ID: 946385992

View in Genome Browser
Species Human (GRCh38)
Location 2:219384864-219384886
Sequence CAGAGATTGGAGAAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 1, 2: 4, 3: 66, 4: 607}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946385975_946385992 27 Left 946385975 2:219384814-219384836 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385974_946385992 28 Left 946385974 2:219384813-219384835 CCCCGCCTCAGCCTCCCAAAGTG 0: 359
1: 2122
2: 3966
3: 5053
4: 7578
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385973_946385992 29 Left 946385973 2:219384812-219384834 CCCCCGCCTCAGCCTCCCAAAGT 0: 394
1: 2331
2: 4219
3: 5308
4: 7563
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385980_946385992 17 Left 946385980 2:219384824-219384846 CCTCCCAAAGTGCTGGGATTCCT 0: 34
1: 3571
2: 303843
3: 270389
4: 154934
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385982_946385992 13 Left 946385982 2:219384828-219384850 CCAAAGTGCTGGGATTCCTTGCT 0: 1
1: 7
2: 223
3: 11469
4: 246665
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385972_946385992 30 Left 946385972 2:219384811-219384833 CCCCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385981_946385992 14 Left 946385981 2:219384827-219384849 CCCAAAGTGCTGGGATTCCTTGC 0: 1
1: 56
2: 3864
3: 238808
4: 281597
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385978_946385992 23 Left 946385978 2:219384818-219384840 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385985_946385992 -3 Left 946385985 2:219384844-219384866 CCTTGCTAGGCAGGACCAAGCAG 0: 1
1: 0
2: 1
3: 11
4: 183
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607
946385976_946385992 26 Left 946385976 2:219384815-219384837 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG 0: 1
1: 1
2: 4
3: 66
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946385992 Original CRISPR CAGAGATTGGAGAAGGGGGC TGG Intronic
900151111 1:1179764-1179786 GGGAGCTTGGAGCAGGGGGCAGG - Intronic
900238001 1:1601541-1601563 CAGAGGTGGGAGCTGGGGGCAGG - Intergenic
900391407 1:2435538-2435560 CAGGGACTGGGGAAGGGGCCAGG + Intronic
900623528 1:3598091-3598113 CAGAGATGGGGGAGGGTGGCTGG - Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902968804 1:20031799-20031821 CTTAGATTGGAGAAGGGAGGAGG + Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903686904 1:25138599-25138621 CAGAGACTGAGGAAGGGAGCTGG + Intergenic
903810172 1:26030957-26030979 CAGAGGTGGGAGATGGTGGCAGG - Intronic
903828961 1:26163638-26163660 CCGAGAAGGAAGAAGGGGGCCGG - Intergenic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904769278 1:32871851-32871873 CTGAGATGAGGGAAGGGGGCTGG - Intronic
905224259 1:36468855-36468877 CAGAAATTGGACAGAGGGGCCGG - Intronic
905662166 1:39735949-39735971 CAGAGGTTGGAGGCGGGAGCTGG + Intronic
905912890 1:41665793-41665815 AAGAGATTAGAGCAGAGGGCAGG + Intronic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906108695 1:43309361-43309383 AAGAGATGGGGGAAGGGGACAGG - Intronic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906478505 1:46185600-46185622 CAGTGATTGGGGGAGGGGACAGG + Exonic
906931719 1:50176645-50176667 CAGAGATTGGAGGTGGGAGGGGG + Intronic
907074516 1:51566268-51566290 TGGAGATAGGAGAAGGAGGCTGG - Intergenic
907257227 1:53188948-53188970 CAGATATTGGAGCAGTTGGCAGG + Intergenic
907463541 1:54620407-54620429 GAAAGATTGGAAGAGGGGGCCGG + Intronic
907960479 1:59275597-59275619 AAGACATTCCAGAAGGGGGCTGG - Intergenic
908451627 1:64261741-64261763 CAGAGATTGCAGAGGGGAGTAGG - Intronic
909686196 1:78351819-78351841 CAGAGAGTGGAGAATGGAGACGG + Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
912313745 1:108647933-108647955 CCAATATTGGAGGAGGGGGCTGG + Intergenic
912387448 1:109278892-109278914 TAGAAATTGGAGCAGGGGGCTGG + Intergenic
912755938 1:112325003-112325025 CAGAGCTTGGACATGCGGGCTGG - Intergenic
912812222 1:112803092-112803114 CAGGGAGTGGAGAGGAGGGCAGG - Intergenic
912954589 1:114145880-114145902 GAGAGGTAGGAGAAGGGGGTGGG + Intronic
912961143 1:114196932-114196954 CAGAGATTGGAGGAGGGGGAGGG + Intergenic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913125231 1:115780973-115780995 ATGAGATTGGAGAAGATGGCTGG - Intergenic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914736911 1:150426699-150426721 CAGGGACTGGGGTAGGGGGCAGG + Intronic
914758549 1:150580267-150580289 CAGAGATGGGAGAAGCAAGCAGG - Intergenic
914939237 1:152007430-152007452 CAGAGATCAAAGAAGGAGGCTGG - Intergenic
914998660 1:152566592-152566614 CAGCAATGGGGGAAGGGGGCAGG - Intronic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915592950 1:156880834-156880856 GAGTGATTGGAGAAGGGGCCTGG - Intronic
916833874 1:168521580-168521602 TAGAGGTTGGAGATGGAGGCAGG + Intergenic
917459865 1:175220838-175220860 GTGAGATTTCAGAAGGGGGCAGG + Intergenic
918066675 1:181106010-181106032 CAGAGAGTGGCGGAGGGGGAAGG - Intergenic
919571515 1:199254766-199254788 CAGCTATTGTAGAAGGGGGTGGG + Intergenic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920540008 1:206771085-206771107 GAGAGATTGGCGGAGGTGGCTGG + Intronic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921841850 1:219836630-219836652 CTGAGATTGAAGAAAGAGGCTGG - Intronic
