ID: 946385439

View in Genome Browser
Species Human (GRCh38)
Location 2:219381560-219381582
Sequence ACAAGCATGAGGAGAACCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946385439_946385442 -1 Left 946385439 2:219381560-219381582 CCGGTGGTTCTCCTCATGCTTGT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 946385442 2:219381582-219381604 TCCCTGTAAGAGACAGATAAGGG 0: 1
1: 0
2: 4
3: 24
4: 250
946385439_946385441 -2 Left 946385439 2:219381560-219381582 CCGGTGGTTCTCCTCATGCTTGT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 946385441 2:219381581-219381603 GTCCCTGTAAGAGACAGATAAGG 0: 1
1: 1
2: 6
3: 67
4: 258
946385439_946385445 17 Left 946385439 2:219381560-219381582 CCGGTGGTTCTCCTCATGCTTGT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 946385445 2:219381600-219381622 AAGGGCCAGACATAGCAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 154
946385439_946385447 23 Left 946385439 2:219381560-219381582 CCGGTGGTTCTCCTCATGCTTGT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 946385447 2:219381606-219381628 CAGACATAGCAAACAGGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946385439 Original CRISPR ACAAGCATGAGGAGAACCAC CGG (reversed) Exonic
900693929 1:3998484-3998506 ATCAGCATGAGGACAAGCACAGG + Intergenic
902864486 1:19269328-19269350 ACAAGTATGAGGACAAGGACGGG - Intergenic
902869767 1:19307058-19307080 ACAAGTATGAGGACAAGGACGGG - Exonic
903087000 1:20870253-20870275 CAAAGCATGAGGAGAATGACAGG - Intronic
903913426 1:26745693-26745715 AAAAGCAACAGTAGAACCACTGG - Intronic
906802237 1:48748473-48748495 ACAAGCATTAGGAGAAAAACTGG + Intronic
913575583 1:120170527-120170549 ATAAGCATGAGGTGAACCAGGGG + Intronic
914557894 1:148786169-148786191 ATAAGCATGAGGTGAACCAGGGG + Intergenic
914614940 1:149344061-149344083 ATAAGCATGAGGTGAACCAGGGG - Intergenic
914679756 1:149930940-149930962 TCAAGGAAGAGGAGAAACACCGG + Exonic
915638989 1:157207123-157207145 ACAAGCATGAGGATAAGCGTAGG + Intergenic
921334234 1:214070359-214070381 AGAATCATGGGGAAAACCACAGG - Intergenic
922819726 1:228475925-228475947 ACATGCATGGGGAGAATCACAGG - Intergenic
923045381 1:230351746-230351768 ACAACCTAGAGGAGAACCAGAGG - Intronic
923056432 1:230429501-230429523 ACAGGCCTGCTGAGAACCACTGG - Intergenic
924031860 1:239893699-239893721 ACAAACATCATGAGAACCTCAGG - Intronic
1063170047 10:3500908-3500930 ACACACATCAGGAGAAACACAGG - Intergenic
1063635363 10:7777352-7777374 ACGAGCATGAGGAAACCCTCTGG + Intronic
1067607222 10:47676442-47676464 ACAAGCAACAGGAGAGCAACAGG + Intergenic
1069887328 10:71632205-71632227 ACCAGCATGAGCAGCAGCACTGG + Intronic
1071622778 10:87137823-87137845 ACAAGCAACAGGAGAGCAACAGG + Intronic
1074326635 10:112456887-112456909 ACAAGTATGAGGAGTAGCTCAGG - Intronic
