ID: 946371831

View in Genome Browser
Species Human (GRCh38)
Location 2:219285820-219285842
Sequence CCCCAGAGGGAGGCCTAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946371818_946371831 6 Left 946371818 2:219285791-219285813 CCCTGAAGAGGTGGGATAGGACC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 395
946371819_946371831 5 Left 946371819 2:219285792-219285814 CCTGAAGAGGTGGGATAGGACCG 0: 1
1: 0
2: 0
3: 5
4: 82
Right 946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG 0: 1
1: 0
2: 1
3: 34
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946371831 Original CRISPR CCCCAGAGGGAGGCCTAGGA GGG Exonic
900190216 1:1349954-1349976 CACTAGAGGGCGGCCCAGGATGG + Intergenic
900251932 1:1675402-1675424 CCACGGATGGAGGCCTGGGATGG + Intronic
900262343 1:1738259-1738281 CCACGGATGGAGGCCTGGGATGG + Intronic
900637854 1:3674666-3674688 CCCCGGAGTGAGGGCCAGGAGGG - Intronic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901969445 1:12895647-12895669 TCCCAGAGGGAGGCGGAGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902007782 1:13246041-13246063 TCCCAGAGGGAGGTGGAGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902015727 1:13306133-13306155 TCCCAGAGGGAGGCGGAGGAAGG - Intronic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902026759 1:13389836-13389858 TCCCAGAGGGAGGCGGAGGAAGG - Exonic
902257664 1:15200508-15200530 CCACAGAGAGAGGCCTCAGAAGG + Intronic
902830995 1:19012488-19012510 CACCAGGGGGTAGCCTAGGAGGG + Intergenic
903285638 1:22275163-22275185 CACCAAAGGGAGGGCTAGGAGGG - Intergenic
903350802 1:22715446-22715468 CCCCAGAGGTGGGCCCAGTAGGG - Intronic
903760259 1:25692782-25692804 CCCCAGTGGAAGGCCAGGGAAGG + Intronic
904319801 1:29689478-29689500 CCCCAGCAGGAGGGCTGGGAGGG - Intergenic
904320015 1:29690448-29690470 ACCCAGAGTGAGGGCTAGGATGG - Intergenic
904325339 1:29724322-29724344 CCCCAGAGGGAGGCCATGAGAGG - Intergenic
904325588 1:29725798-29725820 CCCCAGAGGGAGGTCCTGGGAGG - Intergenic
904499969 1:30908139-30908161 CCCCAGAGGGAATCCCGGGAGGG - Intronic
904829054 1:33295070-33295092 CCCCACAAGGAAGCGTAGGAAGG + Intronic
904970277 1:34414031-34414053 CCACACAGGGAGTCCTAGCATGG - Intergenic
905381664 1:37566070-37566092 CCCCAGAAAGAGGCGTAAGAAGG + Exonic
905975772 1:42172651-42172673 CCCCAGAGGCAGGCCTGAGCTGG - Intergenic
907525124 1:55049586-55049608 AGATAGAGGGAGGCCTAGGAAGG + Intronic
907909648 1:58815072-58815094 CCCCAAAGGCAGCCCCAGGACGG + Intergenic
908823827 1:68114901-68114923 CCTCAGTGGTAGGCCTGGGAGGG + Intronic
909632328 1:77780003-77780025 CGCCAGAGGGAGGCCTGCAAAGG + Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910629222 1:89339281-89339303 CCCCAGAGGCATGTCTAGCAGGG + Intergenic
912380822 1:109247379-109247401 CCCCGGAGGGAGGACTGGGGAGG + Intergenic
913046384 1:115076808-115076830 CCCCACTGGGTGGCCCAGGAGGG + Intronic
914456045 1:147837324-147837346 AGCCAGAGGGAGGGCTAGCAGGG + Intergenic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
915041173 1:152969453-152969475 CACCAGAGGAAGGGGTAGGATGG - Intergenic
915144719 1:153789670-153789692 CCCCAGAGCGAGCTCCAGGAGGG - Intergenic
915676914 1:157540388-157540410 CCCCCCAGGCAGGCCAAGGAGGG - Intronic
916074136 1:161190734-161190756 CCCCAGGGTGAGGGCTATGAGGG + Exonic
916410925 1:164546108-164546130 TCCCAAAGGGAGGCCTCGGGAGG + Intergenic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
918198808 1:182247737-182247759 ACCCAGAGGGAGTCAAAGGAAGG + Intergenic
920215992 1:204361864-204361886 TCCCAGAGGGAGGCCGGGGAGGG + Intronic
921294664 1:213690545-213690567 TCCTAGAGGGAGGAGTAGGATGG + Intergenic
923548030 1:234939037-234939059 CCCAAAAGGGAGGCCAAGGCGGG - Intergenic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