922151436 1:223008184-223008206 CAGAGATGGGGGATGGGGGACGG - Intergenic
922612562 1:226940977-226940999 CAGAGTTTGGAGAAGAGGAAAGG - Intronic
922664418 1:227456417-227456439 CACAGATTGGAAAAATGGGCAGG - Intergenic
923137604 1:231132154-231132176 CGTATTTTGGAGAAGGGGGCAGG - Intergenic
924651630 1:245933941-245933963 CAGTAATTGGGGGAGGGGGCTGG - Intronic
1063123130 10:3118681-3118703 CACAGACTGGGGAAGGCGGCCGG + Intronic
1063303208 10:4872592-4872614 CAGAGAGTGGAGATGCAGGCAGG - Intergenic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1064614109 10:17134941-17134963 CAGAGGTTGGGGGAGGGGGAGGG + Intergenic
1065047637 10:21758460-21758482 CTCAGATGGGAGGAGGGGGCGGG - Intronic
1065646508 10:27840511-27840533 CACTGATTGGACAAGGGGGTGGG + Intronic
1065819782 10:29515049-29515071 AAGAGATTGAGGAAGGGGACAGG - Intronic
1065828466 10:29593589-29593611 CCGAGATTTGAGAAGGAGGCCGG - Intronic
1065961136 10:30735203-30735225 GGGAGAATGGAGAAGAGGGCGGG - Intergenic
1065996565 10:31064693-31064715 CAGAGAGTGGAGAATCAGGCTGG + Intergenic
1067563584 10:47321262-47321284 CAGAGATTGCAGAGGGGGATGGG - Intergenic
1067688002 10:48479331-48479353 CAGAGAATGGAGATGAGGGAAGG + Intronic
1067976481 10:51031498-51031520 CAAGGATTGGAGCAGAGGGCAGG + Intronic
1068051498 10:51955265-51955287 CAAATATTGGTGAATGGGGCAGG - Intronic
1069744148 10:70704210-70704232 CTGACAGTGGAGCAGGGGGCTGG - Intronic
1069756338 10:70776290-70776312 CAGAGAATGGAGAAGGGCCCAGG - Intronic
1069792193 10:71029959-71029981 CCGGAATTGGAGGAGGGGGCAGG + Intergenic
1070190438 10:74107084-74107106 CAGTGATTGAAGAAGGGGGGAGG - Intronic
1070257756 10:74825932-74825954 GAGAGGGTGGAGGAGGGGGCGGG + Intronic
1070329057 10:75405100-75405122 CAGATATTGGAGGAGGGGGTGGG + Intergenic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071162810 10:82770736-82770758 CTGAGATTGGAGATAAGGGCTGG + Intronic
1071574370 10:86715091-86715113 GAGAGACTGGAGATGGGGCCAGG + Intronic
1071760913 10:88605446-88605468 AAGGGGTTGGAGATGGGGGCAGG - Intronic
1073080519 10:100857214-100857236 ATGAGATTGGAGAAGTGGGTAGG - Intergenic
1073176654 10:101561121-101561143 CTGAGGTTGGAGCTGGGGGCTGG - Intergenic
1073198599 10:101716138-101716160 AAGAAATTGAAGAAGGTGGCTGG - Intergenic
1073353661 10:102837021-102837043 CAGGGGGTGGTGAAGGGGGCAGG + Intronic
1073737496 10:106366502-106366524 CCTAGAGTGGAGAAAGGGGCAGG - Intergenic
1074080864 10:110167097-110167119 CTCAGGCTGGAGAAGGGGGCTGG - Intergenic
1074396192 10:113099841-113099863 CAGAAATTGGAGAGGAGGGGAGG + Intronic
1074432863 10:113408602-113408624 CATACATTGGAGGTGGGGGCAGG - Intergenic
1074768835 10:116720262-116720284 CAGAGGTTGGAGGAGGGAGGGGG - Intronic
1074938704 10:118213720-118213742 AAGAGTTTGGAGAAGGAGGGAGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075247528 10:120836469-120836491 CAGAGAGTGGAGCAGGGTGAGGG + Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075711670 10:124534018-124534040 CAGAGTTTGGGGATTGGGGCGGG + Intronic
1076070228 10:127482962-127482984 CAGGGAGTGGACAAGGGGGAAGG - Intergenic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076307400 10:129474834-129474856 CAGAGATTGACGAGGGTGGCTGG + Intronic
1076773437 10:132679604-132679626 CAGAGTTTGGAGGAGGGTGGAGG + Intronic
1077319228 11:1933671-1933693 CAGAGGTTGGAGAGAGGGGTGGG + Intronic
1077572912 11:3354898-3354920 TAGATATTGAAGAAGGCGGCTGG + Intronic
1077998911 11:7477064-7477086 AAGAGATTGGAGGAGGAGGAAGG + Intergenic
1079181717 11:18199849-18199871 CAGGGATTTGGGAAGGGGGATGG - Intronic
1079836267 11:25338088-25338110 CAGAGATTTGAGGAGAGGGAGGG + Intergenic
1080387257 11:31817521-31817543 CTGAGCTGGGAGTAGGGGGCGGG - Intronic
1080779807 11:35419596-35419618 CCGCGACTGGAGATGGGGGCGGG - Intronic
1081605799 11:44526491-44526513 CAGGGCCTGGAGAAGGGGGTGGG - Intergenic
1081660785 11:44887189-44887211 CAGAGGTTGGGGCATGGGGCAGG - Intronic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082919516 11:58477928-58477950 CACATATTGGAGGAGGGGCCTGG + Intergenic
1082954415 11:58853958-58853980 CAGACATTGGAGGAGGTGGTAGG - Intronic
1083241284 11:61390986-61391008 CAGAGATGGGAGAAGGGAAATGG + Intergenic
1083421518 11:62556014-62556036 GAGAAACTGGAGAAGGGGTCGGG - Intronic
1083843082 11:65315523-65315545 CAGAGCTTGGAGACTAGGGCAGG + Intronic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084081367 11:66827667-66827689 CAGAGATGGGAGAACAGGCCAGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085231196 11:74972454-74972476 CACACTTTGGAGGAGGGGGCGGG - Intronic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085341270 11:75733079-75733101 CAGAGAGCAGCGAAGGGGGCGGG - Intergenic
1085402711 11:76244224-76244246 CACAGATGGGAGAATGGGGGTGG - Intergenic
1085470204 11:76752838-76752860 GAGAGAATGGAGAGGGGAGCAGG + Intergenic
1085763762 11:79264488-79264510 CAGAGCTTAGAGCAGGGGGACGG - Intronic
1086073820 11:82828855-82828877 CAGAGATTGGAGAAGATGGCAGG - Intronic
1086417922 11:86607607-86607629 AAGAGATTGCAGAAGGGAGTGGG - Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1086797148 11:91120331-91120353 CAGAGACTGTAAAAGGGGGCTGG - Intergenic
1086809845 11:91295621-91295643 CCGATATTGGAGGAGGGGCCTGG + Intergenic