1074630531 10:115250148-115250170 TCAAGTATGAGCAGAAACACAGG - Intronic
1078739021 11:14049367-14049389 ACCAGCGTGAGGAGGACCAGAGG - Intronic
1089233093 11:116997102-116997124 ACAAGATTCAGGGGAACCACTGG + Intronic
1091409035 12:227251-227273 GCAAGCCTGAGAAGCACCACAGG - Intronic
1095509622 12:42936318-42936340 ATAAGCATGAAGAGAATCAAGGG + Intergenic
1097355353 12:58594740-58594762 ACAACAATGAGGACAACAACAGG + Intronic
1097438880 12:59585246-59585268 TCAAGCATGAGTAGCACCAGCGG - Intergenic
1097717965 12:62987099-62987121 ACAATCATGAGTGGAACCAAGGG - Intergenic
1098213283 12:68188401-68188423 ACAAGCATAAAGAGCATCACGGG + Intergenic
1100225051 12:92548115-92548137 ACAAGCTTCATGAGAAGCACGGG + Intergenic
1101070224 12:101066759-101066781 AGCAGCAGGAGGAGGACCACAGG + Intronic
1106305369 13:28504601-28504623 AGAAGCAAGAGGAGAACCTCGGG - Intergenic
1110137643 13:72087764-72087786 AGAACCATGTGGAGATCCACAGG + Intergenic
1110168707 13:72474477-72474499 ATAAGCAAGAGGAAAAACACTGG + Intergenic
1110443021 13:75546229-75546251 ATAAGCATGAACAGAACAACAGG + Intronic
1112725492 13:102299541-102299563 TCAAACAGGAGTAGAACCACTGG + Intronic
1112907319 13:104440425-104440447 ATCAGCATGAGGGGTACCACGGG - Intergenic
1112950052 13:104983164-104983186 AGAAGCATGAGAAGAACAATTGG + Intergenic
1118343130 14:64913092-64913114 ACAAGCATTTTGAGACCCACAGG + Intergenic
1118947064 14:70398437-70398459 ACAAGCATGAGGGGAATCCTGGG - Intronic
1122795028 14:104201724-104201746 AGAAGCAGGAGGGGAGCCACAGG + Intergenic
1127697597 15:61466613-61466635 ACAAGAGTGAGTAGAAGCACAGG + Intergenic
1128379911 15:67104979-67105001 ACAAGGAAGAGCAGAGCCACTGG - Intronic
1128550830 15:68596916-68596938 GCAGGCAGGAGGAGAGCCACAGG - Intronic
1129660457 15:77550234-77550256 ACCAGCATCAGGAGCAGCACAGG + Intergenic
1130943717 15:88534426-88534448 TCAAGCAGCAGGAGAACCAGGGG - Intronic
1132958411 16:2608835-2608857 ACATGCTTCAGGTGAACCACGGG - Intergenic
1132971023 16:2688931-2688953 ACATGCTTCAGGTGAACCACGGG - Intronic
1132996941 16:2828337-2828359 GCAAGCATGAAGACAGCCACAGG + Intergenic
1134433984 16:14238035-14238057 ACAGGCATGAAGTGGACCACTGG + Intronic
1137920580 16:52483842-52483864 ACAGGCATGAGAGGAGCCACAGG + Intronic
1142949748 17:3468861-3468883 GCAAGGATGATGAGAACCAGGGG - Intronic
1142990174 17:3724800-3724822 ACAGGCAAGAGGAGGGCCACAGG + Exonic
1143286043 17:5790053-5790075 GTAAGCATGAGGGGAATCACTGG + Intronic
1147193721 17:38751337-38751359 ACAAGTATGAAGAGAAACAAAGG - Exonic
1149545983 17:57504292-57504314 AAAGGCATGAGGAGAATCCCGGG - Intronic
1150923154 17:69504654-69504676 CCATGCATGAGGAAAACCCCAGG + Intronic
1154436127 18:14342735-14342757 ACAAGCATGAGGGCACCTACAGG - Intergenic
1155858365 18:30864253-30864275 AGAAGGATGAGGAGAAGGACGGG + Intergenic
