ID: 946371810

View in Genome Browser
Species Human (GRCh38)
Location 2:219285758-219285780
Sequence TCACCTCTGCCTAGTCCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946371810_946371826 29 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371826 2:219285810-219285832 GACCGGGGGACCCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 205
946371810_946371824 25 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371824 2:219285806-219285828 ATAGGACCGGGGGACCCCAGAGG 0: 1
1: 0
2: 1
3: 7
4: 71
946371810_946371820 12 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371820 2:219285793-219285815 CTGAAGAGGTGGGATAGGACCGG 0: 1
1: 0
2: 5
3: 24
4: 260
946371810_946371816 2 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371816 2:219285783-219285805 CTGGCTCACCCTGAAGAGGTGGG 0: 1
1: 0
2: 2
3: 29
4: 261
946371810_946371825 26 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371825 2:219285807-219285829 TAGGACCGGGGGACCCCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 91
946371810_946371817 7 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371817 2:219285788-219285810 TCACCCTGAAGAGGTGGGATAGG 0: 1
1: 0
2: 1
3: 20
4: 199
946371810_946371822 14 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371822 2:219285795-219285817 GAAGAGGTGGGATAGGACCGGGG 0: 1
1: 0
2: 0
3: 13
4: 197
946371810_946371815 1 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371815 2:219285782-219285804 GCTGGCTCACCCTGAAGAGGTGG 0: 1
1: 0
2: 3
3: 15
4: 220
946371810_946371823 15 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371823 2:219285796-219285818 AAGAGGTGGGATAGGACCGGGGG 0: 1
1: 0
2: 1
3: 12
4: 179
946371810_946371821 13 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371821 2:219285794-219285816 TGAAGAGGTGGGATAGGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 279
946371810_946371814 -2 Left 946371810 2:219285758-219285780 CCCTCAGGACTAGGCAGAGGTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 946371814 2:219285779-219285801 GAGGCTGGCTCACCCTGAAGAGG 0: 1
1: 1
2: 1
3: 26
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946371810 Original CRISPR TCACCTCTGCCTAGTCCTGA GGG (reversed) Exonic