1087018460 11:93578037-93578059 AAAAGGTTGGAGAAGGAGGCAGG + Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1088363567 11:109016422-109016444 GAGAGATGGGAGATGGGGGAAGG + Intergenic
1088547023 11:110969378-110969400 TGGAGATTGGGGCAGGGGGCTGG - Intergenic
1088587289 11:111370250-111370272 AAGACATTGGAGAAGGGGAGTGG + Intronic
1088600640 11:111471619-111471641 TATAGACTGGAGAAGGGGACGGG - Intronic
1088889041 11:114030440-114030462 CAGAGAGAGGCCAAGGGGGCAGG - Intergenic
1089067101 11:115670349-115670371 CAGAGAGTGCAGAAGGGCACTGG - Intergenic
1089342450 11:117767628-117767650 CAGAGAGTGGAAAAGGCAGCTGG - Intronic
1089923510 11:122232614-122232636 AAGAGATTGTAAAAGGGGCCGGG - Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1092000418 12:5027149-5027171 CAGAGACAGAAGTAGGGGGCAGG + Intergenic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1092315224 12:7405280-7405302 GAGAGATGAGAGAAGGGGGAAGG - Intronic
1092614392 12:10203187-10203209 GAGAGATAGGAAAAGGGGGCAGG - Intergenic
1093231928 12:16555690-16555712 CAGAGATTAGAGAAGCGGTTTGG - Intronic
1093667493 12:21831821-21831843 GAGAGATTGGAGATGAGGCCAGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1096254240 12:50053183-50053205 CAGAGATGGGTGAAGAGGGAGGG - Intergenic
1096867792 12:54575574-54575596 CACAGAGTGGAGAAAAGGGCAGG - Exonic
1096908201 12:54955886-54955908 AAGAGATTAGACAAGGGGGAGGG - Intronic
1097012502 12:55963251-55963273 CAGAGATTGGGGATGGGGACAGG + Intronic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1098387683 12:69935984-69936006 CACAGATGGGAGCAGGGGGGAGG - Intronic
1098460522 12:70728280-70728302 GAGAGATCAGAGAAGGGGCCTGG - Intronic
1099832870 12:87867639-87867661 CAGAGATTGGAGTGAGGGGAGGG + Intergenic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101364621 12:104060289-104060311 GAGAGTTTGGAGAAGAGGGATGG - Intronic
1101635525 12:106537600-106537622 CATAGATGGGAGTAGGGGGCTGG - Intronic
1101713289 12:107288477-107288499 TAGAGATTGGCGGTGGGGGCGGG - Intergenic
1102035830 12:109769908-109769930 CAGGGTTTGGAGAATGGGGATGG - Exonic
1102484226 12:113245299-113245321 GAGAGGTTAGAAAAGGGGGCTGG + Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1104792096 12:131489747-131489769 AAGAGAAGGGAGAATGGGGCAGG + Intergenic
1104831821 12:131757627-131757649 AAGAGATTGAGGAAGTGGGCTGG + Intronic
1105002375 12:132699086-132699108 CAGAGACTTGAAAAGGTGGCGGG - Intronic
1105533635 13:21243518-21243540 CAGAGATGGGAGGAGGGTGAGGG + Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1106177023 13:27340401-27340423 GAGAGAATGGAGAAGCGGGGAGG + Intergenic
1106325355 13:28684185-28684207 CAGAAATTGGAGCAGGTGCCGGG - Intergenic
1107268267 13:38583300-38583322 GAGAGGTTGGAGGAGGGGGCAGG + Intergenic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1107714183 13:43182493-43182515 CATATGTTGGAGAATGGGGCAGG - Intergenic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108515186 13:51194791-51194813 CACAGACTGGAGTAGGGGGATGG + Intergenic
1111325285 13:86686345-86686367 CAGTGATTGAAGAAGAGGGCAGG + Intergenic
1113444246 13:110353283-110353305 CAGAGATTTGAGGAGGCTGCAGG + Intronic
1113526313 13:110980709-110980731 CAGAGAGTGCAGCATGGGGCAGG - Intergenic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114686012 14:24532396-24532418 AAGAGATTGGAGAAGGGGGCTGG - Intergenic
1114866137 14:26597734-26597756 GAGAGAGTGGAGAAGGGAGAGGG + Exonic
1115020983 14:28681709-28681731 CGGAGATTGGAGATGGAGGTGGG + Intergenic
1115465414 14:33709410-33709432 CAGGGATGGGAGAATGGGGGCGG - Intronic
1115536800 14:34380968-34380990 TAGAGATTTGGTAAGGGGGCGGG + Intronic
1116204062 14:41838419-41838441 CAGATACTGCAGAAGGGTGCTGG - Intronic
1117010795 14:51468292-51468314 CAGAGATGGGAGAGGGGGAGGGG + Intergenic
1117050477 14:51854945-51854967 TGGAGATTGAAGAAGGCGGCTGG - Intronic
1117542241 14:56759498-56759520 CACAGCTTGGAGATGAGGGCTGG + Intergenic
1117940971 14:60964291-60964313 CAGACCTTGGAGAAGAGGGAGGG - Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118851508 14:69587234-69587256 CAGCCATTTGAGAAGGGGGCTGG - Intergenic
1118915350 14:70098335-70098357 TAGAGATTGGGGAAAGGGGGAGG - Intronic
1119084499 14:71727609-71727631 AGGACATTCGAGAAGGGGGCTGG - Intronic
1119165906 14:72492565-72492587 AAGGGATGGGAGACGGGGGCAGG + Intronic
1119314740 14:73683620-73683642 CAGAGACTGGAGAGGGGGGTGGG - Intronic
1119382513 14:74238314-74238336 CAGAGATTGGAAAACCAGGCTGG - Intergenic
1119614848 14:76092173-76092195 CTGATATGGCAGAAGGGGGCAGG + Intergenic
1119972300 14:78984851-78984873 ATGAGACTGGAGAAGGAGGCAGG + Intronic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120524654 14:85563668-85563690 CCCACATTGGAGAAGGGGCCTGG - Intronic
1121256001 14:92530915-92530937 CAGAGATTGGTGGGTGGGGCTGG - Intronic
1121333536 14:93063060-93063082 GAGAGATGGGAGATGGGGGTGGG - Intronic
1121553426 14:94819356-94819378 CTGAGATTGGAGCAGGTGCCAGG + Intergenic
1121616506 14:95317328-95317350 CTGGGAGTGGAGATGGGGGCAGG - Intronic
1121617255 14:95320915-95320937 CTGAGCTGGGAGCAGGGGGCTGG - Intergenic
1121732173 14:96194484-96194506 CAGAGGGTGGTGATGGGGGCTGG + Intergenic
1122757030 14:103989825-103989847 GAGGGACTGGAGAAGGAGGCTGG + Intronic
