ID: 946378208

View in Genome Browser
Species Human (GRCh38)
Location 2:219327085-219327107
Sequence CCCCTCATGCCAGACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946378208_946378213 21 Left 946378208 2:219327085-219327107 CCAGGCCTGTCTGGCATGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 946378213 2:219327129-219327151 CCACCTCCCCGTAACGTGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 37
946378208_946378216 26 Left 946378208 2:219327085-219327107 CCAGGCCTGTCTGGCATGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 946378216 2:219327134-219327156 TCCCCGTAACGTGAAAGGATGGG 0: 1
1: 0
2: 0
3: 3
4: 25
946378208_946378215 25 Left 946378208 2:219327085-219327107 CCAGGCCTGTCTGGCATGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 946378215 2:219327133-219327155 CTCCCCGTAACGTGAAAGGATGG 0: 1
1: 0
2: 0
3: 2
4: 25
946378208_946378211 -5 Left 946378208 2:219327085-219327107 CCAGGCCTGTCTGGCATGAGGGG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 946378211 2:219327103-219327125 AGGGGTAAAAGAAATGAATATGG 0: 1
1: 0
2: 3
3: 43
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946378208 Original CRISPR CCCCTCATGCCAGACAGGCC TGG (reversed) Intergenic
900121405 1:1050021-1050043 CACCTTCTGCCAGACAGGTCGGG + Exonic
900323468 1:2096028-2096050 GCCCTGATCCCAGACAGGCCCGG - Intronic
900351031 1:2234638-2234660 CACCTCCTGCCAGACAGTCAGGG - Intronic
900991243 1:6099371-6099393 AGCCTCATGCCAGTGAGGCCCGG + Exonic
901523406 1:9803369-9803391 CCCATCAAGGCAGACAGCCCAGG + Intronic
903279833 1:22244111-22244133 AGCGTCATGCTAGACAGGCCTGG - Intergenic
904365497 1:30008418-30008440 CACCTCATGCCTGTCAGCCCAGG - Intergenic
904688486 1:32276503-32276525 CCCCTCTTCCCAGGCAGTCCTGG - Intronic
905168764 1:36098302-36098324 CCCCTCAGGCCAGGCTGCCCAGG + Exonic
905457837 1:38100673-38100695 CCCCTCTTCCCAGACTGTCCAGG - Intergenic
906948936 1:50318768-50318790 CCCTTCCTGCCAGGGAGGCCAGG + Intergenic
908844814 1:68313981-68314003 CCACTTATGGCAGACAGGCGAGG + Intergenic
915119182 1:153617807-153617829 CCCCTCAAGCCAGGAAGGCAAGG + Intergenic
915488523 1:156238821-156238843 CCCCACATCACAGACTGGCCTGG + Intronic
922779551 1:228240709-228240731 CCCCTCATGGCAGACATGCCTGG - Intronic
923264614 1:232302297-232302319 CCCCTGAGGCCAGAGAGACCTGG - Intergenic
923436445 1:233971888-233971910 CCCCTCAGGGGTGACAGGCCTGG - Intronic
923500883 1:234562635-234562657 CCCACGAGGCCAGACAGGCCTGG + Intergenic
1063450268 10:6145808-6145830 CCCTGCGTGCCAGAAAGGCCCGG + Intronic
1068941674 10:62686860-62686882 TCCTTCATGCCAGCCAGGCGTGG - Intergenic