924707433 1:246511393-246511415 CCCCAGAGGGTGACTCAGGAGGG + Intergenic
1062788313 10:283663-283685 CCCCATAGGGATGCCTTGGCTGG - Intronic
1063037373 10:2299785-2299807 CTCCAGAGAGAGGGCTAGGGTGG + Intergenic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1066055155 10:31673976-31673998 GCATGGAGGGAGGCCTAGGAGGG - Intergenic
1067752146 10:48978498-48978520 CAGCCTAGGGAGGCCTAGGAAGG + Intronic
1069773993 10:70916357-70916379 CCCCAGAGGGAGTACTGGGAAGG + Intergenic
1070300876 10:75202696-75202718 CCCCAGAAGCAGGCTCAGGATGG - Intergenic
1070311327 10:75276018-75276040 TCCCAGAGAGGGGCCTGGGAGGG - Intergenic
1070585756 10:77764725-77764747 CCCCAGAGGGAGGCTAGTGAGGG + Intergenic
1072657068 10:97337222-97337244 CCTCAGAGGGAGGCCAGGCAGGG - Intergenic
1072973112 10:100034481-100034503 TACCAGAGGGAGGCCGAGGGGGG + Intergenic
1073113430 10:101076511-101076533 CCCCAGAGGGTGGCCAAAGAGGG - Intergenic
1073491185 10:103854716-103854738 CCCCAGCCCCAGGCCTAGGAAGG + Intronic
1074499228 10:114007791-114007813 CCCTAGAGGCAGGTCAAGGAAGG - Intergenic
1074702492 10:116104660-116104682 CCCCCGAGGGAAGTCTAGGTTGG + Intronic
1074924663 10:118055407-118055429 CCCCAGGGAGAAGCCCAGGAAGG - Intergenic
1074957874 10:118410351-118410373 CCCCAGTGAGAGGCTCAGGAGGG - Intergenic
1075090302 10:119440795-119440817 GCACATAGGGAGGCCAAGGAGGG - Intronic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1075556354 10:123435335-123435357 CCCCAGCAGGAGGCCTCGGGTGG + Intergenic
1075807959 10:125203617-125203639 CCCCAAAGGGAGTTCTGGGAGGG - Intergenic
1076615417 10:131751460-131751482 CCCCAGTGGGAGGCTGAGGAAGG - Intergenic
1076740447 10:132480363-132480385 GCCCTGAGGGAGACCGAGGAAGG + Intergenic
1077101990 11:826416-826438 CCCCAGAAGGAGAGCCAGGAGGG + Intronic
1077636044 11:3841557-3841579 CCCCAGAGCCAGGCCTCGCAGGG - Intergenic
1077894499 11:6443532-6443554 CCCCAGTAGGAAGCCTGGGAAGG - Intergenic
1078504633 11:11925352-11925374 TCCCAGTGGGAGGCCGAGGTGGG - Intronic
1079557198 11:21774274-21774296 TCACAAAGGGAGGCCTACGAGGG + Intergenic
1081403227 11:42666682-42666704 CCCCAGTGGGAGGCCAGGCATGG + Intergenic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1081631453 11:44692687-44692709 CCCCAGGGAGAGGCCTGGGGTGG + Intergenic
1081700779 11:45151261-45151283 TCTCAGAGTGAGGCCTGGGAGGG + Intronic
1081845065 11:46234709-46234731 CCAGACAGGGAGGCCCAGGAAGG - Intergenic
1081904832 11:46661579-46661601 GCCCTTAGGGAGGCCAAGGAAGG + Intronic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1084660547 11:70544145-70544167 CCCCAGGGAGAGGCACAGGATGG - Intronic
1085937096 11:81159881-81159903 CGCCTGTGGGAGGCCTAGGTAGG - Intergenic
1086088907 11:82985087-82985109 TCCCAGCGGGAGGCCAAGGCAGG - Intronic
1086426746 11:86692064-86692086 CTGCAGAGGGAAGCCTGGGAAGG + Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087675277 11:101154479-101154501 ACCCAGAGGAAGGACTGGGAGGG + Intergenic
1088814206 11:113410400-113410422 CCCCAGAGGAAGGTCAAGGAAGG + Exonic
1089453172 11:118610687-118610709 CGCCTGAAGGAGGCCAAGGAAGG - Intronic
1089737478 11:120559900-120559922 CCTGAGAGGGAGGCCTGAGAGGG + Intronic
1089965586 11:122652586-122652608 GGCCAGAGGGAGACCCAGGATGG - Intergenic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1091128511 11:133123728-133123750 CCACAGAGAGAGACCCAGGAAGG - Intronic
1092133138 12:6126314-6126336 ACCCAGAGGGAGAACTAGAACGG + Intergenic
1092181505 12:6450068-6450090 CCCTAGAGGTGGGCCTGGGATGG + Intronic
1092507572 12:9119718-9119740 TCCCAGAGGGAGGTCTCTGAAGG + Intergenic
1096310407 12:50515605-50515627 CCCCAGAGAGAGCACGAGGAAGG - Intronic
1096401536 12:51311294-51311316 TCCCAGTGGGAGGCCGAGGTGGG - Intronic
1096514074 12:52146767-52146789 ACCCAGAGTGAGGCCGAGGCAGG - Intergenic
1100572060 12:95852298-95852320 CCCCAGAGGGTGGCCTGACAGGG - Intergenic