1124864984 15:33481251-33481273 CAGAGATTGTAAAATGGGGTAGG - Intronic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125387488 15:39153840-39153862 CAGAAAGTGGAGAAGAGAGCAGG + Intergenic
1125405638 15:39350497-39350519 TAGAGTTTAGAGACGGGGGCAGG - Intergenic
1125418058 15:39474103-39474125 AAGAGATTGGACTAGAGGGCAGG + Intergenic
1125435995 15:39645799-39645821 CCGAGATTGGAGCTGGGGACTGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125600842 15:40915110-40915132 CAGTGATGGGGGGAGGGGGCTGG - Intergenic
1125961687 15:43835306-43835328 TAGAGATTGGGGTGGGGGGCGGG - Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126447120 15:48760071-48760093 CTGAGATAAGAGAAGGGGTCAGG + Intronic
1127798175 15:62455776-62455798 GAGAGATAGCAGAAGGGGACTGG - Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1128990273 15:72253983-72254005 CAGAGATTGCAGACGAGGGGTGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129712386 15:77826960-77826982 CAGAGTTTGGAAAGGGGGGCAGG - Intergenic
1129852125 15:78799310-78799332 CAGAGCTGGGAGAGTGGGGCTGG + Intronic
1130011769 15:80157881-80157903 CAGAGATGGCACAAGGGAGCTGG + Intronic
1130250878 15:82299777-82299799 CAGAGCTGGGAGAGTGGGGCTGG - Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130520375 15:84657148-84657170 CTGACATTGGAGCAGGGGCCCGG + Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133413109 16:5584668-5584690 CACAGATGGGAGAGGAGGGCTGG + Intergenic
1133801544 16:9090071-9090093 CAGAGATAGCAGACTGGGGCAGG + Intergenic
1133845244 16:9447421-9447443 CAGAGATGGTAGAAGGGCCCTGG - Intergenic
1134423247 16:14113749-14113771 CAAAAATTAGAGAAGGGGGTTGG + Intronic
1135826992 16:25737794-25737816 CAAAGATGGGAGAAGGGAGAGGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135916100 16:26606848-26606870 CAGAGATTGCAAAAGGTTGCAGG - Intergenic
1136395577 16:29991009-29991031 CAGAGGTTAGAGTCGGGGGCAGG - Intronic
1136558790 16:31025985-31026007 CAGAGACCTGAGACGGGGGCCGG + Intergenic
1136893393 16:33982991-33983013 CAGAGCCTGGAGAGGTGGGCAGG - Intergenic
1137538678 16:49347222-49347244 CAGAGATGGGAGGAGAGGGTGGG - Intergenic
1137702760 16:50508712-50508734 CAAGGATTGGAGATGGGGGCAGG - Intergenic
1138212397 16:55174426-55174448 CAGAGATTGGGGAGGGGGTACGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138811507 16:60156114-60156136 CAGAGGTTAGAGAAGAGGGAGGG + Intergenic
1139244130 16:65424389-65424411 TTGAGATTGGTGAAGGGGACTGG - Intergenic
1139429510 16:66903721-66903743 CAGGGATAGGATGAGGGGGCTGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139775148 16:69311959-69311981 CGAAGATTGGGGAAGGGGCCGGG - Intronic
1140032532 16:71349962-71349984 CAGAGTTTGGAGGAGAGGTCTGG - Intergenic
1140450071 16:75063729-75063751 CAGAGCTTGGTGGCGGGGGCAGG - Intronic
1140879860 16:79188177-79188199 CAGAGATGGGAGAAGGGACAAGG + Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141405503 16:83789282-83789304 CAAGGATTGGAGAAGGAGGAGGG + Intronic
1141437289 16:84007461-84007483 CAGACATTGAAGAAGGGTCCTGG + Intergenic
1141683456 16:85556889-85556911 CCGAGGTCGGAGGAGGGGGCCGG + Intergenic
1142189186 16:88709781-88709803 CAGAGACTGGTGAAAGGGGCGGG - Intronic
1142216533 16:88832651-88832673 CAGACATGGAAGAAGGGGGTGGG + Intronic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1203079644 16_KI270728v1_random:1140631-1140653 CAGAGCCTGGAGAGGTGGGCAGG + Intergenic
1142974524 17:3635816-3635838 CAGAGAGTCGGGGAGGGGGCGGG + Intronic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143568590 17:7740357-7740379 CAGGGGTTGGAGTTGGGGGCAGG + Intronic
1143706994 17:8705556-8705578 GGGAGACTGGAGATGGGGGCGGG - Intergenic
1143735542 17:8909706-8909728 CAGGGATTGGAGATGCAGGCTGG + Intronic
1144311527 17:14018346-14018368 CAGAGATTGGTGAGAGTGGCAGG - Intergenic
1145823220 17:27856724-27856746 CAGAGAGTGGGGTAGGGGCCAGG - Intronic
1145988574 17:29064199-29064221 AAGAGAATGGGGAAGTGGGCAGG + Intergenic
1147743659 17:42682553-42682575 CAGAGGCTGGGGAAGGGGGGAGG + Intronic
1147876850 17:43627868-43627890 GAGAGATGGGGGGAGGGGGCAGG - Intergenic
1147924166 17:43936347-43936369 AAGAGCTTGGGGATGGGGGCTGG + Intergenic
1148579667 17:48734843-48734865 CCAGGTTTGGAGAAGGGGGCTGG - Intergenic
1149267918 17:54947891-54947913 CTGAGTTTAGAGAAGGGGTCTGG - Intronic
1150391117 17:64790493-64790515 CAGGGATGGGTGAATGGGGCTGG + Intergenic
1150790218 17:68196853-68196875 GAGAGATTGGTGGGGGGGGCGGG - Intergenic
1151297727 17:73197855-73197877 CAGAGACTGGAGGTGGGGCCAGG + Intronic
1151690257 17:75679660-75679682 AGGAGATTGGAGAAGGAGGCTGG + Intronic
1151950903 17:77353226-77353248 CAGAGATTCCAGAAGGAGACTGG + Intronic
1152463662 17:80454276-80454298 CAGAGGTGGGAGAAGAGGTCAGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153108101 18:1550898-1550920 CAAATGTTGGAGAAGGGGCCTGG + Intergenic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154121364 18:11655082-11655104 CCCAGTTTGGAGAAGGAGGCCGG + Intergenic
1154333362 18:13447744-13447766 GAGGGATGGGAGAAGGGGGAGGG + Intronic
1155248383 18:23932974-23932996 CAGGGATTGGAGCAGGAGGTGGG + Intronic
1156315268 18:35963572-35963594 CAGAGATCCGAGAAGTGGCCAGG - Intergenic