1070482996 10:76903483-76903505 CACATCAGGCCAGGCAGGCCTGG - Intronic
1070826409 10:79392789-79392811 ACCCTCATGCCTGACTGGCCGGG + Intronic
1070933944 10:80279214-80279236 GCCATCATCCCAGCCAGGCCAGG - Intronic
1071705418 10:87992885-87992907 CACCTGATCCCAGGCAGGCCTGG + Intergenic
1072785290 10:98275326-98275348 CCCTGCCTGCCAGACAGGTCTGG - Intergenic
1073013831 10:100382503-100382525 CCACTCATTCCAGGAAGGCCAGG - Intergenic
1073467071 10:103700514-103700536 ACCATGATGACAGACAGGCCTGG + Intronic
1075649771 10:124119775-124119797 CCCCTCATGCCCCTGAGGCCAGG + Intergenic
1076043167 10:127268853-127268875 TCCCACATGCCAGGCAGGACTGG - Intronic
1077253197 11:1569768-1569790 CCCCCCATGCTTGACAGTCCTGG - Intronic
1077260776 11:1618817-1618839 CCCCTCCTGCCCCACTGGCCAGG + Intergenic
1077371268 11:2182677-2182699 CCCCCCTTGCCAGGCAGGGCTGG + Intergenic
1077998742 11:7476066-7476088 CCACCCATGCCAGCCAGCCCTGG + Intergenic
1078196910 11:9144053-9144075 GCCCTCATGCCATACAGTCTAGG - Intronic
1078834709 11:15016169-15016191 GAGCTCATGCAAGACAGGCCTGG - Intronic
1080039399 11:27743574-27743596 CCCCTCTTTTCAGACAGACCTGG + Intergenic
1081813984 11:45928577-45928599 CCCCGCAGGCCAGGCAAGCCAGG + Intronic
1083027756 11:59564877-59564899 GCCCCCATGCCAGACAAGCATGG + Intergenic
1083271460 11:61574975-61574997 CCCCTCATGCCACCCTGCCCTGG + Intronic
1083301182 11:61740322-61740344 GCCCTGCTGCCAGGCAGGCCAGG + Intronic
1084214470 11:67639967-67639989 CCCCTCCAGTCAGCCAGGCCTGG - Intergenic
1084333762 11:68445466-68445488 CCTTTCACGCCAGACAGACCCGG - Intronic
1084428283 11:69097421-69097443 CCCCTCCTTCCCGACATGCCTGG - Intergenic
1084561803 11:69909782-69909804 TCCCTCCAGCCAGACAGGGCCGG + Intergenic
1084871005 11:72098489-72098511 CCCCTCAGGCCAGAGAAGCAGGG + Intronic
1085399213 11:76225498-76225520 ACCCTCATTCCAGGAAGGCCTGG - Intergenic
1085524854 11:77158170-77158192 CCCTTTCTGCCTGACAGGCCAGG - Intronic
1088974113 11:114799645-114799667 CCCCTTCTGCCTCACAGGCCTGG - Intergenic
1089395501 11:118134136-118134158 CCCCTGATGTTAGAGAGGCCTGG - Exonic
1089555127 11:119311940-119311962 TCTCTCATCCCAGACAGGCCAGG - Exonic
1090148806 11:124359260-124359282 CCTCTCATGCCAGACAACCTTGG + Intergenic
1091224821 11:133951027-133951049 CCCCTCCTCCCTGACAAGCCAGG + Intronic
1091668634 12:2437071-2437093 CCCTTCATGCCACACTGGCAGGG + Intronic
1091962204 12:4705566-4705588 CCCCTAATACCTGACAGCCCTGG - Intronic
1092237575 12:6819638-6819660 CCCTCCATGCCAGCCAGGGCTGG - Exonic
1092467951 12:8751027-8751049 CCACACATGCCATACAGGCTTGG - Intronic
1093422602 12:18992235-18992257 CTACTCATGGCAGACAGCCCGGG - Intergenic
1094166302 12:27447239-27447261 CACCTCATGCCCCACAGTCCAGG + Intergenic
