ID: 946374144

View in Genome Browser
Species Human (GRCh38)
Location 2:219298010-219298032
Sequence TCTGGTGGCCCTGGCAGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 407}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946374144_946374149 -1 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374149 2:219298032-219298054 AGTGAGCAGCACTGAGCGCATGG 0: 1
1: 0
2: 1
3: 9
4: 194
946374144_946374154 24 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374154 2:219298057-219298079 GAGGTGCTGTGCGCAGTTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 173
946374144_946374151 5 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374151 2:219298038-219298060 CAGCACTGAGCGCATGGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 194
946374144_946374153 23 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374153 2:219298056-219298078 TGAGGTGCTGTGCGCAGTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 141
946374144_946374152 22 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374152 2:219298055-219298077 GTGAGGTGCTGTGCGCAGTTTGG 0: 1
1: 0
2: 1
3: 11
4: 130
946374144_946374150 0 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374150 2:219298033-219298055 GTGAGCAGCACTGAGCGCATGGG 0: 1
1: 0
2: 0
3: 11
4: 122
946374144_946374155 28 Left 946374144 2:219298010-219298032 CCACACCTGCCAGGGCCACCAGA 0: 1
1: 0
2: 7
3: 42
4: 407
Right 946374155 2:219298061-219298083 TGCTGTGCGCAGTTTGGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946374144 Original CRISPR TCTGGTGGCCCTGGCAGGTG TGG (reversed) Exonic
900309087 1:2024799-2024821 TGTGGGAGCCCTTGCAGGTGGGG - Intronic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
901060234 1:6468436-6468458 ACTGGTGGGCGTGGCAGATGAGG + Exonic
901232057 1:7646821-7646843 GGTGGAGGCCCTGGCAAGTGTGG + Intronic
901271371 1:7954361-7954383 TCTGGTGGCCCACGCTGGGGGGG + Intronic
901664643 1:10819459-10819481 TCTGGGGACCCAGCCAGGTGTGG + Intergenic
901936302 1:12629550-12629572 GTTGGTGGCCTTGGCAGGTTGGG + Intergenic
902410528 1:16209002-16209024 CCAGGTGGCCCAGTCAGGTGGGG + Exonic
903472800 1:23598941-23598963 ACTGGAGGCCCTGCCAGGTCAGG - Intronic
903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG + Exonic
903929800 1:26855603-26855625 TGCAGTGGCCCTGGGAGGTGAGG + Exonic
904212821 1:28897134-28897156 TGTGGTGACCCTGGTAGGTCTGG + Intronic
904253639 1:29240951-29240973 CGTGGTGGCCCTGGCAGATGGGG + Intronic
904385868 1:30141732-30141754 TCAGGTGGCCCTGGCTGATGGGG - Intergenic
904432733 1:30475521-30475543 TGTGGTGCTCCTGGAAGGTGGGG - Intergenic
904597386 1:31655420-31655442 CCTGGTGGACCTGGCAAGAGTGG - Exonic
904906819 1:33903664-33903686 TCTGCTGGCAATGGCAGGGGAGG + Intronic
905446976 1:38033987-38034009 TCTGGTGGCCCTGAGAGTTTGGG + Intergenic
906149844 1:43581303-43581325 TTTGGAGTCCCTGGCAAGTGGGG - Intronic
906709868 1:47921319-47921341 GCTGCTGGCCCTGGCAGCGGAGG - Intronic
907246947 1:53114690-53114712 TCTGGGGGACCTGGCAGGGCAGG + Intronic
908494029 1:64676898-64676920 CCTGGTGGACCTCGCAGCTGGGG - Exonic
911185686 1:94902120-94902142 TCTGGTGGCTCTAGCAGGTCTGG - Exonic
911741773 1:101394370-101394392 TCTGGTGGCCAGAGCAGCTGAGG - Intergenic
912550706 1:110483593-110483615 TCTTTTTGCCCTGGCAGGGGTGG + Intergenic
912649282 1:111423792-111423814 TGTGGTGGGCCTGGCAGATGTGG + Intronic
912796485 1:112696518-112696540 TCTGGTAGCTATAGCAGGTGAGG + Exonic
912961650 1:114201396-114201418 TCTAGTGCCCATGGCAGTTGGGG - Intergenic
913325757 1:117627103-117627125 CCTGGGGGACCTGGCAGATGGGG + Exonic
914005956 1:143732389-143732411 TCTTGTGGCCCTGGGGGTTGGGG + Intergenic
914098425 1:144563622-144563644 TCTTGTGGCCCTGGGGGTTGGGG + Intergenic
914249471 1:145909957-145909979 CCTGGTGTTCCTGACAGGTGAGG - Exonic
914300557 1:146374020-146374042 TCTTGTGGCCCTGGGGGTTGGGG - Intergenic
916723320 1:167501735-167501757 TCTGGTCTCCTTGGCTGGTGAGG - Intronic
918010579 1:180582925-180582947 TGTGGTGGTGCTGGGAGGTGTGG + Intergenic
922255917 1:223892827-223892849 TTGGGAGGCCCAGGCAGGTGTGG - Intergenic
922388013 1:225107644-225107666 TCCGGTATCCATGGCAGGTGGGG - Intronic
922506527 1:226129234-226129256 GATGGTGGCATTGGCAGGTGGGG + Intergenic