1156453086 18:37277584-37277606 AAGAGCTGGGAGAAGAGGGCTGG + Intronic
1156653254 18:39252346-39252368 GAGAGATTGGAGAAGGTGGGGGG - Intergenic
1157392438 18:47314018-47314040 CAGAGGCTGGAGAAGAGGCCAGG - Intergenic
1157599850 18:48887239-48887261 AAGAGATGGGAGAAGGGGAGAGG - Intergenic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1157709647 18:49841386-49841408 CAGACAGTGAAGAAGGCGGCAGG + Exonic
1158894951 18:61904041-61904063 CAGAGATTAGAGAAGGGGATGGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159190583 18:65036595-65036617 TAGAGAGTGGCGAAGGTGGCAGG + Intergenic
1159623788 18:70669272-70669294 CTGAGATTGGAGAAGGAGTCAGG - Intergenic
1160983277 19:1826469-1826491 CAGAGATGGGGGAAGGGAGGAGG + Intronic
1161767215 19:6214396-6214418 CAGTGCTGGGAGAAGAGGGCAGG - Intronic
1162127676 19:8508059-8508081 CAGAGAATGGAGAAAGGAGGAGG + Intergenic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1162690769 19:12428472-12428494 CAGAGATTGGAGAGATGGCCTGG - Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1163081876 19:14950150-14950172 CAGAGAGGAGGGAAGGGGGCTGG - Intronic
1164563968 19:29312670-29312692 CAGAGAATGCACAAAGGGGCAGG + Intergenic
1164729162 19:30489047-30489069 CAGTGATTCCACAAGGGGGCTGG - Intronic
1164920366 19:32084556-32084578 GAGGGATTGGAGAAGGGTTCAGG - Intergenic
1165072495 19:33263669-33263691 AAGAGATTGGAGAGGGGAGAGGG + Intergenic
1165087986 19:33364615-33364637 AAGGGGCTGGAGAAGGGGGCAGG - Intergenic
1165470941 19:36004193-36004215 TAGAGATGGGGGGAGGGGGCAGG + Intronic
1165476419 19:36033206-36033228 GTGAGCTTGGAGAAGGGGTCCGG - Intronic
1165718617 19:38063270-38063292 CAGGGATGGGAGCTGGGGGCCGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166705091 19:44904040-44904062 CAGAGATGGGGGCAGGGAGCTGG + Intergenic
1166921110 19:46229826-46229848 CTGAGATTGGAGATGGGCTCAGG - Intronic
1167113498 19:47475447-47475469 CAGGGGTTGGAGGACGGGGCAGG - Exonic
1167715530 19:51140685-51140707 CAGGGATTGGAGGTGAGGGCGGG + Intergenic
1168315495 19:55483173-55483195 CAGCCAGTGGAGCAGGGGGCTGG - Exonic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
1168692522 19:58385694-58385716 CAGGGATGGGAGTAGGGGGCAGG + Intergenic
925031615 2:654199-654221 CAGACACTGGAGAAGGTGGGAGG + Intergenic
925229456 2:2220038-2220060 CAGTGAGTGGAGAAGAGGGGAGG + Intronic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926823754 2:16881917-16881939 AAGAGATTGGAGAAGTGGTGTGG + Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
928033557 2:27801131-27801153 CAGAGGCTGGAGGACGGGGCAGG + Intronic
928156049 2:28877845-28877867 CAGAGATTGGAGAGAGGGGCAGG + Intergenic
929467039 2:42154384-42154406 AAGTGATTGGGGAAGGAGGCTGG + Intergenic
930096229 2:47569274-47569296 AAGAAATTGGAGAAGGGGCTGGG + Intronic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
931348840 2:61470847-61470869 AAGAGAATGGGGGAGGGGGCCGG + Intergenic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932300446 2:70663360-70663382 CAGAGATGGGAGAAGGGAAGGGG + Exonic
932413181 2:71559144-71559166 TAGAGATCAGAGAAGAGGGCTGG - Intronic
933577148 2:84082227-84082249 CAGAGTTTGAAGAAGAGGTCAGG - Intergenic
933741285 2:85536344-85536366 TAAAGATGGCAGAAGGGGGCGGG - Intergenic
935850004 2:107208058-107208080 AAGAGATTAGCGAAGGGGGTTGG + Intergenic
936698790 2:114984833-114984855 CACAGATTGGAATAGCGGGCAGG - Intronic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
938305089 2:130247829-130247851 CACAGATTGGAGAGGAGGGCTGG + Intergenic
938448925 2:131399378-131399400 CACAGATTGGAGAGGAGGGCTGG - Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939862617 2:147437766-147437788 TGGAGATTGGAGGAGGGGTCTGG + Intergenic
941652963 2:168113085-168113107 TAGACAATGGAGAAGAGGGCTGG - Intronic
942292653 2:174487299-174487321 CCGAGGCTGGAGGAGGGGGCGGG - Intergenic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
942762200 2:179412327-179412349 GAGAAATTGGAGAAGGGGGAGGG - Intergenic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
947995365 2:234522949-234522971 CCGATATTGGAGAAGGGGCCTGG + Intergenic
948465867 2:238151348-238151370 CAGAGAGGGGAGCCGGGGGCCGG + Exonic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948857183 2:240735619-240735641 CAGGAATTGGAGTAGGGGGTGGG - Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1170166863 20:13368760-13368782 CAGGGGTTGGGGAAGGGGACAGG - Intergenic
1170226003 20:13992565-13992587 CAGAGACTGGGGAATGGGGGTGG + Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171277678 20:23872252-23872274 CAGGGATTGGTGTAGGGGGTGGG + Intergenic
1171282622 20:23913892-23913914 CAGGAATTGGTGTAGGGGGCGGG + Intergenic
1172113935 20:32562921-32562943 GAGAGAGTGGAGAAGGAGGGTGG + Intronic
1172223746 20:33290712-33290734 GAGACATCGGAGTAGGGGGCTGG + Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172971895 20:38879803-38879825 CAGAGGTTCTAGAAGGGAGCAGG + Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173289759 20:41704204-41704226 CAGTGAATGGAGAAGGGGATGGG - Intergenic
1173465212 20:43275514-43275536 CAGGGAGTGGAGTAGGGGGTGGG - Intergenic
1173586568 20:44187206-44187228 GCAGGATTGGAGAAGGGGGCGGG - Exonic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175267344 20:57710417-57710439 GAGAAATTGGAGAAAGGGGGAGG + Intronic