1100744387 12:97629399-97629421 CCCTAAAAGGAGGCCCAGGATGG - Intergenic
1101384198 12:104241785-104241807 CCCAACAGGGAGGCTGAGGAAGG - Intronic
1101874849 12:108591413-108591435 CACCACAGGGAGGCCAAGGAGGG + Exonic
1102007270 12:109596785-109596807 GCCGAGCAGGAGGCCTAGGAGGG + Exonic
1102236054 12:111295430-111295452 GCCTAGAGGGAGGACTGGGAGGG + Intronic
1104287959 12:127442527-127442549 GCACAGTGGGAGGCCTAGGTGGG - Intergenic
1106011698 13:25830257-25830279 CCACTTTGGGAGGCCTAGGAGGG - Intronic
1106433630 13:29705384-29705406 CCCCAGAGGCTGACCTAGCATGG + Intergenic
1106447671 13:29850666-29850688 CCGCGGAGGGAGGACGAGGACGG - Exonic
1107992423 13:45830378-45830400 ACCCAGAGAGAGACCTAGAAAGG + Intronic
1109664945 13:65521885-65521907 GCCCTTTGGGAGGCCTAGGAGGG + Intergenic
1114659887 14:24337389-24337411 TCCCAGAGTCAGGCCAAGGAGGG - Exonic
1117392920 14:55279739-55279761 CTCCAGAGGTAGGCCCAGGCTGG - Intronic
1117569553 14:57032956-57032978 TCCCAGTGGGAGGCCAAGGCGGG - Intergenic
1119034517 14:71218328-71218350 CCCCAGAGCCAGGACTAGGCTGG + Intergenic
1119324898 14:73753980-73754002 GGCCAGAGGGAGGCTGAGGAAGG + Intronic
1119481452 14:74960792-74960814 ACCCAGTGGGAGGCCTGGGGTGG + Intergenic
1119706585 14:76786695-76786717 CAACAGAGGTAGGCCTAGGAAGG + Intergenic
1121219597 14:92275589-92275611 CCCCACAGGGTGGGCCAGGAGGG + Intergenic
1121428914 14:93873288-93873310 GCCCTGAGGGGGGCATAGGAGGG + Intergenic
1121940398 14:98064755-98064777 CCCAAGAGGGAGCCCGAGGTGGG - Intergenic
1122029474 14:98901911-98901933 CACCACAGGGAGGCCCAGGAAGG + Intergenic
1122599897 14:102915957-102915979 ACTCAGAGGGAAGCCCAGGAGGG - Intergenic
1122773464 14:104107135-104107157 CCCCTGAGGGAGACCCAGGCGGG - Intronic
1122816121 14:104314912-104314934 CCCCAGAGGCAGGGCTGGGCAGG - Intergenic
1122870184 14:104634885-104634907 CCCCAGAGGGAGCCCAGAGATGG + Intergenic
1124121910 15:26894978-26895000 CCCCAGCAGGATGCCTAAGAGGG - Intronic
1128473864 15:67980329-67980351 ACACATTGGGAGGCCTAGGAGGG + Intergenic
1128783792 15:70380043-70380065 CCCAACAAGGAGGCCCAGGATGG - Intergenic
1128787710 15:70410503-70410525 CCCCAGAAGGAGGACTTGGCAGG - Intergenic
1129333804 15:74840790-74840812 CCCCAGAGGCAGATATAGGAGGG - Intronic
1129740709 15:77988334-77988356 CCCCAGCGAGAGGCCAAGGCTGG - Intronic
1129818132 15:78574132-78574154 CCTCAGGGGGAGGCCAAGGCGGG + Intronic
1129845027 15:78764223-78764245 CCCCAGCGAGAGGCCAAGGCTGG + Intronic
1130035729 15:80359778-80359800 ATCCAGAGGGTGGCCGAGGAAGG - Intronic
1130256807 15:82329617-82329639 CCCCAGCGAGAGGCCAAGGCTGG - Intergenic
1130598142 15:85260371-85260393 CCCCAGCGAGAGGCCAAGGCTGG + Intergenic
1131268934 15:90935055-90935077 ACCCAGAGGGAGGCCTGCGGTGG - Intronic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1131559218 15:93424704-93424726 CCACTGTGGGAGGCCTAGGCGGG + Intergenic
1131957093 15:97748325-97748347 GCACAGAGAGAGGCGTAGGAAGG - Intergenic
1132352608 15:101149139-101149161 GCCCAGAGGGTGCCCTGGGAAGG - Intergenic
1132502654 16:291459-291481 CCACCAAGGCAGGCCTAGGAGGG - Intronic
1134069882 16:11254629-11254651 ACCCAGAGGGAGCACCAGGAGGG + Exonic
1134203033 16:12214703-12214725 CCCCACAGGGAAGACAAGGAGGG - Intronic
1134274749 16:12766144-12766166 CCCCAAAGGGAGGCAGAGGCGGG + Intronic
1136687520 16:32003914-32003936 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136788133 16:32947465-32947487 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136881652 16:33906324-33906346 CACCAGAGGCAGGCTCAGGAGGG - Intergenic
1138414267 16:56862381-56862403 CCCGAGAGGCAGGGCTAGGGAGG + Intergenic
1139374498 16:66488293-66488315 CCCTAGGGAGAGGCCTAGAATGG - Intronic
1139673717 16:68508997-68509019 CCCCAGAGCAAGGGCTGGGAAGG - Intergenic
