102 10:81424045-81424067 TCTCCTCTGTCTAGTCCACATGG - Intergenic
1076540619 10:131212247-131212269 TCAACTCTGCATGGGCCTGAAGG - Intronic
1076847454 10:133076254-133076276 TCACCTGTGCCTTGCCCTGAGGG - Intronic
1077104563 11:836561-836583 CCACACCTGCCTAGTCCTGTGGG + Intronic
1080541144 11:33266770-33266792 TAAACTTTGCCAAGTCCTGATGG + Intronic
1082761466 11:57130980-57131002 AGACCTCTGCCTACTCCTGGTGG - Intergenic
1084023356 11:66431888-66431910 TCACCTCCGCCTGGACTTGAGGG - Intergenic
1084180327 11:67442847-67442869 TGACCACTGCTGAGTCCTGAGGG + Intronic
1084213385 11:67634083-67634105 GCACCTCTGCCTGCTGCTGATGG - Intronic
1087045983 11:93844381-93844403 TTACCCGTGCCTAGTGCTGAAGG + Intronic
1088825411 11:113489814-113489836 TGGCCTATGCCAAGTCCTGAGGG - Intergenic
1094363092 12:29651095-29651117 TCACCTCTGCTCAGACCTGGAGG - Intronic
1099177467 12:79438336-79438358 TCACCTCCACCTAGTCCTTCAGG - Intronic
1100476836 12:94942857-94942879 CCACATCTGCCTGGTTCTGAAGG - Intronic
1102612739 12:114127053-114127075 TTACCTCTGACTAATCCTGTGGG - Intergenic
1103549840 12:121728883-121728905 TCTTCTCTCCCTAGTTCTGAAGG - Intronic
1103735111 12:123056148-123056170 TCACCACTGCCTTGACCTCAGGG - Intronic
1104108263 12:125683773-125683795 TCACCTCTTACAAATCCTGAGGG - Intergenic
1104270871 12:127281059-127281081 TCACCTCTTACAAATCCTGAGGG + Intergenic
1104575471 12:129962622-129962644 TCCCCTCTGCAAAGTCCTCATGG + Intergenic
1113021656 13:105894187-105894209 TCAGCTCTTCCTAGGCCTCAAGG + Intergenic
1113241680 13:108345188-108345210 ACACATCTGCCTGCTCCTGATGG + Intergenic
1113409402 13:110071595-110071617 TCACCTTTTCCTACTTCTGAGGG + Intergenic
1117552078 14:56846736-56846758 TCACTTTTGCCTGGTACTGACGG + Intergenic
1120045377 14:79799712-79799734 TCACCACTGCCTGTCCCTGAGGG + Intronic
1124352924 15:28971438-28971460 TCTCCTGTGCCCGGTCCTGATGG - Intronic
1126782266 15:52148970-52148992 ACACCCCTGCATAGTCCAGAAGG + Intronic
1128957759 15:71966571-71966593 TGACCTCTGGCTAGAGCTGATGG - Intronic
1132461466 16:57299-57321 TCACCCTGTCCTAGTCCTGAGGG - Exonic
1134536280 16:15029146-15029168 TCACCTCTGGCAAGTCCTTCTGG + Intronic
1137984284 16:53094522-53094544 TCACCTCTGCCTAATCCTCCTGG + Intronic
1138252609 16:55514290-55514312 TCACCTCTGACTAACCTTGAGGG + Intronic
1139997676 16:70996133-70996155 TCACCTCTGCCTGATCCCGTGGG - Intronic
1142528294 17:560738-560760 TCATCTCTTCCTATTTCTGACGG - Intronic
1142617662 17:1145886-1145908 GCACCTCTGCCCAGTGCTGCTGG + Intronic
1143128197 17:4658095-4658117 TTACCTCTGCCTAATCCTGGGGG + Intergenic
1143253775 17:5541007-5541029 TTACCTCTCCCTGGTCCTGCTGG - Intronic
1150284980 17:63949432-63949454 TCTCCTCTGCCTGCTCCTCAGGG + Exonic
1151205586 17:72504195-72504217 TCCCCACTGCCTGGTTCTGAAGG - Intergenic