1175789119 20:61730822-61730844 CAGAGATTGGTGCTGGGGGCAGG + Intronic
1175802688 20:61810173-61810195 CAGAGATGGGTGAGGGAGGCCGG + Intronic
1176520758 21:7822353-7822375 CAGGGATGGGATAAGGGGCCTGG - Intronic
1177006848 21:15684030-15684052 ATGAGACTGGAGAAGTGGGCAGG + Intergenic
1177492377 21:21844448-21844470 CGGACATTGGAGAAGGATGCTGG - Intergenic
1177583135 21:23053781-23053803 CAGAGGTTGGAAAAGGTGGCAGG - Intergenic
1178234247 21:30823091-30823113 CAGATATTGGAGGTGGGGCCTGG + Intergenic
1178379685 21:32097380-32097402 AAGAGAGTGGAGTAGGGGGCGGG - Intergenic
1178578391 21:33815406-33815428 CAGAGAGTGGAGGTGGGGGATGG + Intronic
1178638798 21:34329438-34329460 CTGATATTGGAGGAGGGGCCTGG - Intergenic
1178654782 21:34452365-34452387 CAGGGATGGGATAAGGGGCCTGG - Intergenic
1179159402 21:38880108-38880130 CAGAGGTTGGAAAAAGAGGCTGG - Intergenic
1179640455 21:42744368-42744390 CACATATTGGAGATAGGGGCTGG + Intronic
1180623955 22:17181613-17181635 CAGGGGTTGGGGAACGGGGCAGG + Intronic
1180958909 22:19753913-19753935 CAGAAATTGGAGAGGGGTCCAGG + Intergenic
1181313201 22:21956567-21956589 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181346307 22:22222639-22222661 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181387965 22:22558520-22558542 CAGAGAGTGGGGGAGGGGGTGGG + Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1181872084 22:25907736-25907758 AAGAGTGTTGAGAAGGGGGCCGG + Intronic
1182472610 22:30557619-30557641 GAGAGGTTGGGGAATGGGGCAGG + Intronic
1183021723 22:35032837-35032859 AAGAAAGTGGAGAAGGGGGAGGG + Intergenic
1183216906 22:36486601-36486623 CAGAGATAGGAGAAGGGTCTGGG + Intergenic
1184093374 22:42303911-42303933 GAGAGAATGGAGAAAGGGGAAGG + Intronic
1184191816 22:42900027-42900049 CAGAGAGCTGAGATGGGGGCAGG - Intronic
1184204900 22:42995889-42995911 TGGAGACTGGGGAAGGGGGCAGG - Intronic
1185314604 22:50173592-50173614 CAGAGAGTGGAGAATGTAGCAGG + Intronic
1185418828 22:50723878-50723900 CAGAGAGGGAAGATGGGGGCTGG - Intergenic
949281869 3:2355597-2355619 CAGGGGTTGGAGGAGGGCGCAGG - Intronic
949856234 3:8463869-8463891 AAGAGATTGGAGAACGGGCACGG - Intergenic
950112763 3:10430640-10430662 AAGAGGTGGGAGAAGGGGGATGG - Intronic
950165969 3:10799168-10799190 CAGACACTGGTGAAGAGGGCAGG - Intergenic
950798220 3:15528583-15528605 CTGGGATTGGGGTAGGGGGCCGG - Intergenic
950934512 3:16824883-16824905 CAGAGGTGAGAGAAGAGGGCAGG + Intronic
951078627 3:18425485-18425507 CCGGGATTGGGGGAGGGGGCGGG + Intronic
951278021 3:20713206-20713228 CAGAGATCTGAGAAGGAGGTTGG + Intergenic
952419390 3:33117758-33117780 CAGATTTTGGAGAAGGTGGTAGG - Intronic
952918612 3:38268324-38268346 CTGAGGTTGGAGAAGGGGCGGGG - Intronic
953055444 3:39383940-39383962 AAGGGAATTGAGAAGGGGGCAGG + Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953965144 3:47298721-47298743 CAGAGATTAGAGATGGTGGGTGG - Intronic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954240861 3:49292413-49292435 CACACATGGGAGAAGGGGGTTGG - Intronic
954422017 3:50423832-50423854 CAGAGATGGGAGGTGGGGACAGG + Intronic
954736933 3:52714801-52714823 CTGAGATTGGAGCTGGGGGTGGG - Intronic
955088078 3:55722197-55722219 CAGAGATAAGAGAATGGGGTTGG + Intronic
955314066 3:57920716-57920738 CAGAGATGGCAGAATAGGGCCGG + Intronic
955463500 3:59211570-59211592 TACAGATTGCAGAAGTGGGCAGG + Intergenic
956462398 3:69485235-69485257 CAGAGATTGGAGTGGGAGCCAGG + Intronic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
956721773 3:72124347-72124369 AAGAGATTGGTGGAGGGGACAGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957758335 3:84522393-84522415 CAGTGATATGAGACGGGGGCGGG + Intergenic
957883850 3:86256989-86257011 CAAAGACTGGAGAAGGTGGAAGG + Intergenic
959152648 3:102625807-102625829 CAGAGTGTGGACAAAGGGGCTGG - Intergenic
960319009 3:116211177-116211199 CAGGGATGGGAGGAGGGGGAAGG + Intronic
961026557 3:123563404-123563426 GAAAGACTGGAGAAGTGGGCAGG + Intronic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
961825559 3:129597402-129597424 CAGAGGCTGGAGAAGGGCACAGG + Intronic
962324785 3:134423901-134423923 CAGAGAGGGGAGCAGGGGCCAGG - Intergenic
964330334 3:155595014-155595036 CAGAGCTTGGAGAAGTGGAGAGG + Intronic
964590802 3:158360712-158360734 CTGAGATTGGAGCAGGTGCCAGG + Intronic
965787647 3:172352869-172352891 CAGAGAGTGGAGACGGGGTCAGG - Exonic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966254641 3:177904001-177904023 AAGAAATTGGAGTAGTGGGCAGG + Intergenic
966908167 3:184542683-184542705 AACAGATGGGAGAAGGGGGGAGG + Intronic
967191704 3:186990595-186990617 GAGGGATGGGAGAAGGCGGCTGG - Intronic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968684886 4:1951296-1951318 GTGAGATTGGGGAAGGGGTCTGG - Intronic
969253972 4:5990259-5990281 CTGAGCTTGGAGAATGGGGCTGG - Intergenic
969414311 4:7048739-7048761 CAGGGACTGGGGAAGGGGGAGGG - Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
970652887 4:18197947-18197969 AAGAGAATGGAGAGGGGGTCAGG - Intergenic
971004971 4:22362931-22362953 CAGACTTTTGAGAAGGGGACTGG - Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
972620061 4:40738602-40738624 CAGATTTGGGAGAAGGGAGCAGG - Intergenic