1139719434 16:68840812-68840834 CCCTAGAAGAAGGCCTGGGATGG - Intergenic
1140022278 16:71249725-71249747 CCCCAGAGGTAGAAATAGGAAGG - Intergenic
1141616830 16:85214658-85214680 CCAGAGAGGGAGGCCTCAGAAGG - Intergenic
1203090358 16_KI270728v1_random:1209122-1209144 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1143296078 17:5873084-5873106 CCCCCGAGCCATGCCTAGGAGGG - Intronic
1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG + Intergenic
1144734029 17:17544969-17544991 CTCCAGAGGGAGTCCAAGGTGGG + Intronic
1144876727 17:18400982-18401004 CCCCAGAGGGTGACATGGGAGGG - Intergenic
1144950699 17:18992059-18992081 CCCCAGGGAGAGGCCTGGGCTGG - Intronic
1145155500 17:20543437-20543459 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1145761574 17:27428777-27428799 CCCCAGAGGGTGACTCAGGAGGG - Intergenic
1146842933 17:36167501-36167523 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146855238 17:36255442-36255464 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146865382 17:36332933-36332955 CCCCAGAGGGTGACATGGGAGGG - Intronic
1146871144 17:36379353-36379375 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146878504 17:36430435-36430457 CCCCAGAGGGTGACATGGGAGGG + Intronic
1146882452 17:36451581-36451603 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1147068243 17:37933527-37933549 CCCCAGAGGGTGACATGGGAGGG - Intronic
1147074030 17:37979977-37979999 CCCCAGAGGGTGACATGGGAGGG + Intronic
1147079774 17:38013082-38013104 CCCCAGAGGGTGACATGGGAGGG - Intronic
1147085551 17:38059515-38059537 CCCCAGAGGGTGACATGGGAGGG + Intronic
1147095715 17:38137024-38137046 CCCCAGAGGGTGACATGGGAGGG - Intergenic
1147101498 17:38183481-38183503 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1147110918 17:38260828-38260850 GCCCTTAGGGAGGCCTAGGCAGG - Intergenic
1147148501 17:38499583-38499605 CACCAGAGGCAGGCTCAGGAGGG + Intronic
1147909174 17:43844575-43844597 CCCCAGAGTGTGGCCTAAGGTGG + Intergenic
1148418593 17:47527609-47527631 GCCCTTAGGGAGGCCTAGGCAGG + Intronic
1148581463 17:48747025-48747047 CCCCAGAAGGAGCCCCGGGAAGG - Intergenic
1149475940 17:56960834-56960856 CTCCAGGTAGAGGCCTAGGAAGG + Exonic
1149846097 17:60009987-60010009 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1150084446 17:62266567-62266589 CCCCAGAGGGTGACATGGGAGGG + Intergenic
1151633392 17:75326580-75326602 CCCCAGAGGCAGGCCTTGAGAGG - Intronic
1152242366 17:79167319-79167341 CCCCAGAGGGAGGGGAAGAAGGG - Intronic
1152390384 17:80000796-80000818 CCGCAGGGGGTGGCCTTGGACGG - Intronic
1152440817 17:80308444-80308466 ACTCAGAAGGAGGCTTAGGAGGG - Intronic
1154174874 18:12079619-12079641 CCCCAGAGGGAAGGATTGGACGG - Intergenic
1156883537 18:42108322-42108344 GCACAGAGGCAGCCCTAGGACGG - Intergenic
1157485492 18:48084203-48084225 ACCCAGGGTGAGGCCTCGGAAGG - Intronic
1157618503 18:49001943-49001965 CCCCACAGGGAGTCCTAGAGGGG + Intergenic
1157685400 18:49639032-49639054 CCCCAGTGGGAGGCCTGGGCAGG + Intergenic
1158206632 18:55000468-55000490 CCTTAGAAGGAGCCCTAGGATGG - Intergenic
1160542572 18:79632903-79632925 CCTTAGAAGGAGCCCTAGGATGG + Intergenic
1161030579 19:2056187-2056209 CCCCAGCTGGAGCCCTGGGAGGG + Intergenic
1161169370 19:2805310-2805332 CCCCACAGGGAGGCCTCTGCTGG - Intronic
1161325787 19:3663372-3663394 ACCCAGAGTGTGGCTTAGGAGGG - Intronic
1162524823 19:11201186-11201208 CCCCAGAGTCAGACCCAGGAAGG - Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162770156 19:12944489-12944511 CCCCAGAAGGAGACACAGGAGGG - Exonic
1163234776 19:16023889-16023911 CCCCAGAGGGTGACTTGGGAGGG - Intergenic
1163416939 19:17192644-17192666 CTCCAGAGTGAGACCTAGGCTGG - Intronic
1163436522 19:17299161-17299183 CCACATCGGGAGGCCAAGGAGGG + Intronic
1163672165 19:18635984-18636006 CCCCTGAGAGAGGCCTGGGAAGG + Intergenic
