ID: 946377167

View in Genome Browser
Species Human (GRCh38)
Location 2:219318475-219318497
Sequence CCAACGCCTGTATTTTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946377159_946377167 21 Left 946377159 2:219318431-219318453 CCTCCGAAAGTGCTGGGGTTGCA No data
Right 946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG No data
946377154_946377167 30 Left 946377154 2:219318422-219318444 CCACCTCGGCCTCCGAAAGTGCT 0: 576
1: 91996
2: 188571
3: 138228
4: 72030
Right 946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG No data
946377162_946377167 -10 Left 946377162 2:219318462-219318484 CCACTGCACCCAACCAACGCCTG No data
Right 946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG No data
946377156_946377167 27 Left 946377156 2:219318425-219318447 CCTCGGCCTCCGAAAGTGCTGGG 0: 774
1: 119922
2: 268161
3: 215110
4: 127024
Right 946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG No data
946377161_946377167 18 Left 946377161 2:219318434-219318456 CCGAAAGTGCTGGGGTTGCAGGC 0: 60
1: 6871
2: 229307
3: 274012
4: 183937
Right 946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946377167 Original CRISPR CCAACGCCTGTATTTTTTTT GGG Intergenic
No off target data available for this crispr