924463714 1:244282149-244282171 TCTGTGGGGCTTGGCAGGTGTGG - Intergenic
924707185 1:246510516-246510538 TCCGGAGACCCAGGCAGGTGGGG - Intergenic
924755004 1:246932363-246932385 TCGTGTGGCCCTGCCAGCTGGGG + Intergenic
924772231 1:247088328-247088350 TCTGGTGGGCAGGGTAGGTGGGG - Intergenic
1063663395 10:8048616-8048638 CCTCCTGGCCTTGGCAGGTGGGG - Intergenic
1064036910 10:11921416-11921438 ACAGGTGGCCCTGGCATCTGCGG + Intronic
1066110030 10:32187694-32187716 GCTGGTATCCGTGGCAGGTGGGG - Intergenic
1067355756 10:45524471-45524493 TCTTGTGGCCCTTGCAGGTAAGG + Intronic
1067578807 10:47426168-47426190 TCGGGTGGCCCTGCCCAGTGAGG - Intergenic
1069426123 10:68290141-68290163 TCTGCTGGGCCTGGCAGCTGGGG - Intronic
1069455001 10:68547062-68547084 TCTTGTTGCCCAGGCAGGAGTGG - Intergenic
1071451134 10:85792190-85792212 TCTGGTGGCACTGGCAGTTGAGG - Intronic
1072378384 10:94840326-94840348 ACTTGGGGCCCTGGCAAGTGTGG + Intronic
1072537044 10:96371708-96371730 TCACGGGGCCCAGGCAGGTGGGG - Intronic
1072631604 10:97150591-97150613 TCTGCTGGGCCTGGAAGGGGTGG - Intronic
1073350068 10:102813239-102813261 GCGGGCGGCCGTGGCAGGTGCGG - Exonic
1074581663 10:114724867-114724889 TCTGGTGGCTCTGCCTGGTGTGG - Intergenic
1076132929 10:128026195-128026217 TCTGGTTGGCCAGCCAGGTGCGG + Intronic
1076445130 10:130509238-130509260 TCAGGAAGCTCTGGCAGGTGTGG + Intergenic
1076763207 10:132615945-132615967 CCTGGTGGGCCTGGCACCTGAGG + Intronic
1077050796 11:565903-565925 CCTGGTGGCCCTGGCTTCTGGGG - Intergenic
1077407983 11:2391165-2391187 CCTGGTGCCCCTGGCAGGGCTGG + Intronic
1077499184 11:2901656-2901678 TCTGGTGGCCCCTGCAAGGGTGG + Intronic
1077543745 11:3159916-3159938 TCTGCTGACCCTGGCACCTGGGG + Intronic
1077901664 11:6494978-6495000 TCTGGTGGCTCTAGGGGGTGGGG - Intronic
1078236132 11:9486527-9486549 GCTGCTGGCCTTGGCAGATGAGG - Intronic
1079136770 11:17779845-17779867 ACTTGAGGCCCTGGCAGCTGTGG + Intronic
1079791671 11:24747437-24747459 TCTGGTGGAGGTGGCAGTTGGGG + Intronic
1081553713 11:44138131-44138153 TCTGGTGGCACAGGCACGGGAGG + Intronic
1081910203 11:46695532-46695554 CCTGGTGCTCCTGGCATGTGGGG - Intronic
1082263162 11:50093044-50093066 ACTGGGGGCCAAGGCAGGTGGGG + Intergenic
1082758261 11:57099814-57099836 TCTGGTGGCTGTGGGAAGTGTGG - Intergenic
1083338742 11:61945025-61945047 TCTGGTAGCCCTAGCATGGGTGG + Intergenic
1083625249 11:64069038-64069060 TCCGGGGGCAGTGGCAGGTGGGG + Intronic
1083856548 11:65395999-65396021 TCTGTGTGCCCTCGCAGGTGGGG + Intronic
1083891761 11:65599191-65599213 TCAGGTGGTCCAGGCAGGTGGGG - Intronic
1083897727 11:65628578-65628600 CCTGTTGGCCCTGCCAGCTGTGG + Exonic
1084646829 11:70463774-70463796 TGTGGATGCGCTGGCAGGTGTGG + Intergenic
1084914872 11:72421202-72421224 GCTGGTATCCATGGCAGGTGGGG + Intronic
1085504920 11:77052977-77052999 TCAGTTGGCTCTGGCAGGGGTGG + Intergenic
1087192989 11:95275374-95275396 TTTGATGGGCCTGGAAGGTGAGG + Intergenic
1087305403 11:96483777-96483799 TCTGGTGGCCATGTCATCTGTGG + Intronic
1087779831 11:102290466-102290488 GATGGAGGCACTGGCAGGTGTGG + Intergenic
1087906382 11:103702827-103702849 TCTGGTGATCCTAGCAGGGGTGG + Intergenic
1088329380 11:108634332-108634354 TCTGGTGGCTCTGGAAGGTGTGG - Intergenic
1088647196 11:111926816-111926838 ACTGTTGGCTCTCGCAGGTGCGG + Exonic
1090868199 11:130720657-130720679 TATGGTATCCCAGGCAGGTGAGG + Intergenic
1091289766 11:134431895-134431917 TGTGGTGGTCTTGGGAGGTGGGG + Intergenic
1091667836 12:2431952-2431974 TCTGGTGACCTTGGCAGGGTTGG - Intronic
1093991466 12:25593310-25593332 TCTGGTGGAGGTGGCAGGGGAGG - Intronic
1095604669 12:44052669-44052691 ACTGCTGGCCCTGTCAAGTGTGG + Intronic
1096529528 12:52234155-52234177 GCTGGAGGACCAGGCAGGTGGGG - Intronic
1096536805 12:52280045-52280067 ACAGGTGGCCCTTGCAGATGGGG + Intronic
1096607436 12:52776870-52776892 TTTGGTGGGCCTGGCAGCTTTGG - Exonic
1096610115 12:52795576-52795598 TTTGGTGGGCCTGGCAGCTTGGG - Exonic
1096676226 12:53227534-53227556 ATTGGTGGCCATGGCAGCTGCGG + Exonic
1097240077 12:57569118-57569140 TATGGTGGCATTAGCAGGTGGGG - Intronic
1097278193 12:57827305-57827327 GGTGGTGGCCAGGGCAGGTGTGG + Intronic
1098342891 12:69470305-69470327 CCTGGAGGCCCTGGCAGCTCCGG + Intergenic