1164169173 19:22709313-22709335 CATCAGAGGGACGCTTAGGATGG + Intergenic
1165180470 19:33963192-33963214 GCCCACAGGGAGGCCTAAGCAGG + Intergenic
1165591852 19:36975391-36975413 CTCCATTGGGAGGCCTAGGCGGG - Intronic
1166566905 19:43771017-43771039 GCCCAGATGTGGGCCTAGGAAGG - Intronic
1166779061 19:45330725-45330747 GCGCAGTGGGAGGCCTAGGTGGG + Intergenic
1167693184 19:50999892-50999914 CCCCAGAGGGAGACAAAGAAGGG - Intronic
1168176878 19:54632940-54632962 TCCCAGAGGGAGACCTGGGGAGG + Intronic
1168473238 19:56657999-56658021 CCCAGGAGGGAGGCCAAGGCAGG + Intergenic
925809169 2:7681952-7681974 CCCCTTTGGGAGGCCAAGGAGGG - Intergenic
926136032 2:10337188-10337210 TCCCATAGGGAGGCCAGGGAGGG + Intronic
926212191 2:10879271-10879293 CCCCATCTGGAGGCCTAGGGAGG + Intergenic
927040505 2:19226057-19226079 CACCAGAGGCAGGCCTGGGATGG + Intergenic
927186219 2:20484419-20484441 CTCCCGAGGGAGGCCAGGGATGG + Intergenic
927676473 2:25110183-25110205 CCCCGGAGGGTGGCAGAGGAAGG - Intronic
928313704 2:30231015-30231037 TTCCAGAGAGAGGCCTAGTATGG + Intergenic
931282763 2:60808407-60808429 CCCTAGAGAGAGGCCTTGGCTGG + Intergenic
932423082 2:71612789-71612811 CCCCACAGGGTGGCCCAGGTAGG + Exonic
934661662 2:96146387-96146409 CTGGACAGGGAGGCCTAGGATGG - Intergenic
936082567 2:109444529-109444551 CCCCAGGTGGAGGCTTAGTATGG - Intronic
937127808 2:119485378-119485400 CCCCAGAGGCAGGTCTGGGTGGG + Intronic
937761308 2:125606195-125606217 CCCCAGAGAGATACCTAAGATGG + Intergenic
938897394 2:135765772-135765794 CCCCAGATCCTGGCCTAGGATGG - Intronic
939718359 2:145614737-145614759 CCCCAGAGGTATGCTTAGTATGG - Intergenic
939741039 2:145906554-145906576 CCACAGAAGGTGGCCTAGGTGGG + Intergenic
942617512 2:177809363-177809385 CCACAGAGGGAGGGTCAGGATGG + Intronic
944310119 2:198223800-198223822 ACCCAGAGGGAGGGATAGTAGGG + Intronic
944738128 2:202586789-202586811 CCCCTTTGGGAGGCCAAGGAGGG + Intergenic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
946865611 2:224039113-224039135 CCCCAGGGGGCGGCCGCGGAGGG + Intronic
947204112 2:227644621-227644643 CCCAAGCGGAAGGCCCAGGATGG + Intergenic
948033179 2:234836413-234836435 CCACAGAGTGAGTCCTGGGAAGG + Intergenic
949045737 2:241871958-241871980 CACCCCAGGGAGGCCTATGAGGG + Exonic
1170418344 20:16168420-16168442 ATCCAGTGGGAGGCCAAGGAGGG - Intergenic
1172223462 20:33289088-33289110 CCCCAGAGCAAGGCCAGGGACGG + Intronic
1172624762 20:36340712-36340734 TGCCAGAGGGAGGCCTAGTCTGG - Intronic
1172836861 20:37878697-37878719 CCCAAGAGTGAGGCAGAGGACGG + Intergenic
1173413886 20:42838853-42838875 CCCCAGAGGTTCCCCTAGGAAGG - Intronic
1174165753 20:48582492-48582514 CCCAGGAGGGAAGCCTGGGAGGG + Intergenic
1175174793 20:57104718-57104740 CCCAAGTGGGAGTCCCAGGAGGG - Intergenic
1175216309 20:57393130-57393152 CACAAGGGGGAGGCCTGGGAGGG + Intronic
1175525305 20:59629538-59629560 CCACAGAGAGAGTCCTGGGACGG - Intronic
1175814077 20:61874527-61874549 CCCCAGAGGGAGGCCCTGGGCGG + Intronic
1175940358 20:62535023-62535045 CCCCAGGCGGAGGCTCAGGACGG + Intergenic
1176021611 20:62965109-62965131 CTACAGGGGGAGGCCAAGGAAGG - Intronic
1176413065 21:6459184-6459206 CCCTAGAGGGGGGCAGAGGAGGG + Intergenic
1177262557 21:18749834-18749856 CACAGGAGGGAGGCCAAGGAGGG + Intergenic
1177411266 21:20733521-20733543 CCCGAGAGAGAGGCCTCAGAAGG - Intergenic
1178414465 21:32392879-32392901 CCCAAGAGGAAGGCCTCGGGCGG - Exonic
1179147793 21:38783759-38783781 AGCCAGAGGGAGGCCTCGCAAGG + Intergenic
1179546304 21:42114526-42114548 CCCTTGAGGGAGGTGTAGGATGG + Intronic
1179593686 21:42428127-42428149 CCCCAGAGAGAGGCCTCAAAAGG + Intronic
1179688560 21:43067506-43067528 CCCTAGAGGGGGGCAGAGGAGGG + Intronic
1179811676 21:43875223-43875245 CACGGGAGGGAGGCCGAGGAGGG - Intronic