1094843341 12:34351026-34351048 CCCCTCCTGCCACACATGCGTGG - Intergenic
1095103547 12:38205653-38205675 CCCTTCCTGCCAGACAAGCACGG + Intergenic
1095990092 12:48028589-48028611 CCCATCATCCTTGACAGGCCAGG - Intergenic
1096526489 12:52213117-52213139 CCCGTCAGGAAAGACAGGCCAGG - Intergenic
1101806119 12:108065408-108065430 GCCCTCCTGCCAGGCAGCCCTGG - Intergenic
1102030987 12:109740009-109740031 CCCCTGCAGCCAGACAGGCGAGG + Intronic
1106512574 13:30423990-30424012 CCCCGCAGGCCAAACAGGTCTGG - Intergenic
1107895340 13:44956350-44956372 TCCCTCGTGCCAGAAAGGCTGGG - Intronic
1108066084 13:46578835-46578857 GCCTTCATGCCAGAAAGGACAGG + Intronic
1108831809 13:54488386-54488408 CCCTACATGCCAGAAAGGACTGG + Intergenic
1112543174 13:100337229-100337251 CCCCTCATGGCAGCCAGGCAGGG + Intronic
1113347549 13:109494872-109494894 CCCCGCTTGCCTGAGAGGCCAGG - Intergenic
1115522956 14:34251645-34251667 TCCCTCAGGACAGACAGGCCTGG + Intronic
1124250995 15:28106577-28106599 CTCCTCATGCCAGGCGGGGCCGG - Intergenic
1126189347 15:45863553-45863575 CCCCTGACCCCTGACAGGCCCGG + Intergenic
1126705252 15:51399827-51399849 TGCCACCTGCCAGACAGGCCAGG + Intronic
1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG + Intronic
1127588134 15:60397600-60397622 CCCCGCATTCCAGACGCGCCAGG - Intronic
1129389496 15:75213549-75213571 CACCTCACTCCAGCCAGGCCTGG - Intergenic
1129514160 15:76146749-76146771 GCCCTCAAGCCAGACAGTACAGG - Intronic
1132333367 15:101027545-101027567 CCCCTCAGGCCACAGGGGCCGGG + Intronic
1132600192 16:769692-769714 CCCCTAGAGCCAGACAGGCCTGG + Intronic
1135676184 16:24417064-24417086 CCCCTGATCCAGGACAGGCCTGG + Intergenic
1136576870 16:31130371-31130393 CTCCCCCTCCCAGACAGGCCAGG - Intronic
1137462748 16:48680261-48680283 CCCCCCACCCCCGACAGGCCTGG - Intergenic
1137830062 16:51535917-51535939 CCCTCCTTGCCAGACAGGCTTGG + Intergenic
1139432979 16:66921016-66921038 CCTCTCATTCCAGGCAGGGCGGG + Intergenic
1140020537 16:71234112-71234134 GCCCCAATGCCAGAGAGGCCAGG + Intergenic
1140692181 16:77495156-77495178 GCCCTAAGGCCAGAAAGGCCTGG - Intergenic
1141267775 16:82512499-82512521 ACTCTGGTGCCAGACAGGCCTGG + Intergenic
1142028151 16:87825263-87825285 CCCCTCATTGCAGAAAGCCCGGG - Intergenic
1143125825 17:4640426-4640448 CCCCTCATTCCACACAGCTCTGG - Intronic
1143393783 17:6576128-6576150 CCCCTCTTGCCAGCCTGTCCAGG - Intergenic
1143402651 17:6656396-6656418 CCCCTCATTCCACACAGCTCTGG + Intergenic
1144674959 17:17156091-17156113 CCCCTCTTCCCAGCCAGGCCTGG + Intronic
1144952374 17:19001184-19001206 CCACACATGCCACACAAGCCTGG + Intronic