1098531401 12:71546005-71546027 TTTGGTGGCAGGGGCAGGTGGGG + Intronic
1100318177 12:93464994-93465016 TCTGGCTGCCCTGGGAGGAGTGG - Intergenic
1101236617 12:102796082-102796104 TCTGGAGGATCTGGAAGGTGAGG + Intergenic
1102039585 12:109792325-109792347 TCAGGTGGTCCTGGCAGGGGTGG - Intronic
1102259564 12:111435966-111435988 TCTGGTGGCCCTGCCGTGTATGG + Intronic
1103746898 12:123130977-123130999 TCTGGTGCCCTAGGCATGTGAGG - Intronic
1103925946 12:124423406-124423428 TCTGGAGGGCCAGGCAGGTCGGG - Intronic
1104494175 12:129221189-129221211 CTTGGTGGCCGTGTCAGGTGAGG - Intronic
1104733506 12:131122073-131122095 TCTGAGGGCCCTGGCTGGTTGGG + Intronic
1104980869 12:132572625-132572647 ACCGCTGCCCCTGGCAGGTGGGG + Intronic
1105071382 12:133236022-133236044 TCTGGTGTCCGTGGCATCTGCGG + Exonic
1105239565 13:18597844-18597866 GCTGGTGGCACTGGCAGGGTCGG + Intergenic
1106593980 13:31121445-31121467 CCTCGTGGCCCTGGAAGGTCTGG - Intergenic
1106677512 13:31976620-31976642 CATGGTGGCCCTGGAAGGAGAGG - Intergenic
1108543935 13:51472159-51472181 TCTGGTTGCCCAGGCAGAAGTGG + Intergenic
1111046674 13:82823091-82823113 GCTGGTGGCCGGGGCAGCTGCGG - Intergenic
1113279890 13:108777683-108777705 AGTGGTGGCTCTGGCAGTTGAGG - Intronic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114007815 14:18333107-18333129 GCTGGTGGCGCTGGCAGGGTCGG - Intergenic
1115990613 14:39146029-39146051 TCAGCTGGACCTGGGAGGTGGGG - Intergenic
1118747739 14:68786077-68786099 ACTGGAGGCCCTGGAGGGTGGGG - Intergenic
1120190901 14:81438204-81438226 TCTGGTGTTCCTCCCAGGTGAGG - Intergenic
1120624430 14:86807219-86807241 GGTCGAGGCCCTGGCAGGTGAGG + Intergenic
1121013550 14:90535235-90535257 GCTGGGGGCCTGGGCAGGTGTGG - Exonic
1122482199 14:102054500-102054522 TTGGGTGGCCCTGGCGGTTGGGG - Intergenic
1122494040 14:102139590-102139612 TCCGCTGGCCCTGGCGGCTGCGG + Exonic
1122548654 14:102538620-102538642 ACTGGTGGCCCAGGCAGCTGGGG - Intergenic
1122797418 14:104212924-104212946 TCCAGAGGCCCAGGCAGGTGAGG + Intergenic
1122868056 14:104618380-104618402 TCTGGTGGTCCTGGGAGGAGTGG - Intergenic
1122971403 14:105153716-105153738 TCTGGGGGGCCTGGTGGGTGGGG - Intronic
1123491682 15:20786240-20786262 GCTGGTGGCACTGGCAGGGTCGG - Intergenic
1123548184 15:21355334-21355356 GCTGGTGGCACTGGCAGGGTCGG - Intergenic
1123661893 15:22571855-22571877 TCTGGTTGCTCTGGCAGGCCGGG + Intergenic
1123920974 15:25069548-25069570 TCTGGCTGCCCTCTCAGGTGAGG - Intergenic
1123995029 15:25712420-25712442 TGGAGTGGCCCTGGCATGTGGGG - Intronic
1124315692 15:28666098-28666120 TCTGGTTGCTCTGGCAGGCCGGG + Intergenic
1125504225 15:40257726-40257748 TCTGGTGGCCCTGGCATCCCAGG + Intronic
1125815241 15:42578341-42578363 TTGGGAGGCCATGGCAGGTGAGG - Intronic
1126626225 15:50688042-50688064 TCTGCTGGACCTGCCAGATGGGG - Intergenic
1127393976 15:58528908-58528930 CCTGGGTGCCCTGGCAGGTAGGG - Intronic
1128679421 15:69637153-69637175 TCAGGTGGACTTGGCGGGTGAGG - Intergenic
1128926523 15:71661173-71661195 TCTGCTGCCCCAGGCAGATGAGG - Intronic
1129167542 15:73787292-73787314 TCAGGGGGGCCTGGGAGGTGAGG + Intergenic
1129182593 15:73886596-73886618 TCTGGAGGCTCTGGGAGGTGAGG + Exonic
1129229534 15:74189109-74189131 TCTGTGGGCTCTGGAAGGTGAGG - Exonic
1132044762 15:98554298-98554320 TCTTGTTGCACTGCCAGGTGTGG + Intergenic
1132069961 15:98767769-98767791 TATGGTGTCCCTGGCAGGATAGG + Intronic
1202956516 15_KI270727v1_random:82564-82586 GCTGGTGGCACTGGCAGGGTCGG - Intergenic
1133154565 16:3863942-3863964 TCTGGTGCCCCTCTCAGCTGTGG - Intronic
1133287975 16:4699321-4699343 TCTGGTGGCTCAGGCAGGGCAGG + Intronic
1133839680 16:9396205-9396227 TCAGGTGTTCCTGGCAGGTGGGG - Intergenic
1134050134 16:11131585-11131607 TCTCCTGGCCCTTGCAGATGAGG + Intronic
1134251597 16:12578084-12578106 ACTGGTGTCCCTGCCAGGAGGGG + Intergenic
1135609933 16:23857522-23857544 TCTGGTGTGCCTGATAGGTGGGG + Intronic
1136394907 16:29987449-29987471 TCTGGTGGCTATGGCAGCGGGGG + Exonic
1136469802 16:30472672-30472694 GCTGGTGACACTGGCAGGCGGGG - Exonic
1136717086 16:32289633-32289655 AGTGGTGGCCGTGGCACGTGTGG + Intergenic
1136835460 16:33495887-33495909 AGTGGTGGCCGTGGCACGTGTGG + Intergenic
1137001750 16:35235252-35235274 CCAGGTGGCCCTCACAGGTGGGG + Intergenic