1158097069 18:53785258-53785280 ACAAGCATCAGGAGATCTAAAGG - Intergenic
1158935883 18:62364204-62364226 AGGGGCATCAGGAGAACCACAGG + Intronic
1159043539 18:63347074-63347096 ACAGGGATGAGGAGAAGCAGTGG - Intronic
1161163245 19:2772159-2772181 ACCACCGTGAGGAGAAGCACAGG + Intronic
1162215599 19:9131326-9131348 AAAAGAATGAGGAAAACCATGGG + Intergenic
1162478493 19:10914922-10914944 CCTAGCATGAGAAGAGCCACAGG - Intronic
1164560139 19:29286019-29286041 AAAACCATGAGGAGACCCAGTGG - Intergenic
1167994779 19:53393529-53393551 CAAAGCATGAGGATAGCCACCGG - Intronic
1168003270 19:53466130-53466152 CAAAGCATGAGGATAGCCACTGG - Intergenic
928199652 2:29239498-29239520 ACAGGCAAGAGGTGAACCACTGG + Intronic
929958812 2:46480646-46480668 ACCTGCATGAGAAGAACCAGCGG + Exonic
930012448 2:46947912-46947934 ACAAGCATGGAGAGACCCGCAGG + Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932071779 2:68627881-68627903 ACAAGCTTGAGGACTACCACTGG + Intronic
932484420 2:72074461-72074483 AGAAGCAGGAGGAGACCCAGTGG - Intergenic
934489870 2:94755081-94755103 ACAAGCATGTGGGCACCCACTGG + Intergenic
934593055 2:95575459-95575481 ACAAACATGAAGAGAAACAAAGG + Intergenic
937287490 2:120762494-120762516 ACAGGCAGGAGGAGAGTCACAGG + Intronic
942161807 2:173196773-173196795 AGAAGCAGGAAGAGAACCAGTGG - Intronic
943590737 2:189793241-189793263 CCAAACATCATGAGAACCACTGG - Intronic
944710086 2:202327761-202327783 CCAAGGATGAGGAGAAGCAAAGG - Intergenic
946325811 2:218984322-218984344 AAAAGAATCAGGAGAACCCCGGG + Intronic
946385439 2:219381560-219381582 ACAAGCATGAGGAGAACCACCGG - Exonic
946817788 2:223596754-223596776 GCAAGCATAAGGAAAACCATGGG + Intergenic
948817027 2:240516519-240516541 ACAATAATTAGGATAACCACTGG - Intronic
948925171 2:241091596-241091618 TGAAGCATGAGGAGAATGACAGG - Intronic
1169533972 20:6516883-6516905 ACTATCATGAGGAGAACCATTGG - Intergenic
1169792939 20:9430802-9430824 ATAAACAGGAGGAAAACCACTGG + Intronic
1170606101 20:17876039-17876061 GCAGGCATGAGGAGGACCAAGGG + Intergenic
1170658623 20:18315163-18315185 ACAAGCATGTGAAGATCCAGGGG - Exonic
1177909111 21:27008939-27008961 ACAAGTATGATGGGAACCAGGGG - Intergenic
1178691402 21:34753193-34753215 ACAAGTATGATATGAACCACAGG + Intergenic
1182808163 22:33093374-33093396 ACATGCATGGGGAAAACCACAGG + Intergenic
1183747604 22:39700575-39700597 ACAAGCAGGACGAAAACCCCTGG - Intergenic
955517502 3:59742290-59742312 ACAAACAAGATCAGAACCACAGG - Intergenic
956732006 3:72204719-72204741 ACAGGCATGAGGACAAGCCCAGG - Intergenic
960699855 3:120429064-120429086 CCAAGCATGATGAACACCACTGG - Intronic
966577612 3:181520025-181520047 AGAGCCATGAGGAGATCCACGGG - Intergenic
967107094 3:186262759-186262781 ACAAGCACGAGCAGACCCATGGG - Intronic
