ID: 946379430

View in Genome Browser
Species Human (GRCh38)
Location 2:219335190-219335212
Sequence TGCCTCTCTGCAGGGTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946379424_946379430 0 Left 946379424 2:219335167-219335189 CCAGTAGCAAGTTGTCCTAAAAC No data
Right 946379430 2:219335190-219335212 TGCCTCTCTGCAGGGTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946379430 Original CRISPR TGCCTCTCTGCAGGGTAATG GGG Intergenic