1138019950 16:53469955-53469977 TCTGGTAGTGCTGGCTGGTGGGG - Exonic
1138190267 16:55008923-55008945 GCAGGTGGGCCTGGCAGCTGAGG + Intergenic
1138447964 16:57076670-57076692 TCTGGGGGTCATGGCAGGTGGGG - Intronic
1138536044 16:57660790-57660812 GCTGGTGGCCCTGGTGGATGTGG + Exonic
1139377458 16:66509088-66509110 GCTAGAGGCCCTGGGAGGTGGGG - Exonic
1139594618 16:67950488-67950510 TCTGGTGGCCCCTGCAGGTATGG - Exonic
1140254357 16:73322155-73322177 GCTGGTGGACCAGGCAGGTCAGG - Intergenic
1141461319 16:84180164-84180186 GCTGCTGCACCTGGCAGGTGAGG - Exonic
1142264083 16:89055586-89055608 ACTGGAGGCCCTGGCTGGGGAGG - Intergenic
1203009343 16_KI270728v1_random:228145-228167 AGTGGTGGCCGTGGCACGTGTGG - Intergenic
1203145637 16_KI270728v1_random:1796200-1796222 AGTGGTGGCCGTGGCACGTGTGG + Intergenic
1142594109 17:1021250-1021272 TCTTGGGGCCCTGGCAAATGTGG - Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143604426 17:7973748-7973770 TCTGGTTGCCCAGGCTGGAGTGG - Intergenic
1144539039 17:16121057-16121079 TCTGGTGGCGGTGGCAGAGGTGG + Exonic
1144593658 17:16546485-16546507 GCTGGTATCCGTGGCAGGTGGGG + Intergenic
1144835162 17:18153019-18153041 TTTAGTGCCCATGGCAGGTGTGG - Intronic
1145328228 17:21849303-21849325 GCTGGCAGCCATGGCAGGTGAGG + Intergenic
1145415163 17:22708593-22708615 GCTGGCAGCCATGGCAGGTGAGG + Intergenic
1145899143 17:28478671-28478693 TCTGGTGGTCCCAGCAGATGGGG + Intronic
1145976206 17:28985883-28985905 CCAGGTGGGCCTGGCAAGTGGGG - Intronic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147303938 17:39550358-39550380 TTTGGAGGTCCTGGCAGTTGGGG - Intronic
1147537110 17:41328164-41328186 TCTAGAGACCCAGGCAGGTGGGG + Intergenic
1147910774 17:43854651-43854673 GCTGGTGTCACTGGCATGTGGGG - Intronic
1148014562 17:44512058-44512080 GCTGGTATCCCTGGCAGGTAGGG + Intergenic
1148091129 17:45023080-45023102 TCTGCAGGCCCTGGCAGGGAAGG + Intergenic
1148551311 17:48552172-48552194 GCTAGTGGCACTGGTAGGTGCGG + Exonic
1148597987 17:48872166-48872188 TCTGGACCCACTGGCAGGTGAGG - Intergenic
1149660329 17:58331415-58331437 TCGGGGGGCCCTGGCAGGGTTGG - Intergenic
1150540826 17:66097174-66097196 TCTGGTGTCCTTGGAATGTGGGG - Intronic
1151321078 17:73352653-73352675 GATGGAGGCCCTGGGAGGTGAGG + Intronic
1153764498 18:8362544-8362566 TCTTGAGGCTCTGGCAGGTGGGG - Intronic
1153931786 18:9885585-9885607 GCTGGTGCGCCTGGGAGGTGGGG + Intergenic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1156374201 18:36499186-36499208 TCTCGTGAACCTGGGAGGTGGGG - Intronic
1157827468 18:50825037-50825059 TCTTGTGGCCCAGGCTGGAGTGG - Intronic
1160106496 18:75983079-75983101 TCTGGTGAACCTGGCAGGTGGGG + Intergenic
1160217359 18:76944191-76944213 GCTGTTGGCCCTGGCAGCTGGGG - Intronic
1160353049 18:78201401-78201423 TGCGGTGGCCCTGGCAGGAATGG - Intergenic
1160726016 19:618123-618145 GGTGGTGGCCCTGGCAGGAGGGG - Intronic
1160809398 19:1006978-1007000 CCAGGTTGCCCTGGCAGCTGTGG + Intronic
1161003771 19:1924425-1924447 TTCTGTGGCCCTGGCAGGAGGGG - Exonic
1161010135 19:1955909-1955931 TGTTGTGGCCCAGGCAGGTTGGG - Intronic
1161302811 19:3551230-3551252 CCTGGGAGCCCTGGCTGGTGCGG - Intronic
1161595261 19:5148026-5148048 TCTTGGGGCCTTGGCATGTGGGG - Intronic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162189770 19:8935789-8935811 ACTGGTGGCCATTACAGGTGTGG + Exonic
1162190006 19:8937559-8937581 ACTGGTGGCCATTGAAGGTGTGG + Exonic
1162190033 19:8937727-8937749 ACTGGTGGCCATTGAAGGTGTGG + Exonic
1162190054 19:8937889-8937911 ACTGGTGGCCATTGAAGGTGTGG + Exonic
1162190077 19:8938051-8938073 ACTGGTGGCCATTGAAGGTGTGG + Exonic
1162190102 19:8938219-8938241 ACTGGTGGCCATTGAAGGTGTGG + Exonic
1163392678 19:17039762-17039784 TATTGGAGCCCTGGCAGGTGAGG - Intergenic
1163476438 19:17528728-17528750 TCTGGTGGCTCTGCTATGTGGGG + Intronic
1163535259 19:17872976-17872998 TCTGCACGCCCGGGCAGGTGGGG - Intronic
1163633256 19:18427521-18427543 TCTGATGGCCCTGGGAACTGAGG + Intronic
1163936477 19:20449196-20449218 GCTGGTGTCTCTGGCAGGGGAGG + Intergenic
1164897903 19:31893139-31893161 TCTTGTTGCCCTGGCTGGAGTGG - Intergenic
1165127527 19:33610799-33610821 TGTGGTGGCATTGGGAGGTGGGG - Intergenic
1165230040 19:34381132-34381154 TCTGGTGTCCCAGGCAGGCCTGG + Intronic