1145106655 17:20123509-20123531 CTCCTCATGTCAGAGAGGACAGG - Intronic
1146972761 17:37086038-37086060 CCCCTGATGCCAGTCAGGAGGGG + Exonic
1147133227 17:38420726-38420748 CCCAAGATGCCAAACAGGCCTGG - Intergenic
1149451689 17:56754666-56754688 CCTCTCCTGCCACTCAGGCCGGG + Intergenic
1151599938 17:75099990-75100012 CCCCTCTTGCCCCGCAGGCCTGG + Exonic
1151759580 17:76093024-76093046 TCCCTCCTGCCTGAAAGGCCAGG + Intronic
1152119913 17:78412126-78412148 CCCAGCATGCCCCACAGGCCAGG - Intronic
1152206522 17:78977305-78977327 CCCCGCCTGCCACACAGCCCAGG - Intronic
1152281143 17:79385472-79385494 CCCCTCCTGCCTGGCAGGACAGG - Intronic
1152960943 18:79868-79890 CCCCTCTTCTCAGAGAGGCCAGG + Intergenic
1153676256 18:7458446-7458468 CCCACCATGCCAGAAAGACCAGG + Intergenic
1155596666 18:27495807-27495829 GCCTTCAAGCCAGACAGACCTGG + Intergenic
1156331600 18:36129049-36129071 CTCCTCAGGCCAGACAGGCGTGG - Intronic
1159736158 18:72100476-72100498 CTCCCCATGCCAGACAGACAAGG - Intergenic
1160143458 18:76346679-76346701 CCGCTCATGCCCCACCGGCCCGG - Intergenic
1160857310 19:1223384-1223406 CCCTCCTGGCCAGACAGGCCTGG - Intronic
1162317290 19:9947319-9947341 CCCCTCATGGCAAACAACCCAGG - Intergenic
1162412362 19:10514219-10514241 CCCAACATGCCACAAAGGCCAGG + Exonic
1164650021 19:29884805-29884827 CCCCTCATCCCTGATAGCCCAGG + Intergenic
1165680088 19:37766737-37766759 CCCCTCATACCAGACAGAGCTGG - Intronic
1168107304 19:54172823-54172845 CCCCTCCTCCCAGACTAGCCTGG + Intronic
925124983 2:1448063-1448085 CCCCTCCTGCCTGACAGCACAGG + Intronic
925518098 2:4707418-4707440 TACCTGATGCCAGGCAGGCCTGG - Intergenic
925685694 2:6470667-6470689 CCTCTCAGGCCAAAAAGGCCAGG - Intergenic
927515306 2:23668736-23668758 TCCCCCAGGCCAGCCAGGCCTGG + Intronic
928096527 2:28408369-28408391 CCCCTCCTGCCAGCCAGGCGTGG - Intronic
928163597 2:28952305-28952327 CCCATCAGTACAGACAGGCCAGG - Intergenic
928168763 2:28990048-28990070 CCCCTCATGGGAGGCAGCCCAGG - Intronic
929944883 2:46362681-46362703 CCTCTGATTCCAGACCGGCCTGG + Intronic
931282264 2:60804681-60804703 CCCCTCTTCCCCGACAGGCTCGG - Intergenic
931645449 2:64417738-64417760 CCCCTCAGGTCAGGCAGTCCTGG + Intergenic
932171171 2:69557752-69557774 TCCCTCATACCAGAGAGGCTAGG + Intronic
936152364 2:110028743-110028765 CCCCTCAGGCCACTCAGGGCAGG - Intergenic
936192315 2:110342669-110342691 CCCCTCAGGCCACTCAGGGCAGG + Intergenic
937662714 2:124448625-124448647 GGCCTCAAGCCAGACAAGCCAGG - Intronic
938631128 2:133168957-133168979 CCCCTCTTGCTGGACAGCCCTGG + Intronic
942036223 2:172013266-172013288 CCCCTCCTGCCTCAGAGGCCTGG + Intronic
942051785 2:172147072-172147094 CCGCTCTTGCCAGCCAGACCAGG + Intergenic