1151804384 17:76396611-76396633 TCACCACTCCCTTGTCCTCAGGG + Exonic
1156054998 18:32991698-32991720 ACACCTCTGCATAAGCCTGAAGG - Intronic
1157570964 18:48711935-48711957 TCACCACTGCCTCTTCCTGGGGG + Intronic
1160473809 18:79165302-79165324 TCACCTCTACCTAGCACTGTTGG + Intronic
1160541242 18:79624359-79624381 TCACATCTTTCTAGTCCTGGTGG + Intergenic
1160780284 19:874628-874650 TCACCTCTCTCTACTCCTGGGGG - Intronic
1160883202 19:1331885-1331907 TCACCCCTGCCTCGTCCAGAGGG - Intergenic
1162793526 19:13075191-13075213 TCACCTCACCCTAGCCCTGGGGG + Intronic
1163298113 19:16425367-16425389 TGCCCTCTGCCTTCTCCTGATGG - Intronic
1164443578 19:28298693-28298715 TCAGCTCTGCCCACTCTTGAAGG + Intergenic
1167147695 19:47693042-47693064 TGATCTCTCCCTAGCCCTGAGGG - Intronic
1167564346 19:50246957-50246979 GCACCTCTTCCCAGTGCTGATGG + Intronic
1168186134 19:54700775-54700797 TCTCCACTGCGTAATCCTGAAGG - Intronic
926629033 2:15120025-15120047 ACACCTGTTCCTAGTTCTGATGG + Intergenic
927483073 2:23469457-23469479 TCGCCTCTGCCTGGTGCTGCGGG - Intronic
930105198 2:47633750-47633772 GCTGCTCTGTCTAGTCCTGAGGG - Intergenic
932403877 2:71500699-71500721 TCTGCTCTGCTCAGTCCTGAGGG + Intronic
933229453 2:79789551-79789573 TCACCTCTCCCCAGTCCCCAAGG - Intronic
934692448 2:96372163-96372185 TCATAGCTGCTTAGTCCTGAGGG + Intronic
935638532 2:105269364-105269386 GCTCCTCTGCCCATTCCTGATGG - Exonic
937253073 2:120536297-120536319 TCACCTCTGCCAAGACCAGGGGG - Intergenic
938405397 2:131030103-131030125 CCACCTCTCCGGAGTCCTGAGGG - Intronic
940239334 2:151546260-151546282 TCCCTTCTGCCTAGCCCTGGAGG + Intronic
940409938 2:153349825-153349847 TCACCTCCCTCTAGTGCTGAAGG - Intergenic
946371810 2:219285758-219285780 TCACCTCTGCCTAGTCCTGAGGG - Exonic
946406323 2:219493802-219493824 TCACCTCTCCTTATTCCTGGAGG + Intronic
947128256 2:226894871-226894893 CAGCCTCTGCCAAGTCCTGAGGG + Intronic
1169522472 20:6388289-6388311 TCTCCTCTGGGTATTCCTGATGG + Intergenic
1170487303 20:16831547-16831569 TCACCTCTGCGTAGTACACATGG + Intergenic
1170522602 20:17202957-17202979 TCACTTCAGCCTGGTCCTGTAGG - Intergenic
1172675120 20:36664391-36664413 CCACCTCTGCCTCCTTCTGAAGG - Intronic
1173005574 20:39137364-39137386 TCTCCTCTCCTTAGTCATGAAGG - Intergenic
1173017326 20:39237512-39237534 TCCCCTCTGCCTACTCCAGCAGG + Intergenic
1176082456 20:63280938-63280960 TCACCTCTGCCTGTTCCTCTAGG + Intronic
1179911357 21:44450605-44450627 GCACATCTGCCTTGTCTTGACGG + Intergenic
1180053971 21:45347670-45347692 TCACCTCTGGCGTTTCCTGAAGG - Intergenic
1180715095 22:17866200-17866222 TCTCCTCTCCCTTGGCCTGAAGG + Intronic
1180854212 22:19036139-19036161 TCAGCTCTGCCTGGTCCTCAGGG + Intergenic
1181542237 22:23579699-23579721 TCACCTCCCCCTAGTCCTTGGGG - Intronic