1165373970 19:35428481-35428503 TGTGGTGGCTCTGCCAGGTGTGG - Intergenic
1165520642 19:36311445-36311467 TTTGGTGGCCCCGGCGGGTTAGG - Intergenic
1165623428 19:37267139-37267161 TTTGGTGGCCCCGGCTGGTTAGG + Intergenic
1166406320 19:42524527-42524549 TATGATGGACCTGGCAGGGGTGG + Intronic
1166800882 19:45456202-45456224 TGGGGAGGCCCTGGCGGGTGAGG + Intronic
1166803613 19:45472382-45472404 CCTGGTGGCCATGGGAGTTGGGG - Intronic
1167648386 19:50717729-50717751 TGTGGTGGCCCGGGTAGATGTGG + Intronic
1168423534 19:56220686-56220708 TCTTGTTGCCCAGGCTGGTGTGG - Exonic
925013474 2:503778-503800 TCTGGTGGGGCAGGCCGGTGGGG - Intergenic
926180042 2:10634412-10634434 AATGGAGACCCTGGCAGGTGGGG + Intronic
926202052 2:10808342-10808364 ACTGGGAGCCCTGGCAGTTGTGG + Intronic
926864166 2:17340361-17340383 ACTTGGGGCCCTGGCAAGTGTGG - Intergenic
927784003 2:25959812-25959834 TCTGGGGAACCTGGCAGGAGGGG + Intronic
929339325 2:40794239-40794261 TCTGCTGGCCCTAACAGGTTAGG + Intergenic
930662089 2:54064363-54064385 TCCTCTGGCCTTGGCAGGTGTGG + Intronic
930692272 2:54376755-54376777 AGTGGTGGCCCTGGCTGTTGAGG - Intronic
933099393 2:78233001-78233023 TATGGTGGTCTTGGAAGGTGGGG - Intergenic
934896501 2:98124385-98124407 CCTGGTGGGGATGGCAGGTGGGG + Intronic
934953134 2:98592929-98592951 CCTGGGGCCCCTGGCAGGGGAGG - Intronic
937224608 2:120360986-120361008 TCTGGTGGCCCTGAGAGGACAGG - Intergenic
937354232 2:121187965-121187987 TCTGGGGGCCCAGGCAGGGCGGG + Intergenic
938193174 2:129300934-129300956 GCTGAAGGGCCTGGCAGGTGGGG + Intergenic
939087225 2:137735841-137735863 TCTGCTGCCACTGGCTGGTGGGG - Intergenic
942969792 2:181944283-181944305 TCTGGTGGTGCTGGCAGTGGTGG - Intergenic
945293233 2:208145860-208145882 ACTGGTGGCCCTGGTAGTTGGGG + Exonic
946148712 2:217749720-217749742 TCTGGTGAAGCTGGCAGGTAGGG - Intronic
946177356 2:217929700-217929722 TTTGGTGGCCGGGGCGGGTGGGG - Intronic
946193070 2:218017620-218017642 ACTCCTGGCCCTGGCACGTGTGG + Intergenic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
946417788 2:219549271-219549293 TCTGGTGGCCCAGGCCTGGGAGG - Exonic
947520871 2:230845126-230845148 TCTACTGGCACTGGCAGGTGGGG + Intergenic
947876866 2:233473556-233473578 TCTGGTGCCCCCAGCACGTGAGG - Intergenic
948059650 2:235033407-235033429 TGTGATGGCACTGGCAGGTGGGG - Intronic
948583584 2:239004446-239004468 TCTGCAGCTCCTGGCAGGTGCGG - Intergenic
948816552 2:240513260-240513282 TGTGGTGGGCCTGGCAGGGCAGG - Intronic
948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG + Intronic
948895615 2:240925554-240925576 TGTGGGGCCCATGGCAGGTGGGG + Intronic
1168799550 20:635409-635431 TTTGGTGCCCCTGGCAGGGTTGG + Intergenic
1168891927 20:1300452-1300474 TCTGGTGGCCAGGGATGGTGAGG + Intronic
1169450035 20:5702962-5702984 TCTGGTTGCCCAGGCTGGAGTGG + Intergenic
1169475593 20:5928475-5928497 GCTGGCGGCCCTCGCAGCTGCGG - Intergenic
1171207768 20:23294496-23294518 ACTGAGAGCCCTGGCAGGTGAGG - Intergenic
1171349381 20:24491019-24491041 TCTGGTTGCTGTGGCAGGTAAGG + Intronic
1171518470 20:25757953-25757975 GCTGGCAGCCATGGCAGGTGAGG + Intergenic
1171558386 20:26098254-26098276 GCTGGCAGCCATGGCAGGTGAGG - Intergenic
1172778069 20:37419762-37419784 GCTGGGGGCCCTGGGAGGGGGGG + Intergenic
1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG + Intergenic
1173313667 20:41923819-41923841 TCTGGTTGCCATGGCAGGTAAGG + Intergenic
1173364789 20:42375371-42375393 TGTGGTGGCTCTAGGAGGTGAGG + Intronic
1173537721 20:43828717-43828739 TCTGTTGGCCAAGGCAGCTGGGG + Intergenic
1174056966 20:47804587-47804609 GCTGGTATCCATGGCAGGTGGGG + Intergenic
1174074939 20:47927775-47927797 TCGGGTTTCCCTGCCAGGTGTGG + Intergenic
1175166682 20:57049049-57049071 TCTGGTGGGCCTGGTGAGTGTGG - Intergenic
1175176205 20:57113987-57114009 GCTGGTGGCCCTGGCAGTACTGG + Intergenic
1175269254 20:57722305-57722327 GCTGTTGGCTCTTGCAGGTGGGG + Intergenic
1175771940 20:61629503-61629525 ACTTGTCGCCCTGGCACGTGTGG + Intronic
1175823938 20:61926433-61926455 TCTGTGGACCCTGGCAGGGGAGG - Intronic
1176042287 20:63072127-63072149 CCTGGGGGCGCGGGCAGGTGTGG - Intergenic
1176047680 20:63101190-63101212 GCTGGGGGCCCTGGCAGCAGTGG + Intergenic