967341112 3:188398976-188398998 AAAACAATGAGGAGAATCACGGG + Intronic
973995287 4:56452586-56452608 ACTAGAATGATGAGAACCTCTGG + Intronic
974199227 4:58617107-58617129 ACAAGCAGGAGGAAAACCTTTGG - Intergenic
976912788 4:90327958-90327980 AGAAGAATGAGAATAACCACAGG - Intronic
977144808 4:93425456-93425478 AAGGGCTTGAGGAGAACCACAGG - Intronic
982312396 4:153999777-153999799 CCTAAAATGAGGAGAACCACAGG + Intergenic
985476185 5:80521-80543 TGGAGCATGAGGAGATCCACAGG - Intergenic
986653649 5:9989472-9989494 ACAAGCAAGAGGACAACAGCTGG + Intergenic
986770315 5:10966791-10966813 CCCAGCATGATGAGAACCCCTGG - Intergenic
988906365 5:35794712-35794734 ACAAACATGAGAAGAACAAAGGG + Intronic
991101455 5:62797959-62797981 AGAAGAATGAGGAGAAGGACAGG - Intergenic
993702106 5:91130801-91130823 ACAAGGATGGGGATAAACACTGG - Intronic
995478749 5:112574181-112574203 ACATGCATGTGGACAACCCCTGG - Intergenic
995566412 5:113435893-113435915 ACAAGCAGCAGGGGAAGCACTGG + Intronic
1000598633 5:163245751-163245773 ACAACAATTAGGAAAACCACAGG - Intergenic
1000823813 5:166018756-166018778 ACAATCATGAGAAGAACCTGTGG + Intergenic
1001782377 5:174381174-174381196 ACCAGCATGAGCAAAAGCACAGG - Intergenic
1002151731 5:177238730-177238752 ACAATCATGAAGAGCAACACTGG - Intronic
1002191977 5:177483193-177483215 ACAGACATGAGGGGAGCCACTGG - Intergenic
1003062476 6:2874517-2874539 ACAAGGATGAGGAGAAATTCTGG - Intergenic
1005796436 6:29366914-29366936 AAAAGCATCAGGAGATCCCCAGG - Intronic
1006169435 6:32084687-32084709 ACAAGGATGAGGAGAAGCCTGGG - Intronic
1009298723 6:61987980-61988002 ACAAGCATCAAAAGAACCAAGGG + Intronic
1011727992 6:90230101-90230123 ATATGAGTGAGGAGAACCACAGG + Intronic
1012037099 6:94156125-94156147 AAAACCAAGAGGAGAACCAGAGG + Intergenic
1012957261 6:105584585-105584607 ACAAGCAAGAGGAAAGCCATGGG - Intergenic
1013443125 6:110191600-110191622 ACAATCATGTGGATATCCACAGG + Intronic
1016582134 6:145640393-145640415 AAAAAGATGAGGAAAACCACAGG + Intronic
1016991803 6:149935295-149935317 ACAAGCATGAGGAGGAGGCCTGG - Intergenic
1016994348 6:149951216-149951238 ACAAGCATGAGGAGGAGGCCTGG - Intergenic
1017441255 6:154466408-154466430 ACAAGCATGAGCAGCAATACTGG + Intronic
1019019055 6:168902521-168902543 CCAAGCATGAGGCTCACCACAGG - Intergenic
1020241957 7:6402037-6402059 ACAAGGAGGAGGAAAAACACAGG - Intronic
1021909254 7:25368026-25368048 ACAAAGATGAGAAGAACCAAAGG - Intergenic
1024711629 7:52021585-52021607 ACAAGCATGAGGATATTGACAGG - Intergenic
1027450451 7:78325597-78325619 ACAACCATGAGAAGAAAAACAGG - Intronic
1029066606 7:97855958-97855980 ACAAGGTTGAGAAGAAACACTGG - Intronic
1031079220 7:117242082-117242104 ACAAGCATGATGAGAACATTGGG - Intergenic
1032712324 7:134471090-134471112 TCAAGCATGAGCAAAACCAGAGG - Intergenic