973535594 4:51878945-51878967 CAGAGATTGGTCTAGGTGGCTGG + Intronic
973759401 4:54102534-54102556 TAGACATTGGAGGAGGGGGCAGG - Intronic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
979443263 4:120778093-120778115 AAGAGATTGGAGAAAAGGGGAGG + Intronic
979833458 4:125330352-125330374 TAGAAATTGGTGAAGGAGGCTGG - Intronic
981269345 4:142826450-142826472 AAGAGAATGGAAAAGGGGACAGG - Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981767054 4:148263027-148263049 CAGGGAGTGGAGATGGTGGCAGG - Intronic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
983054312 4:163083771-163083793 CAGAGCTGGGAGGAGGGTGCAGG + Intergenic
983676699 4:170302922-170302944 CACAGATTGGAAGAGGAGGCAGG + Intergenic
985078065 4:186237807-186237829 CAGAGAGGTGGGAAGGGGGCGGG - Intronic
985488967 5:168014-168036 GAGAGAGTGGAGAGGTGGGCTGG - Intronic
986006869 5:3676069-3676091 CAGAGAGTGGAGATGGTGACGGG - Intergenic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987330255 5:16850737-16850759 AAAAGTTTGGGGAAGGGGGCTGG + Intronic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
989460214 5:41688982-41689004 CAGAGACTGGAAAAGGGAGGGGG - Intergenic
989577433 5:43001165-43001187 CAGAGATTGGAGGGGAGGACCGG + Intergenic
991982132 5:72243110-72243132 CAGAGATGGGAGAGGGGGTCAGG + Intronic
992013924 5:72557179-72557201 CAGAGATTTGAGCAGGGGTGGGG + Intergenic
992080436 5:73231016-73231038 TAGACAATTGAGAAGGGGGCTGG - Intergenic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995403158 5:111764256-111764278 CAGAGATGGAAGGAGGGGGTTGG + Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
998096525 5:139398726-139398748 CAAAGGTTGGACAAGGGGCCAGG + Intronic
998158927 5:139802172-139802194 CAGAGATTGGGGAGGGGGTGGGG + Intronic
999261599 5:150241886-150241908 CACAGAATGGGGAAGGGGCCAGG + Intronic
999375976 5:151086865-151086887 AAGACAGTGGAGAAGGAGGCTGG + Intronic
999642716 5:153688143-153688165 CAGAGATGGGAGATGGGCTCTGG - Intronic
999771521 5:154779802-154779824 TAGAGAATGTAGAGGGGGGCTGG - Intronic
1001013498 5:168119630-168119652 CAGAGATTGGGGAATGGGCAAGG - Intronic
1001109862 5:168886656-168886678 ATGAGATTGGAGTAGGGTGCAGG + Intronic
1001440517 5:171739262-171739284 GAAAGACTGGAGAAGTGGGCAGG - Intergenic
1001548326 5:172584403-172584425 CTGAGATTAGAGAAGGTGGGAGG + Intergenic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1001768408 5:174273338-174273360 CAGAGACTGGAGTTGGAGGCAGG - Intergenic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002471736 5:179439543-179439565 CAGAGGTTGGCAAAGGAGGCCGG - Intergenic
1002685055 5:181003591-181003613 TGGAGATGGGAGAAGGCGGCTGG - Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002815939 6:680438-680460 ATGAGATTGGAGAAGGGTGGAGG + Intronic
1003344973 6:5258542-5258564 CAGAGATTAGAGAGGAGGGAAGG + Intronic
1003377451 6:5593025-5593047 CAGAGATGGGAGGAGGGTGAGGG - Intronic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1004281422 6:14282597-14282619 CAGGGATGGGAGAAGCAGGCAGG + Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005220277 6:23578798-23578820 GAGAGATAGGAGATGGGGTCAGG + Intergenic
1005886826 6:30103370-30103392 CTGAGAGTGGAGATGGGGGCGGG - Exonic
1005916401 6:30355760-30355782 CAGAGTTTGGGGCAGGGTGCAGG - Intergenic
1006338368 6:33432450-33432472 CACAGCTTGGAGAAGGTGGGAGG - Intronic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007369776 6:41418858-41418880 AAGAGATTGGATATGGGGGCTGG - Intergenic
1007589681 6:43013745-43013767 AGGAGAGGGGAGAAGGGGGCGGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1008022852 6:46600526-46600548 CAGAGGCTGGGGAATGGGGCTGG - Intronic
1011140295 6:84147320-84147342 CAGAGATGGGAGTGGGGGGTTGG + Intronic
1011325158 6:86142647-86142669 CAGAGGTTGGAGAAAGAGGGAGG + Intergenic
1011811498 6:91137306-91137328 TAGAGATTGGAGAAGTAGCCTGG + Intergenic
1012762768 6:103322784-103322806 TAAAGATTGGAGAAGGAGGAGGG - Intergenic
1012865376 6:104612219-104612241 TAGAGATTGGAGATGGTGGGAGG - Intergenic
1013307442 6:108862644-108862666 CAGAGATAGGGGAAGGGAGAGGG + Intronic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1014086022 6:117345132-117345154 CAGAGACTGGATATGCGGGCAGG - Intronic
1014952051 6:127567890-127567912 CAGAGATAAAAGAATGGGGCAGG + Intronic
1015454428 6:133409678-133409700 CAGAGATGGGAGGAGGGATCAGG + Intronic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1016289200 6:142509511-142509533 CAGAGAGTGGAGCATGGGGTTGG - Intergenic
1016381984 6:143493654-143493676 CAGAGATTGGAGAGGGAGCATGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017103491 6:150867093-150867115 CTGAGATGGGAGAAGGGGAGTGG - Intronic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018349333 6:162940406-162940428 GAGAGATAGGAGAAATGGGCAGG - Intronic
1018748220 6:166779466-166779488 GAGACATTGGAGGAGGGGCCTGG + Intronic
1018787390 6:167118889-167118911 CACAGAGTAGAGAAGGGAGCCGG - Intergenic
1019352149 7:559372-559394 AAGAGGCTGGAGCAGGGGGCAGG + Intronic