1180963432 22:19773308-19773330 CCCCAGAGGAAGGTCTAGGTGGG + Intronic
1181161843 22:20964313-20964335 TCCCAGAGGATGGCCTGGGAAGG + Intergenic
1181172655 22:21018387-21018409 ACCCAGAGGCAGGACCAGGATGG - Intronic
1181533834 22:23531679-23531701 CCCCAGGAGGAGGCAGAGGAAGG - Intergenic
1181618562 22:24071826-24071848 CCCCAGGGGGTAGCCCAGGAAGG - Intronic
1181772795 22:25138956-25138978 CCTCAGAGGGAAGACCAGGAAGG - Intronic
1182009261 22:26986684-26986706 CCCAAGAGGAAGGCCCAGCATGG + Intergenic
1182896918 22:33866683-33866705 CACCAGATGGAGCCCTAGAATGG + Intronic
1182912682 22:33999249-33999271 CCCCAGATCAAGGCCTAGCATGG - Intergenic
1183380995 22:37490475-37490497 CCCAAGAGGGAGGCATAGGCAGG + Exonic
1184045212 22:41968973-41968995 CCTCAGGGGCAGGCCTAGGGCGG + Intergenic
1184484275 22:44766660-44766682 CCCCAGAGAGAGCCCCCGGAAGG - Intronic
1184489911 22:44802530-44802552 TCCCAGAGAGAGGCCCAGGGAGG - Intronic
1184557839 22:45242599-45242621 CCCCAGTGCCAGGCCCAGGAGGG + Intergenic
1184767990 22:46581976-46581998 TCCCACAGGGAGGCCCAGGTGGG + Intronic
1184956678 22:47891790-47891812 CCTCTGAGGAAGGCCTATGAAGG - Intergenic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
950267273 3:11583694-11583716 TCCCAGAGGCAGGCCTGGAATGG - Intronic
952126428 3:30305971-30305993 TTCCAGAGGGAAGCCTGGGAGGG - Intergenic
954381484 3:50221327-50221349 GCCCTGAGGGAGCCCCAGGAAGG + Intergenic
960662736 3:120078796-120078818 TCCCAGAGGGAGGCTGAGGCTGG - Intronic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
961464549 3:127073305-127073327 CAGGAGAGGAAGGCCTAGGAGGG - Intergenic
961537184 3:127577285-127577307 CCCGAGAGGGAGGGCCAGGCTGG - Intronic
961756218 3:129128673-129128695 ACACAGCGGGAGGCCTGGGATGG - Intronic
964104750 3:153027167-153027189 TCCCAGTGGGAGGCCAAGGCAGG + Intergenic
964927313 3:161975127-161975149 CTCAGGAGGGAGGCCAAGGAGGG - Intergenic
965560782 3:170060514-170060536 CCACTTTGGGAGGCCTAGGAGGG + Intronic
965646510 3:170887638-170887660 ACCCAGAGGGAGGCATAGGAGGG - Intergenic
966880369 3:184346581-184346603 CCCTCGTGGGTGGCCTAGGATGG - Exonic
967952683 3:194853102-194853124 CCCCAAAGGGAAGCCCAGCAAGG + Intergenic
967970439 3:194995095-194995117 CCACAAAGGGAGCCCTAGGAAGG - Intergenic
968007164 3:195251006-195251028 CGACAGAGGGAAGCCTAGGTTGG - Intronic
968597978 4:1495133-1495155 CCCCAATGGGAGGCCCAGCACGG + Intergenic
968842025 4:3014545-3014567 CCACTTAGGGAGGCCAAGGAGGG + Intronic
969670643 4:8588230-8588252 CCAGAGAGGGTGGCCTGGGATGG + Intronic
969691501 4:8706520-8706542 GACTGGAGGGAGGCCTAGGATGG + Intergenic
970740840 4:19235786-19235808 CCCCAGAGCAAGGCATAGTAAGG - Intergenic
972995077 4:44869866-44869888 CACCAGAGGGAGGCCTGGTTGGG - Intergenic
974064949 4:57069098-57069120 CCCTAGAAGGAGGCCTGGGAGGG - Intronic
976154251 4:82125626-82125648 CACCACAGGGAGGCCAAGGTAGG - Intergenic
981426720 4:144611906-144611928 ACACAGAGAGAGGACTAGGATGG - Intergenic
983650414 4:170031411-170031433 TCTCAGAGGGAGGTCTAGGAAGG - Intronic
984016167 4:174429318-174429340 ACTCAAAGGGAGGCCTAGGTGGG + Intergenic
984922978 4:184782039-184782061 CCCCATAGGCAGGGCCAGGATGG - Intronic
985705835 5:1400879-1400901 CCCCCGAGAGAGGCCCAGCAGGG + Intronic
985839969 5:2298748-2298770 CCCCAGAGGGTGGACAAGGCAGG + Intergenic
985942655 5:3150893-3150915 CCCCACAGGGAGGCCAGGGCAGG + Intergenic
987369820 5:17182695-17182717 CCCCAGAGGCTGGCCTGGGCAGG + Intronic
987543579 5:19285211-19285233 GCACACTGGGAGGCCTAGGAGGG + Intergenic
989197839 5:38733347-38733369 CCCCAGAGGAAAGCCCTGGATGG - Intergenic
992762389 5:79962212-79962234 CCCCAGAGTGGGCCCAAGGAAGG - Intergenic
992913738 5:81425918-81425940 TCACAGAAGGAGGCCTGGGAAGG - Intronic
993195270 5:84733927-84733949 CCACATTGGGAGGCCTAGGCGGG - Intergenic
996222425 5:120950034-120950056 CCCTAGATGGTGCCCTAGGAGGG - Intergenic