1176216319 20:63949638-63949660 TCTGGTGGCCCTGGAGGCCGTGG + Intronic
1176298787 21:5088691-5088713 TGTGGTGTCCCTGGCAGGCTGGG + Intergenic
1176299895 21:5094646-5094668 TCTGGGGGACAGGGCAGGTGGGG + Intergenic
1178163607 21:29946837-29946859 TATTGTGGCCCAGGCTGGTGGGG - Intergenic
1178478703 21:32960031-32960053 TCTGGTGGCGGTGGGAGGGGAGG + Intergenic
1179005206 21:37507804-37507826 ACTGCAGGCCCTGGCAGGTGTGG - Intronic
1179397845 21:41057517-41057539 TCCTGTGTCCCTGGCAGCTGGGG + Intergenic
1179409871 21:41154212-41154234 GCTGGAGGCTGTGGCAGGTGAGG + Intergenic
1179442790 21:41407391-41407413 TCTTGTGGGGCTGGCAAGTGTGG - Intronic
1179857127 21:44167265-44167287 TCTGGGGGACAGGGCAGGTGGGG - Intergenic
1179858239 21:44173258-44173280 TGTGGTGTCCCTGGCAGGCTGGG - Intergenic
1179979384 21:44888403-44888425 GCTGGTGGGCCTGCCCGGTGTGG + Intronic
1180176706 21:46094050-46094072 TCCTGTGGCCCAAGCAGGTGGGG - Intergenic
1180432321 22:15263917-15263939 GCTGGTGGCGCTGGCAGGGTCGG - Intergenic
1180514885 22:16131854-16131876 GCTGGTGGCGCTGGCAGGGTCGG - Intergenic
1180735380 22:18012558-18012580 TCTGGCAGCCCTGGGAGCTGAGG - Intronic
1180835523 22:18927667-18927689 TGAGGTGGGCCTGGCAGGAGAGG + Intronic
1181005251 22:20010375-20010397 TCTGGTGGGCCTGGCGGGTGGGG - Intronic
1182466512 22:30520118-30520140 ACAGGAGGCCCTGGGAGGTGTGG + Intergenic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1183264751 22:36818285-36818307 TGTGGTGGCCCTGGGTGGTGGGG + Intronic
1184035943 22:41918165-41918187 GCTGGGGGCCCTGAGAGGTGTGG + Intergenic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
1184340655 22:43884143-43884165 ACTGGTGCCCATGGCAGGAGGGG - Intronic
1184645470 22:45892501-45892523 TCAGGAGGCCTTGGCAGCTGTGG + Intergenic
1184741118 22:46429665-46429687 TCTGGTGGCTTTGGCCAGTGGGG + Intronic
1203285611 22_KI270734v1_random:152966-152988 TGAGGTGGGCCTGGCAGGAGAGG + Intergenic
949684575 3:6553474-6553496 GCTGGTGTCCCTGGCAGGTGGGG + Intergenic
950572057 3:13807373-13807395 GGTGGTGGCCCGGGGAGGTGGGG - Intergenic
950748984 3:15113956-15113978 GCTGGTGTCCCTGGCAGGGAGGG + Intergenic
952423587 3:33152855-33152877 ACTGCTGCTCCTGGCAGGTGTGG - Exonic
952608467 3:35179043-35179065 TGTGTAGGCCCTGGCAGCTGGGG + Intergenic
953948276 3:47167144-47167166 TCTTGTTGCCCAGGCTGGTGTGG - Intergenic
954118091 3:48478312-48478334 CCTGTAGGCCCAGGCAGGTGTGG - Intronic
954577355 3:51683999-51684021 GCTGGTGGCCCTGGGGCGTGGGG + Intronic
955294832 3:57725385-57725407 TCTTCTGGGCCTGGGAGGTGAGG - Intergenic
957118317 3:76055912-76055934 GCTGGTGGTCCAGCCAGGTGTGG - Intronic
958008284 3:87841863-87841885 TCTTGTTGCCCAGGCAGGAGTGG - Intergenic
960837834 3:121925864-121925886 TCTGTTGGCTTTGGCAGGGGAGG - Intronic
961058377 3:123808060-123808082 GCTGATGACCCTGGCAGGTTTGG - Intronic
961381180 3:126497497-126497519 CCTTGTGGACCTGGCAGGCGTGG + Intronic
961385284 3:126519849-126519871 CCAGGTGGCCCTGGCTGGTGAGG - Intergenic
961450756 3:127001316-127001338 TCATGTGGCCCTGGCTGTTGGGG + Intronic
961552251 3:127676149-127676171 TGCGGTGGCCCTGGTGGGTGTGG + Intronic
962754954 3:138459819-138459841 GCAGGTGGCCCTGACATGTGGGG + Intronic
963368667 3:144369527-144369549 TCTGGTGGGGATGGCAGGGGTGG - Intergenic
966456870 3:180127743-180127765 GCTGGTATCCCTGGCAGGTGGGG - Intergenic
967313841 3:188131962-188131984 TGTGGTGGTCTTGGGAGGTGGGG - Intergenic
968550803 4:1222614-1222636 GGCGGGGGCCCTGGCAGGTGGGG + Intronic
968704965 4:2073453-2073475 CCTGGTGGCTCTGGCTGGTGGGG - Intronic
968949566 4:3683550-3683572 GCTGGTGGCCCTCCCAGCTGCGG + Intergenic
968970688 4:3791968-3791990 GCTGGAGCACCTGGCAGGTGGGG + Intergenic
969053748 4:4389058-4389080 GCTGGGGGCCCAGGCAGGAGGGG - Intronic
969298281 4:6282119-6282141 GCTGGAGGCCCTGGCAGGGAGGG - Intronic
969578849 4:8052218-8052240 TCTGGTGGCCTTGGCGTGAGAGG + Intronic
973069109 4:45835378-45835400 TCTGGTGGAGGTGGCAGGGGTGG + Intergenic
974726233 4:65802206-65802228 CATGGTGGTGCTGGCAGGTGGGG + Intergenic
977624824 4:99179090-99179112 TCCTGTGGGCCTGGCAGGGGAGG - Intergenic
978999377 4:115199128-115199150 TCTGGTGGAGGTGGCAGGGGTGG + Intergenic
979550792 4:121988817-121988839 TCTGGAGGCCCAGGCAGGTGAGG - Intergenic