945927968 2:215825299-215825321 CCCCTACTCCCTGACAGGCCCGG - Intergenic
946158752 2:217823366-217823388 TCCCTCATGGGTGACAGGCCTGG + Intronic
946378208 2:219327085-219327107 CCCCTCATGCCAGACAGGCCTGG - Intergenic
947140046 2:227012261-227012283 CCCCTCCTGCCATCCAGCCCAGG + Exonic
947752934 2:232542130-232542152 CCCCTCCTGCCAGACAGCAGTGG + Intronic
948798985 2:240421621-240421643 GTCCTCGTGCCACACAGGCCAGG + Intergenic
1169329959 20:4708599-4708621 CCCCTGAAGGCAGACCGGCCAGG - Intergenic
1173410874 20:42808486-42808508 CCCCTCTCACCAGTCAGGCCAGG - Intronic
1174603473 20:51743348-51743370 TCCCACATTCCAGACAGGCTGGG + Intronic
1175083057 20:56437367-56437389 CCCCCCATTCCTGAGAGGCCTGG + Exonic
1175465145 20:59185702-59185724 CCCCTCTTTCCAGACTGCCCTGG + Intergenic
1175518383 20:59583723-59583745 CCCCTCATCCCAGCCAGCCCCGG - Intronic
1175702008 20:61146244-61146266 TCACACATGGCAGACAGGCCTGG + Intergenic
1175823156 20:61922919-61922941 GCCCTCATAACAGACAGGCAGGG - Intronic
1179655086 21:42839781-42839803 CCCTTCCTGCCAGACACCCCTGG - Intergenic
1179775265 21:43658147-43658169 CCCCTCACGCCAGAAAGCGCGGG + Exonic
1179821450 21:43939594-43939616 CCCAGCCTGCCGGACAGGCCAGG - Intronic
1179986024 21:44920695-44920717 CCCTTCCTGCCAGACACCCCTGG + Intronic
1180180512 21:46116776-46116798 CCGTTCTTGCCAGCCAGGCCAGG - Exonic
1181045843 22:20213912-20213934 CCCTTCTTGCCTGGCAGGCCTGG + Intergenic
1181123883 22:20690637-20690659 CCCCTGCTGCCACACAGGCGAGG + Intergenic
1181860168 22:25812187-25812209 CCTCTCCTCCAAGACAGGCCTGG + Intronic
1183253431 22:36745777-36745799 GGCCTCATGCAAGACGGGCCCGG - Intergenic
1183938776 22:41280564-41280586 CCCATGATCCCAGGCAGGCCTGG - Intronic
1184503495 22:44887921-44887943 CCCCTCACCCCAGACTGGCATGG - Intronic
1184573180 22:45339982-45340004 ACCCACATGCAGGACAGGCCAGG - Intronic
1185117523 22:48946103-48946125 CACCTCATGGCAGCCAGGTCTGG - Intergenic
1185136928 22:49078635-49078657 CCCCTCCTGCCACCCAGGCATGG - Intergenic
950794364 3:15498674-15498696 CCCCTAATGCCAAACAGGCCAGG - Intronic
952992601 3:38844647-38844669 CCCATCATGGCACACAGGCTCGG + Intergenic
954034693 3:47845017-47845039 ACCCTCAGACCAGCCAGGCCAGG - Intronic
954084871 3:48236306-48236328 GCCCCCATGCTAGACATGCCTGG - Intergenic
954322275 3:49840249-49840271 CCCCTCATTCCTGTCAAGCCAGG + Intronic
954445988 3:50547154-50547176 CCCTTTCTGCCAGCCAGGCCTGG - Intergenic
954615401 3:51966751-51966773 GCCCTCATGCCTGCCTGGCCAGG - Intronic
954661396 3:52228790-52228812 CCCCTTAAGCCAGCCAGGCAGGG + Exonic
954781895 3:53068043-53068065 CCACTCCTGCCAGGCAGTCCTGG - Intronic
955226401 3:57063816-57063838 CCCCTCATTTCAGGCAGGCTTGG - Intronic
