ID: 946381103

View in Genome Browser
Species Human (GRCh38)
Location 2:219349608-219349630
Sequence GTGCCCTGCCTCATATCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946381103_946381105 -2 Left 946381103 2:219349608-219349630 CCATTGGATATGAGGCAGGGCAC No data
Right 946381105 2:219349629-219349651 ACCTGCCTGGTCTGCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946381103 Original CRISPR GTGCCCTGCCTCATATCCAA TGG (reversed) Intergenic
No off target data available for this crispr