979677834 4:123429132-123429154 TCTTGTTGCCCAGGCAGGAGTGG - Intergenic
981806167 4:148717951-148717973 TCTAGAGACCCTGGCAGGTGGGG + Intergenic
983372075 4:166873097-166873119 TCTGGTGGTGTTGGGAGGTGAGG - Intronic
984972403 4:185203269-185203291 TCTGTAGGACCTGGCAAGTGGGG - Intronic
985416695 4:189742429-189742451 TCTGGTTGCCAGGGAAGGTGGGG - Intergenic
985541361 5:489042-489064 TCTGGTGCCCCTCGCTGGGGAGG + Intronic
985622261 5:961835-961857 TCTGGGGGCCTTGGGAGGAGTGG - Intergenic
985657880 5:1141443-1141465 TCTGGTGCCCATGGCGGCTGTGG - Intergenic
986249702 5:6044881-6044903 TTTGGAGGCCCTGGCAGATTGGG - Intergenic
987008316 5:13734042-13734064 TCTGACGGTCCTGGGAGGTGAGG + Intronic
987149818 5:15027492-15027514 TCAGGTGGCTCTGGTAGCTGAGG + Intergenic
987858772 5:23456436-23456458 GGTGATGGACCTGGCAGGTGGGG + Intergenic
987963241 5:24837788-24837810 TACGGTGGCCATGGCAGTTGTGG + Intergenic
989113360 5:37928499-37928521 TTCGGTGGCACTGGGAGGTGGGG - Intergenic
989282036 5:39655353-39655375 GCTGGTATCCATGGCAGGTGGGG + Intergenic
991165854 5:63565021-63565043 CCTGGTGGCCATGTCAGGAGTGG + Intergenic
991367724 5:65886599-65886621 TGTGGTGGCTCAGACAGGTGAGG + Intergenic
994644515 5:102451555-102451577 TCTGGAGGCCCTGGATGGAGTGG + Intronic
994774301 5:104024784-104024806 CCTGGGGTCCCTGGCACGTGAGG - Intergenic
995304766 5:110631874-110631896 AGTGGTGGACCAGGCAGGTGAGG - Intronic
995495214 5:112734873-112734895 TCTCTTGGACCTGGGAGGTGGGG - Intronic
996167099 5:120237619-120237641 TCTTGTTGCCCTGGCTGGAGTGG - Intergenic
996798330 5:127375318-127375340 TCTGTTTGCCTTGGCAGCTGAGG + Intronic
997359544 5:133285958-133285980 TATTGGTGCCCTGGCAGGTGGGG - Intronic
997587021 5:135049230-135049252 TCTGGTGGGCCTGGGATGGGTGG + Intronic
1000068676 5:157719279-157719301 GCTGGTGTCCCTGCCAGGTGGGG - Intergenic
1000257688 5:159556303-159556325 TCTGGTGGCCTCTGCCGGTGAGG + Intergenic
1000343350 5:160294535-160294557 TGTGGATGCCCTGGCAGCTGTGG - Intronic
1000902601 5:166927999-166928021 TCTCATGGCTCTGGCAGGGGAGG + Intergenic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1001684725 5:173584874-173584896 TCTGGTGACATTGGCTGGTGGGG - Intergenic
1003987173 6:11448400-11448422 TGTGGTGGTGTTGGCAGGTGGGG - Intergenic
1005119996 6:22379198-22379220 GCTGGTACCCATGGCAGGTGGGG + Intergenic
1006706858 6:36028028-36028050 GCTGGTCGCCCGCGCAGGTGCGG - Exonic
1006924949 6:37648938-37648960 CCTGGTGGGCGTGGTAGGTGGGG + Intronic
1007637472 6:43308002-43308024 TCTGGTGGGCCTGGGAGGGGTGG + Intronic
1008879959 6:56371833-56371855 TCTGATGGCCCAGGGAGCTGAGG - Intronic
1009898309 6:69780231-69780253 ACTGGTATCCGTGGCAGGTGGGG + Intronic
1016733198 6:147448547-147448569 GCTGGTAACCCTGGCAGGTATGG + Intergenic
1017994428 6:159520276-159520298 TTTGGTGGCCCTGTCCAGTGAGG + Intergenic
1018364157 6:163100585-163100607 GCTGTGGGCCCAGGCAGGTGTGG - Intronic
1018845681 6:167553626-167553648 TCTGGTGGCCGTGGGAGCTGTGG - Intergenic
1019137232 6:169917828-169917850 TGTTCTGGCCCTGGCAGGGGAGG - Intergenic
1019165820 6:170097046-170097068 TAAGGAGGCCCTGCCAGGTGGGG - Intergenic
1019220939 6:170472319-170472341 TCTAGGGGTCCTGGCAGGTAGGG + Intergenic
1019324849 7:432997-433019 TCTGGTGGCCCTGCAGGGAGGGG - Intergenic
1019424589 7:968339-968361 TCTCCAAGCCCTGGCAGGTGGGG - Exonic
1019558094 7:1642456-1642478 TCTGGTGGCCCTGGCCAAGGGGG - Intergenic
1019570436 7:1708992-1709014 GCTGGTGGCTCCGGCAGGTGGGG + Intronic
1019989983 7:4683648-4683670 ACTTGAGGCCCTGGCTGGTGGGG - Intronic
1020071959 7:5233036-5233058 TTGGGTGGCCCTGGCAGGGCTGG + Exonic
1020736112 7:11950735-11950757 TCAAGTGGCCCTGGCAGTTGAGG + Intergenic
1022232078 7:28423844-28423866 TGTGGTCGCCCTGGGAGGAGGGG - Intronic
1023292884 7:38686397-38686419 TCTGGCTGCCCAGGCAGGAGAGG + Exonic
1023763004 7:43484131-43484153 GCTGGGGTCCCTGGCAGGGGAGG - Intronic
1023810290 7:43906417-43906439 CCTGGTGGGCCTGGCGGGCGGGG + Intronic
1023965977 7:44963238-44963260 GCTGGTGGCCCTGGCGAGGGCGG - Intronic
1024939526 7:54747345-54747367 TCTGGAGGGCCTGGCTGGGGTGG - Intergenic
1025014363 7:55426964-55426986 TCAGGTGGGCCAGGCAGGGGTGG + Intronic
1025185344 7:56853526-56853548 GCTGGTGGCCAAGGCAGGTCGGG + Intergenic