997436985 5:133882637-133882659 CTCCAGTGGGAGGCCAAGGCAGG + Intergenic
999579623 5:153022491-153022513 TCCCAGTGGGAGGCCAAGGCAGG + Intergenic
1002048160 5:176553606-176553628 CCTCAGAGGGATGCCTGGGCTGG + Intronic
1002374020 5:178775435-178775457 GCCCAGAGGCAGGCCTGGCATGG + Intergenic
1003092309 6:3114536-3114558 CCCCAGAGGGAGGGCGAGAAGGG + Exonic
1004340642 6:14804762-14804784 CCCCTGAGGCGGGCCTAGGCCGG - Intergenic
1004517433 6:16332286-16332308 CACCAGAGGGCGCCCCAGGATGG + Intronic
1006891849 6:37435458-37435480 CCTCAGAATGAGGTCTAGGAAGG - Intronic
1007255151 6:40523247-40523269 CTCCAGAAGGAGGACAAGGAGGG - Intronic
1007746344 6:44045827-44045849 GGCCAGAGGCAGGCCTGGGAGGG - Intergenic
1009770419 6:68137519-68137541 CCCCTGAGGGAGGACTGTGAAGG + Intergenic
1009945959 6:70341866-70341888 CAGCAGCTGGAGGCCTAGGAGGG - Intergenic
1011369051 6:86612710-86612732 GCCCAGAGGGAGGGCAAGGTTGG - Intergenic
1011661487 6:89598380-89598402 CCACAGAGGGAAGGTTAGGAAGG + Intronic
1012728620 6:102850077-102850099 CACTAGAGGGAGGCCTAGGCGGG + Intergenic
1012889889 6:104885807-104885829 CACAAGAGGGAGGCCAAGGTGGG + Intergenic
1015110753 6:129589049-129589071 TCACAGAGGGAGGGCTAGGAGGG - Intronic
1016270290 6:142280827-142280849 CCCCTGTGGGAGGCCGAGGTGGG + Intergenic
1016271693 6:142297456-142297478 CCTCAGATAGAGGCCCAGGAAGG + Intergenic
1018172316 6:161152549-161152571 CCCCAGATGCAGGCCTGGGGAGG + Intronic
1018628889 6:165805356-165805378 CCCCGGAGGGAGGCGGAAGAAGG + Intronic
1018969369 6:168515620-168515642 CCTCAGGGCGAGGCCTAGGAAGG - Intronic
1019188475 6:170235851-170235873 CCCCAGATGGAGGCCCAGGTCGG + Intergenic
1019335646 7:481309-481331 CTCCAGAGGAAGGCCGAGGTGGG + Intergenic
1019346395 7:532924-532946 CCCCTCAGGCAGGCCTGGGAAGG - Intergenic
1019524090 7:1472963-1472985 CCCCATCGGGACGCCTCGGACGG + Intronic
1019793569 7:3033334-3033356 CCGCAGAGAGAGGCCTCAGAAGG + Intronic
1020083435 7:5298211-5298233 ACCCAGAGAGGGGCCCAGGATGG + Intronic
1020086698 7:5314326-5314348 CCGCCGAAGGAGGCCTAAGAAGG - Intronic
1021623112 7:22566862-22566884 CCCCAGGGGGAATCCTGGGATGG - Intronic
1022101000 7:27169181-27169203 CTCCAGTGGGAGGCTCAGGATGG + Intronic
1022182344 7:27933429-27933451 TCCCAAAGGAGGGCCTAGGAAGG - Intronic
1023454983 7:40328878-40328900 CCCAAGGTGGAGGCCTAGGTGGG + Intronic
1024109945 7:46134617-46134639 ACCCAGAGTGTGGTCTAGGAGGG + Intergenic
1024928304 7:54641563-54641585 CACCAGTGGGAGGCATTGGAGGG - Intergenic
1025210846 7:57018986-57019008 ACCCAGAGAGGGGCCCAGGATGG - Intergenic
1025661109 7:63557861-63557883 ACCCAGAGAGGGGCCCAGGATGG + Intergenic
1026392071 7:69912038-69912060 CACAAGAGGGAGGCCAAGGTAGG - Intronic
1026797983 7:73378017-73378039 CCCCGGAGGGGGGCGCAGGATGG - Intergenic
1027111131 7:75440827-75440849 CCAAAGAAGGAGGCCTATGAAGG + Intronic
1027283373 7:76625395-76625417 CCAAAGAAGGAGGCCTATGAAGG + Intronic
1027352997 7:77330655-77330677 CCCCAGATTGAGGCTTAGCAGGG + Intronic
1030754284 7:113269254-113269276 TCCCAGAGGGAGGACCAAGATGG - Intergenic
1030929468 7:115504300-115504322 CCCTAGAGGAATGCTTAGGAAGG - Intergenic
1032159594 7:129500545-129500567 TCCCAGTGGGAGGCCGAGGCAGG + Intergenic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032803300 7:135333683-135333705 CCCCAGAGGAAGTCACAGGATGG + Intergenic
1033285319 7:140036188-140036210 CCCCAGGGTGTGGCCTAGGTTGG + Intronic
1033786430 7:144737002-144737024 GACCAGAGGGAGGCAAAGGAGGG + Intronic
1034319313 7:150164958-150164980 CCACAGAGGGGGCCCCAGGAGGG - Intergenic
1037588474 8:20294446-20294468 CCCCTGAAGGAGGCCTGGGAAGG - Intronic
1037754406 8:21701915-21701937 CCACAGTGGGAGTCCTGGGAAGG + Intronic
1037798866 8:22020202-22020224 GCACTGTGGGAGGCCTAGGAGGG + Intergenic