1183391848 22:37549836-37549858 TCACTTCTGCCAAGGCCTGCTGG - Intergenic
1184552181 22:45210352-45210374 TCACCTCTGCACAGTTCTGGGGG - Intronic
1185340428 22:50288465-50288487 CCGCCTCTGCCCTGTCCTGATGG - Intronic
950475414 3:13211629-13211651 TCCCCTCAGCCTATCCCTGAAGG + Intergenic
950499159 3:13353062-13353084 ACACCTGTGCCTATACCTGATGG - Intronic
952791615 3:37205108-37205130 TCATCTCAGCCAAGACCTGAAGG - Intergenic
953028440 3:39159376-39159398 CCTCCTCTCCATAGTCCTGAGGG + Intergenic
962297020 3:134199760-134199782 TCACCTCTCACTAGTAGTGATGG - Intronic
963395887 3:144732480-144732502 TCACCTCTGCACAGTCCTGCGGG - Intergenic
969093718 4:4716884-4716906 GCACCTGGGCTTAGTCCTGATGG - Intergenic
969142176 4:5086228-5086250 TCACCTCTGCCTAACCTTGAGGG + Intronic
970542159 4:17091042-17091064 TCACCTCTCCCCATACCTGATGG + Intergenic
971056320 4:22916982-22917004 TCAACTCTGCCAAGCCCTGTGGG + Intergenic
973583426 4:52367615-52367637 TTAGCTCTGCCTAGTTGTGATGG + Intergenic
977142763 4:93395534-93395556 TCACCTCTGTATAGTCTTTATGG - Intronic
979216872 4:118175712-118175734 TTGCCTCTGCCTGTTCCTGAGGG + Intronic
981778137 4:148393950-148393972 TCACTTCTGCCTAGCCCTGCTGG - Intronic
982925812 4:161335731-161335753 CCACCTTTGCCTAATCCTGCAGG + Intergenic
983413899 4:167431230-167431252 TCATCTGTGCTTATTCCTGAAGG - Intergenic
984924554 4:184795153-184795175 TCACTTCTGCCTAGTTCAAAGGG + Intronic
985940636 5:3133025-3133047 GCACCTGTGCCTCATCCTGATGG + Intergenic
990652291 5:57915311-57915333 TCAGCTTTTCCTAGTCTTGAGGG + Intergenic
993920520 5:93795193-93795215 TCACCTCTGCTGAGTCATGCAGG + Intronic
994326783 5:98456927-98456949 TCACCTCAGCCTAGGTCTGTAGG - Intergenic
994399141 5:99257080-99257102 TGACCTCTCCCTAGTTCTGCTGG + Intergenic
997406512 5:133653184-133653206 GTACCTCTGCCTCCTCCTGAGGG + Intergenic
998672782 5:144372612-144372634 TCACCTGTGCCAAATCCTGAAGG + Intronic
1001143398 5:169163903-169163925 TCACCTCTGCCCAGGCCCAAAGG - Intronic
1003986676 6:11442710-11442732 ACACCTCTGCTTAGTCATGCAGG - Intergenic
1004899402 6:20180444-20180466 TCACCCCTGCCATCTCCTGAGGG + Intronic
1005855017 6:29853796-29853818 TCCCATCTGCCCAGGCCTGAGGG + Intergenic
1006936362 6:37721424-37721446 TCACCTCTGCCATGTCCTATTGG + Intergenic
1007601539 6:43085200-43085222 GCCCCTCTGGCTAGCCCTGATGG + Intronic
1007660681 6:43483952-43483974 CCACCTCAGCCTCCTCCTGAGGG - Intronic
1009453162 6:63825151-63825173 CTGCCTCTGCCTAGTCATGAAGG - Intronic
1020169069 7:5831200-5831222 CCATCTCTGGCTAGTCTTGAAGG + Intergenic
1020986448 7:15141122-15141144 TCACCTGATCCTAGTCCTGATGG + Intergenic
1021440847 7:20673303-20673325 TCATCTCTTCCTTGTCCTTATGG + Intronic
1023272571 7:38480529-38480551 CCACCTCTCACCAGTCCTGAAGG - Intronic