1025236048 7:57235591-57235613 GCTGGTATCCGTGGCAGGTGGGG - Intergenic
1025686587 7:63723433-63723455 GCTGGTGGCCAAGGCAGGTGGGG - Intergenic
1026769564 7:73186765-73186787 TCTGGTGACGATGGCAGGTCCGG - Intergenic
1027010433 7:74740151-74740173 TCTGGTGACGATGGCAGGTCCGG - Intronic
1027050370 7:75017938-75017960 CCTGGTGGCCCTGGGGGATGTGG - Intronic
1027077609 7:75205893-75205915 TCTGGTGACGATGGCAGGTCCGG + Intergenic
1028258210 7:88627201-88627223 CATGGTGGCCCTGCCAGGAGTGG + Intergenic
1030266628 7:107628653-107628675 TCTGGTAGCTCTGGCTGGTGTGG + Intronic
1032358416 7:131231152-131231174 TCTGATGGGCCTGGCAGGGCAGG + Intronic
1033566252 7:142580970-142580992 CCTGGTGGCCATGGCAGGGTGGG - Intergenic
1034980226 7:155471108-155471130 TTTGGTGGCCCCCTCAGGTGAGG + Intergenic
1035203715 7:157281616-157281638 TCTGGTGCCTCGGGCAGGAGTGG - Intergenic
1035698720 8:1621548-1621570 CCTGGAGCCCGTGGCAGGTGGGG - Intronic
1036635647 8:10548197-10548219 TCAGGTGGGCCTGGCTGGAGTGG + Intronic
1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG + Exonic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1038398088 8:27261802-27261824 TCTGCTGGCTCTGGAAAGTGAGG + Intergenic
1038586063 8:28790251-28790273 TGTGGTGGTCCTGGCATGGGGGG + Intronic
1039535707 8:38310540-38310562 TCTGGTTGCCCAGGCTGGAGTGG + Intronic
1039943822 8:42113487-42113509 GATGGTAGCCCTGGCAGGTGAGG - Intergenic
1043718338 8:83511356-83511378 TCTGGTGGAGGTGGCAGGGGAGG + Intergenic
1044922449 8:97180535-97180557 TCTGGTGGGCAGGGGAGGTGGGG - Intergenic
1047221594 8:122922987-122923009 CCAGGTGGCCCTATCAGGTGTGG + Intronic
1047915684 8:129581818-129581840 TCTGATGTCCCAGGCAGATGTGG + Intergenic
1048282647 8:133116483-133116505 TCTTGTAGGCCTGGCAGGGGTGG + Intronic
1048921102 8:139230921-139230943 TCTGGTGGCCGGGGCAGTGGAGG - Intergenic
1048941321 8:139403179-139403201 TCTGGTGGTCCTGACAGTTTAGG - Intergenic
1049063406 8:140294215-140294237 GCTGGTGGGCCTGGGAGGTGGGG - Intronic
1049218406 8:141418015-141418037 GCGGGTGAGCCTGGCAGGTGGGG + Intronic
1049564810 8:143332481-143332503 TCTCCTGGCTCTGGCAGGTGGGG - Intronic
1051278336 9:15418011-15418033 GCTGGTATCCGTGGCAGGTGGGG + Intergenic
1052955477 9:34250399-34250421 TCTGGTGGGCGTGTCAGCTGTGG + Intronic
1053157833 9:35792435-35792457 GGTGGCAGCCCTGGCAGGTGGGG + Exonic
1053707358 9:40768638-40768660 GCTGGTGGCGCTGGCAGGGTCGG + Intergenic
1054417272 9:64889406-64889428 GCTGGTGGCGCTGGCAGGGTCGG + Intergenic
1056258698 9:84826053-84826075 TCTGCTGTCCATGGCGGGTGGGG - Intronic
1056282637 9:85056897-85056919 TATGGTGGCCCTTGAAGGTGTGG - Intergenic
1057208044 9:93184862-93184884 TCCGGCGGCCTGGGCAGGTGCGG + Intergenic
1057447421 9:95127216-95127238 TCCGGTAGCCCTGGGAGCTGGGG + Intronic
1057575703 9:96240689-96240711 GCAGGTGGCCCTGGCAGGGCTGG - Intronic
1060532494 9:124356064-124356086 TCTGGGAGCCCGGGCAGGTCAGG - Intronic
1060719973 9:125970174-125970196 TCAGGTGGCCCAGGCAACTGAGG - Intergenic
1061042755 9:128149470-128149492 GCTGCTGGGCCTGGCAGGGGTGG - Exonic
1061273633 9:129557731-129557753 TGGGGTTGCCCTGGCAGGGGCGG - Intergenic
1062197637 9:135283024-135283046 TCAGGTGGCCTCGGCAGGAGGGG + Intergenic
1062206994 9:135342809-135342831 TCTGGTGGCCTGGGGAGATGGGG + Intergenic
1062284982 9:135768816-135768838 TCTGGTGGTCCTGGCGGGGTGGG - Exonic
1062527007 9:136981979-136982001 CCTGGTGGCAGTGGCAGCTGAGG - Intronic
1062533323 9:137011031-137011053 ACTGGTGGCCATGGCGGTTGAGG - Exonic
1062614231 9:137388785-137388807 TCTGATGCTGCTGGCAGGTGTGG - Intronic
1185470378 X:378027-378049 TGTGGTGGTCCTGTCAAGTGTGG - Intronic
1185812700 X:3125518-3125540 TCGGGTGGCTGAGGCAGGTGGGG - Intergenic
1189314600 X:40045787-40045809 ACTGATGGCCCGGCCAGGTGCGG + Intergenic
1192225791 X:69226907-69226929 GCTGGAGGACCTGGCAGGGGAGG + Intergenic
1192434445 X:71134340-71134362 TGTTGTGGCCCTGGCAGGTGGGG + Exonic
1197671591 X:129284088-129284110 TCTGGTGGAGGTGGCCGGTGGGG + Intergenic
1197705615 X:129632521-129632543 GCTGGTGGGCCTGGTGGGTGTGG - Intergenic
1200164364 X:154026021-154026043 TCTGGAGGACCTGCCCGGTGGGG - Intronic
1200547325 Y:4533436-4533458 TCTGGAGGTCCTGGCCAGTGAGG - Intergenic
1201388967 Y:13475991-13476013 TCTTGTTGCCCTGGCTGGAGTGG - Intronic