955505873 3:59632675-59632697 CCCCTCATCCCTGACATGGCAGG - Intergenic
960673328 3:120172335-120172357 CCCATCATCCCAGAAAGTCCAGG - Intronic
967779370 3:193419092-193419114 CCCCTCAGGCCATGCAGGGCAGG - Intronic
969597237 4:8156392-8156414 CATCCCATACCAGACAGGCCTGG - Intronic
970590953 4:17560403-17560425 GCCCTCCTTCCAGACAGGGCTGG + Intergenic
973240191 4:47948603-47948625 CCCCTCATGCCCAACAGGCAAGG + Intronic
974045235 4:56892896-56892918 CCCCTCCTGGTAAACAGGCCTGG + Intergenic
974420323 4:61664069-61664091 CCCCTCATGCCAGACATCCTAGG + Intronic
980973258 4:139586666-139586688 CTCCCCATTCCAGACAAGCCAGG + Intronic
981139649 4:141253741-141253763 CCCTTCATGCAAGACAGACCTGG + Intergenic
985589233 5:756176-756198 CGCCTCATGCCAGGCTGACCAGG - Intronic
985694296 5:1331256-1331278 CCCCTGAGGCCAGGCAGCCCAGG - Intronic
986417970 5:7547362-7547384 CCACCCATGCCACCCAGGCCTGG - Intronic
986639887 5:9861874-9861896 CCCCTCATGCCTGGCTGCCCTGG - Intergenic
990352766 5:54935259-54935281 ACCCCCATGCCAGTCAGGCCTGG - Intergenic
995135391 5:108674674-108674696 CCCCACATGGCAGAGAGGCAAGG + Intergenic
997336447 5:133112193-133112215 TCTCACATGCCGGACAGGCCTGG - Intergenic
997645594 5:135479488-135479510 CCCTTCATCCTAGCCAGGCCAGG + Intergenic
998451166 5:142235665-142235687 CCCCTCCTGCCTGGCAGGGCTGG + Intergenic
999261350 5:150240846-150240868 GCCCTTATACCAGAGAGGCCAGG + Intronic
1001039267 5:168321147-168321169 CCCCTCATCCCAGAGATACCTGG + Intronic
1003076693 6:2988934-2988956 CCCCTCATCCCGGACGGGCCGGG - Intronic
1006735667 6:36270763-36270785 CCCTTCCTGCCACCCAGGCCTGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007448802 6:41927524-41927546 ACCCTCCTGCCAGGTAGGCCTGG + Exonic
1009932055 6:70188126-70188148 CCCTTCATGCCTGTAAGGCCTGG - Exonic
1009939123 6:70268802-70268824 ACCCTCATGCCTGGTAGGCCTGG + Exonic
1011068747 6:83359104-83359126 CCTCACATCCCAGACAGGGCAGG + Intronic
1011473521 6:87731068-87731090 CCCTGCATGACAGACAGCCCAGG + Intergenic
1013046457 6:106490289-106490311 AACCTCATGCCAGGCAAGCCTGG - Intergenic
1015389190 6:132662130-132662152 CCCCTCAGGGCAGCCAGGACAGG + Intergenic
1015439707 6:133233691-133233713 CCCTTCCTGCCAGAGAGCCCAGG - Intergenic
1016993459 6:149944995-149945017 CCTCTCTTGCTAGAGAGGCCTGG + Intronic
1017004874 6:150022535-150022557 CCTCTCTTGCTAGAGAGGCCTGG - Intronic
1018720861 6:166571122-166571144 CCCCGCATGCCCAGCAGGCCTGG + Intronic
1018953543 6:168393592-168393614 CACCTCATGCAGGACTGGCCAGG - Intergenic
1019060472 6:169254051-169254073 CGGCCCCTGCCAGACAGGCCTGG + Intergenic
1021315855 7:19145907-19145929 CCCTTGATGCCAGGCAGGCAGGG - Intergenic