1023827087 7:44016919-44016941 TAAGCTCTGCCTCTTCCTGAAGG + Intergenic
1026773017 7:73213949-73213971 TCCCCTCTGCCGAGGCCTCAGGG + Intergenic
1027013879 7:74767345-74767367 TCCCCTCTGCCGAGGCCTCAGGG + Intergenic
1027074158 7:75178687-75178709 TCCCCTCTGCCGAGGCCTCAGGG - Intergenic
1029738242 7:102476665-102476687 TAAGCTCTGCCTCTTCCTGAAGG + Intronic
1029755372 7:102570321-102570343 TAAGCTCTGCCTCTTCCTGAAGG + Intronic
1029773321 7:102669401-102669423 TAAGCTCTGCCTCTTCCTGAAGG + Intronic
1029907538 7:104106442-104106464 TCATCTCTGCCTTGTCCTCTGGG + Intergenic
1029982853 7:104895526-104895548 GCACCTCTGCAGTGTCCTGAGGG - Intronic
1030127854 7:106171475-106171497 CCATCTCTGCCTGGTCATGAAGG - Intergenic
1030696931 7:112595565-112595587 TGAGCTCTGGCCAGTCCTGAAGG - Intergenic
1035365780 7:158348835-158348857 TCAGCACTGCCTCCTCCTGAGGG - Intronic
1038708694 8:29921025-29921047 TCACCACTAACTAGTCCTGTTGG + Intergenic
1039785677 8:40832469-40832491 TGCCCTCTGCCGAGTCCTGCTGG + Intronic
1042884797 8:73536625-73536647 TCACCTATACCTAGTGATGATGG + Intronic
1043447679 8:80335104-80335126 ACACCTCTCCCTAGTTCTTATGG + Intergenic
1047739509 8:127795144-127795166 TCACCTTCGCCCAGCCCTGAGGG - Intergenic
1048851224 8:138647003-138647025 TCACTTCTGCCATGTCCTGTGGG - Intronic
1049552770 8:143268026-143268048 TCGCCTCTGCTCAGTCCTGGGGG + Intronic
1055056120 9:72025757-72025779 TCATCTCAGCCTAGTCTTTAAGG + Intergenic
1055822894 9:80289068-80289090 TGCCCTCTGCCTAGTCCAGGTGG + Intergenic
1055930742 9:81557403-81557425 TCACTCCTGCCTTGTTCTGAAGG - Intergenic
1056297778 9:85209679-85209701 TCACTTCTGCCTAGGCCTCCTGG - Intergenic
1056935634 9:90913287-90913309 TTACCTCTGCCTAGTGGTGTTGG + Intergenic
1056998595 9:91487238-91487260 TCAGCTCTGCCTCTTCCTGTGGG + Intergenic
1057461000 9:95261878-95261900 TCACCTCTTCCTGCTTCTGAAGG - Intronic
1058418934 9:104816859-104816881 CTATCTCTGCCTAGTCCTAATGG - Intronic
1059500259 9:114746296-114746318 TCAGCTCTGGCTAGCCCTGAAGG - Intergenic
1061902586 9:133680586-133680608 TGACCTCTGCCTCCTCTTGAGGG - Intronic
1062005395 9:134236233-134236255 TGGGCTCTGCCCAGTCCTGATGG + Intergenic
1187566942 X:20460155-20460177 TCATCTCTGCCTTGTGCTTAAGG + Intergenic
1188989438 X:36799898-36799920 TCACCCCTGACTGTTCCTGATGG - Intergenic
1190372428 X:49755462-49755484 TCACCTCTGCCTTCTGCTGTGGG + Intergenic
1191017569 X:55826780-55826802 TCTCCTCTGCCTAATTCTTAAGG - Intergenic
1192725067 X:73741267-73741289 TCTCCTCTGCCTATTTCTGAAGG + Intergenic
1193037754 X:76972227-76972249 ACACCTCTGCCTGATCCTGAAGG - Intergenic
1193040763 X:77001355-77001377 TCTCCTCTTCTTAGTCCTAAGGG - Intergenic
1196741367 X:119028755-119028777 TCACCTCTCACCAGTGCTGAGGG + Intergenic
1197819880 X:130531681-130531703 GGACCACTGCCTAGTCCTGAGGG - Intergenic