1037819789 8:22130090-22130112 CCCCAGAGAGAGGCAAGGGAGGG + Intronic
1037910713 8:22742079-22742101 CCTCAGAGGAAGGCCTCTGAAGG - Intronic
1037951279 8:23019888-23019910 CCCCAGAGGGAGGAGCAGGCAGG + Intronic
1038758396 8:30363199-30363221 CCAAGGAGGGAGGCCAAGGAGGG + Intergenic
1039407646 8:37326800-37326822 CCCCAGAGGGAGGCCAACCCTGG + Intergenic
1040481602 8:47832132-47832154 CTCCAGAGGGAGGCCCAGGGAGG + Intronic
1040582037 8:48705952-48705974 CCGCAGAGGGATGCTGAGGAAGG + Intergenic
1041545850 8:59041316-59041338 CCCCTGAGTGAGGCTCAGGATGG - Intronic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1042752628 8:72174812-72174834 GCCCTGTGGGAGGCCAAGGAGGG - Intergenic
1042950944 8:74200214-74200236 CCCAGGAGAGAGGCCTGGGATGG - Intergenic
1043078613 8:75735509-75735531 CCTAAGAGGGAGGTCTAGGCAGG + Intergenic
1044210321 8:89542537-89542559 TCCCAGTGGGAGGCCGAGGCAGG + Intergenic
1047027165 8:120836490-120836512 CCCCATAAGGAGGCCTATGAGGG + Intergenic
1047498806 8:125427259-125427281 GCCCAGTGGGAGGCCCGGGAGGG - Intergenic
1048455627 8:134575674-134575696 CTCCAGAGGCAGGCCCAGGCTGG - Intronic
1048677902 8:136805356-136805378 CTCCCTAGGGAGGCCCAGGAAGG - Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049303412 8:141883813-141883835 GCCCAGTGGGAGGCTTGGGAGGG - Intergenic
1049423865 8:142528666-142528688 CCCCAAGGGTGGGCCTAGGAGGG - Intronic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1056236936 9:84604043-84604065 CCACAGTGGGAGGCCGAGGCAGG - Intergenic
1057008463 9:91581353-91581375 CTCAACAGGGAGGCCGAGGAGGG - Intronic
1057228416 9:93304512-93304534 CCCCACAGGGAGACCGAGGTGGG + Intronic
1057747569 9:97764110-97764132 CCCCAGGGGGTAGCTTAGGAAGG + Intergenic
1058573925 9:106379750-106379772 CCAAAAAGGGAGACCTAGGAAGG - Intergenic
1059437016 9:114283055-114283077 CCCCAGGGGGAAGCCAGGGAAGG + Intronic
1059733651 9:117080774-117080796 CCACAGACAGAAGCCTAGGAAGG + Intronic
1060362892 9:122977454-122977476 CCCAACAGGGAGGCCAAGGCGGG + Intronic
1061215865 9:129221800-129221822 CCACCTTGGGAGGCCTAGGAGGG - Intergenic
1061246632 9:129404161-129404183 CCCCAGGAGGAGGCAGAGGAAGG + Intergenic
1061296062 9:129677459-129677481 CCTCTGGGGGAGGCCCAGGAGGG + Intronic
1061599820 9:131660735-131660757 CCCCAGAGTGGGGCCCTGGATGG + Intronic
1061805352 9:133134680-133134702 CCCCTGTAGGAGGCCTAGGCTGG + Intronic
1061959876 9:133982474-133982496 CCCCAAGAGGGGGCCTAGGATGG + Intronic
1062025441 9:134338200-134338222 AGCCAGAGGGAGGCCCAGGGAGG - Intronic
1062050244 9:134443372-134443394 GCCCAAAGGGAGGCCAAGGCAGG + Intergenic
1062076392 9:134592297-134592319 CCGCAGAGAGAGGCCGAGGCTGG - Intergenic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062401952 9:136376679-136376701 CACCAGAGGGATGGCTTGGATGG - Intronic
1062526842 9:136981333-136981355 CCCAGGAGGGAGGCCTAGGCTGG + Intronic
1062656732 9:137607455-137607477 ACGCGGAGGGAGGCCTGGGAGGG + Intronic
1185709993 X:2296333-2296355 CCCCAGAGGGAGGGGAGGGAAGG + Intronic
1185872494 X:3675576-3675598 CCCCAGTGGGAGGAAGAGGAGGG - Intronic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186434691 X:9532676-9532698 CCCAGGAGAGAGGCCTAGGGAGG - Intronic
1186806240 X:13143047-13143069 GCCCAGAGGGAGGCTGAGAAGGG + Intergenic
1188543009 X:31270314-31270336 CCCCAGAGGGTGGCTTTGGCTGG - Intronic
1190287643 X:48971593-48971615 CCCTGGAAGGAGGCCTGGGAAGG + Intergenic
1190466111 X:50726477-50726499 CACAAGCTGGAGGCCTAGGAGGG + Intronic
1193378327 X:80788184-80788206 TCCCAGGGGGAGGCCGAGGCAGG + Intronic
1196786511 X:119425825-119425847 CCCTAGAGGGAAGGCAAGGAAGG + Intronic
1199691187 X:150310187-150310209 GCCCTTAGGGAGGCCTAGTACGG + Intergenic
1200791421 Y:7303126-7303148 CCCCAGTGGGAGGAAGAGGAGGG + Intergenic
1201651116 Y:16288179-16288201 TCCCAGCAGGAGGCTTAGGAGGG + Intergenic