1023112068 7:36824014-36824036 TCCCTCATGCCAAAAAGGTCGGG - Intergenic
1023940793 7:44767378-44767400 CCCCTCCTCACACACAGGCCGGG - Intronic
1026807166 7:73435775-73435797 CACCTCTAGCCACACAGGCCTGG + Exonic
1027047432 7:75000399-75000421 TCCCTCATTCCAGACAGAACGGG + Intronic
1032197900 7:129799772-129799794 GCCCTTCTGCCAGCCAGGCCTGG + Intergenic
1032720103 7:134544099-134544121 CCCCTAATGCCTGACTGTCCAGG + Intergenic
1032781605 7:135168862-135168884 TCCCTCATGGCTGACAGCCCAGG - Exonic
1034960122 7:155359646-155359668 CCCCTCAGGGCAGACAGGTGAGG + Intronic
1036691980 8:10949901-10949923 CCCCTGAGTCAAGACAGGCCGGG - Intronic
1041099188 8:54379390-54379412 CTCCACATGCCAGACCTGCCCGG + Intergenic
1044914149 8:97094446-97094468 CCATCCATGCCAGACAGCCCAGG + Intronic
1046496553 8:115022214-115022236 CCCCTACTCCCTGACAGGCCTGG + Intergenic
1052020549 9:23520672-23520694 CCCCTACTCCCTGACAGGCCCGG - Intergenic
1057171284 9:92964799-92964821 CCTCTCATGTCACCCAGGCCTGG + Intronic
1059424274 9:114210988-114211010 CCCCTCTTGCCAGGAACGCCAGG - Exonic
1060815727 9:126634162-126634184 CTCCTTATCCCAGGCAGGCCAGG - Intronic
1061236786 9:129347840-129347862 CCCCACTTCCCAGCCAGGCCTGG + Intergenic
1061876475 9:133546587-133546609 ACACCCATGCCAGCCAGGCCAGG + Intronic
1062028430 9:134351157-134351179 CCCCTTCTCCCACACAGGCCAGG + Intronic
1062217733 9:135398453-135398475 CACCCCATCCCGGACAGGCCAGG + Intergenic
1062338674 9:136083837-136083859 GCCCTCAACCCAGCCAGGCCGGG - Intronic
1062458824 9:136654346-136654368 CCCCTCATCCCAGGGAAGCCAGG + Intergenic
1062544410 9:137055110-137055132 CCCCGCATCCCAGCCCGGCCAGG + Intergenic
1062737221 9:138144121-138144143 CCCCTCTTCTCAGAGAGGCCGGG - Intergenic
1185452245 X:288896-288918 CCCCACATAGCTGACAGGCCAGG - Intronic
1191233913 X:58119012-58119034 GCCATCATGCCAGTCTGGCCAGG - Intergenic
1192150617 X:68710067-68710089 GCCCTCATGCCAGCCAAGCAAGG - Intronic
1192308576 X:69989155-69989177 CCCCTGATGCCAGCAGGGCCTGG + Intronic
1192380913 X:70614786-70614808 CCCCCAATGCCAGACAGTTCAGG + Intronic
1196468924 X:116003269-116003291 GTCCTCATGCCAAACATGCCAGG + Intergenic
1197226778 X:123961943-123961965 CCGCCCATGCCAGGCAGGCAGGG - Intronic
1200055378 X:153457305-153457327 CCCCACATGCCACCCATGCCAGG + Intronic
1200083889 X:153593351-153593373 CCCCTCCTTCCAGTCAGGGCTGG - Intronic
1200137884 X:153883694-153883716 CCACTCATGCCTGGCAGACCAGG + Intronic
1200153966 X:153965495-153965517 CCCCTCACACCTGGCAGGCCAGG + Intronic
1201537175 Y:15063261-15063283 CCCCACCTCCCTGACAGGCCGGG + Intergenic
1201686351 Y:16707553-16707575 CCCCTCAACCCCAACAGGCCTGG - Intergenic