1034228355 7:149499848-149499870 AAAAGCATGAGGAAAGGCACAGG - Intergenic
1034398794 7:150847834-150847856 ACAAACATGAGCAGAAACAATGG + Intronic
1035618661 8:1021867-1021889 ACAAACAAGAGGAGAAGCCCAGG - Intergenic
1036805987 8:11834178-11834200 AGAAGCATGAGGAGGTCCTCTGG - Intronic
1037649400 8:20822971-20822993 AAATGCATGTGGAGAAACACGGG - Intergenic
1037949768 8:23011368-23011390 GGAAGAAGGAGGAGAACCACAGG - Intronic
1038045098 8:23759770-23759792 ACAAGCATAAGGAGAAGGAAAGG - Intergenic
1040891956 8:52326430-52326452 ACATGATTGGGGAGAACCACAGG + Intronic
1041229221 8:55731986-55732008 ATAAACATGAGGACAACCAGAGG + Intronic
1045089895 8:98730995-98731017 AGAAGGAGGAGGAAAACCACTGG + Intronic
1045210388 8:100091900-100091922 ACAAGCCTGAGCAACACCACAGG - Intronic
1046030609 8:108779255-108779277 AACAGCACGATGAGAACCACAGG + Intronic
1047167258 8:122452923-122452945 ACCTGGATGAGGATAACCACAGG + Intergenic
1047194657 8:122710789-122710811 ACAACCATGTTGAGAACCAGTGG - Intergenic
1047879086 8:129172744-129172766 ACAAGAGTGAGAAGAACCAGAGG + Intergenic
1048869747 8:138787450-138787472 ACAAGGAGGAGGAGTACCTCTGG + Intronic
1049406833 8:142455351-142455373 ACAAGCAGGAGGACAGCCATGGG - Intronic
1050256130 9:3794009-3794031 ACAAGCTTGAGGATAGACACTGG - Intergenic
1050545668 9:6706795-6706817 ACAAGCATGAAAAGAAGAACTGG - Intergenic
1054917779 9:70511512-70511534 ACATGCATGATGCGAACCAAGGG + Intergenic
1056676849 9:88683105-88683127 ACAAGACTGGAGAGAACCACAGG + Intergenic
1058673472 9:107380492-107380514 CCAAGCATGATGAGACTCACAGG - Intergenic
1060002484 9:119970811-119970833 ACAAGCAGGAAGAGGACCATTGG + Intergenic
1060783167 9:126428727-126428749 ACAGGGAAAAGGAGAACCACAGG - Intronic
1061082637 9:128381332-128381354 ACTGGCATGAGGAGAACCAAAGG + Intronic
1186092746 X:6067333-6067355 CAAAGCAAGAGGAAAACCACTGG - Intronic
1186660135 X:11661161-11661183 ACAAGAATTAGGAGAAGCTCAGG + Intronic
1187781943 X:22837271-22837293 AAAAGCATGAGGCTGACCACTGG + Intergenic
1188885405 X:35543788-35543810 GCAAGCATTAGCAGAACCAAAGG - Intergenic
1191172148 X:57459057-57459079 ACAAGCAAGCTAAGAACCACTGG + Intronic
1194437751 X:93889799-93889821 ACAACCTTGAGCATAACCACGGG + Intergenic
1194693421 X:97014445-97014467 ACAAGTATGAGGAGAAATAGAGG - Intronic
1196183054 X:112715981-112716003 AGCACCATCAGGAGAACCACTGG + Intergenic
1198229898 X:134678885-134678907 AAAAGACAGAGGAGAACCACAGG + Intronic
1198305394 X:135377280-135377302 ACAAACATGAAGATGACCACTGG + Intergenic
1202361731 Y:24117841-24117863 ACAAGTATGAGGAGAAATATTGG + Intergenic
1202363341 Y:24135255-24135277 ACAAGTATGAGGAGAAATATTGG - Intergenic
1202507439 Y:25534862-25534884 ACAAGTATGAGGAGAAATATTGG + Intergenic
1202509046 Y:25552272-25552294 ACAAGTATGAGGAGAAATATTGG - Intergenic