ID: 946383243

View in Genome Browser
Species Human (GRCh38)
Location 2:219363955-219363977
Sequence TCCCCAGGCCAGCCCCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946383243_946383251 6 Left 946383243 2:219363955-219363977 CCCCTTTGGGGCTGGCCTGGGGA No data
Right 946383251 2:219363984-219364006 GGGGATTTCCCTGGAGAGCACGG No data
946383243_946383250 -3 Left 946383243 2:219363955-219363977 CCCCTTTGGGGCTGGCCTGGGGA No data
Right 946383250 2:219363975-219363997 GGAAAACAAGGGGATTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946383243 Original CRISPR TCCCCAGGCCAGCCCCAAAG GGG (reversed) Intergenic
No off target data available for this crispr