1019457306 7:1137115-1137137 CAGAGATGCGAGGAGGGGCCAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1021263934 7:18495764-18495786 CACAGATAGGAGAAGGGCACCGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1022008505 7:26289040-26289062 CAGAAATTGCGGAATGGGGCTGG + Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1023883536 7:44335090-44335112 CAGGGACTGGGAAAGGGGGCAGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1026925020 7:74185441-74185463 AAAAGATGGGAGAAGTGGGCAGG + Intronic
1027220364 7:76210155-76210177 TGGAGATTGGTGTAGGGGGCAGG - Intronic
1028631316 7:92937440-92937462 CAGAGGTGGGAGAAGGGGAAAGG - Intergenic
1029233127 7:99088431-99088453 GACAGATTGAAGAAGGGGGACGG - Intronic
1029483875 7:100827698-100827720 GAAAGTTTGGAGAAGGGGGAGGG + Intronic
1030152350 7:106420154-106420176 CAGAGAATGGAGAGGTGGGGAGG - Intergenic
1030798524 7:113819522-113819544 CAAAGAATGGAAAAAGGGGCAGG + Intergenic
1031948785 7:127869393-127869415 CAGAGTTTGGAGTAGAGGGATGG + Intronic
1032448115 7:132002082-132002104 ATGAGATTGGAGAAGTGGTCAGG + Intergenic
1033275365 7:139967582-139967604 CAAAGATTGGTTGAGGGGGCAGG - Intronic
1033332687 7:140429320-140429342 CTAAGAGTGGAGCAGGGGGCTGG - Intergenic
1033528129 7:142236813-142236835 GAGAAATTGGAGAGGGGAGCAGG + Intergenic
1033601619 7:142892820-142892842 CAGAGAATGGAAAAGGGAACAGG - Intergenic
1033731720 7:144187226-144187248 CAGAGAGTTGGGATGGGGGCAGG - Exonic
1033742570 7:144285809-144285831 CAGAGAGTTGGGATGGGGGCAGG - Intergenic
1033751333 7:144363805-144363827 CAGAGAGTTGGGATGGGGGCAGG + Exonic
1034113642 7:148562980-148563002 CAGATGTTGGAGGAGGGGCCTGG - Intergenic
1034707509 7:153158670-153158692 CAGAGATGGGGGTTGGGGGCTGG + Intergenic
1034955789 7:155333800-155333822 CAGAGATGGGAGATTGGTGCCGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035168273 7:157004096-157004118 CATCGATGGGGGAAGGGGGCCGG + Intronic
1035434602 7:158850040-158850062 CAGAGATTGGAGCAGGCGCTAGG + Intergenic
1035698091 8:1615336-1615358 CACACATTGGAGGAGGGAGCAGG + Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1036780280 8:11642216-11642238 CAGATATTTGAGGACGGGGCAGG - Intergenic
1036797896 8:11769442-11769464 CAGGGATGGAAGAAGGGTGCAGG - Intergenic
1037256305 8:16959236-16959258 AAGACATTGGAGAAGGGGTTGGG - Intergenic
1037583611 8:20261546-20261568 GGGAGAATGCAGAAGGGGGCTGG - Intronic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038296149 8:26292018-26292040 CTGGGCTTGGAGAACGGGGCTGG + Intronic
1039306042 8:36264159-36264181 CAGAAATTTGAGAAGCGGGAAGG + Intergenic
1039868468 8:41526387-41526409 GGGAGATTGGAGAAGGTGGTTGG + Intergenic
1041354495 8:56985940-56985962 AAGAGATTGGAGAATTGGGCAGG - Intronic
1043197800 8:77321278-77321300 CAGAGATTGGACGTGGGGGTAGG + Intergenic
1043925724 8:86034538-86034560 CAGAGCTTGGGGAAGGGTTCAGG - Intronic
1044161380 8:88920577-88920599 CATATGTTGGAGAAGGGGCCTGG + Intergenic
1044603284 8:94026789-94026811 CAGAGACTGGGGAAGGGGTAGGG - Intergenic
1045339231 8:101237257-101237279 CATAGACTGGAGAAGGGGTAAGG - Intergenic
1046077482 8:109330885-109330907 CAGAGAATGGGGTAGGGGGAGGG + Intronic
1047036339 8:120942851-120942873 CAAGAATTGGAGAGGGGGGCTGG - Intergenic
1047654300 8:126959903-126959925 CAAAGATTGGAGCAGAGTGCAGG - Intergenic
1047946582 8:129886880-129886902 AAGAGATTGTAGGAGGAGGCTGG - Intronic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048383119 8:133885850-133885872 GAGAGACTGGAGAAGGAGGGAGG + Intergenic
1048711357 8:137214968-137214990 GAGAGAATGGAGGTGGGGGCGGG + Intergenic
1049035454 8:140072043-140072065 AAGAGTTTGGAGTAGGGGCCAGG + Intronic
1049334198 8:142073937-142073959 CCGATGTTGGAGAAGGGGCCTGG - Intergenic
1049766287 8:144356717-144356739 CAGAGATGGGGGGAGGGGGTAGG + Intronic
1050719321 9:8567368-8567390 CTGAAATTGGAGAAGAGGTCAGG - Intronic
1050791216 9:9472497-9472519 TAAAGATTGGAGTAGGGGGCCGG - Intronic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1051594989 9:18816142-18816164 CAGAGACTGGGGAAGGGAGCGGG - Intronic
1051686467 9:19663457-19663479 GACAGATTGCGGAAGGGGGCAGG - Intronic
1051814848 9:21093164-21093186 CCAAGATTGGAGAAACGGGCAGG - Intergenic
1052282882 9:26753141-26753163 CAGAGAATGGTGAAGGGGAGTGG - Intergenic
1053122040 9:35554968-35554990 CAGAGATGGGAGAGGGGAGAGGG - Intronic
1053754652 9:41293299-41293321 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054260173 9:62857603-62857625 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054331594 9:63762402-63762424 CAGATAGTGAAGAAGGTGGCAGG + Intergenic
1055645353 9:78357357-78357379 CTGAGATTGGAGCAGGCAGCAGG - Intergenic
1055700809 9:78944022-78944044 CTGAGATTGGAGCAGGGTTCTGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056685955 9:88759494-88759516 CAGGGATTGGAGAGGGGGCTGGG + Intergenic
1057034708 9:91803389-91803411 CAGAGGCTGGAGGAGGGGACAGG + Intronic
1057314807 9:93961300-93961322 CTGGGATTGGGGAAGGGGTCTGG + Intergenic
1057862454 9:98652285-98652307 CTGAGAGTGCAGAATGGGGCTGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058575863 9:106400413-106400435 TAGAGATAGGAGAAGGTAGCAGG + Intergenic
1058725189 9:107796486-107796508 GGGAGACTGGAGAAGGGGTCAGG + Intergenic
1058766763 9:108189461-108189483 CCAAGATAGGAGAAGGGGGTAGG + Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060003032 9:119975691-119975713 GAAATATTGGAGAAGAGGGCAGG - Intergenic
1060171077 9:121461560-121461582 AAGAGAAGGGAAAAGGGGGCTGG + Intergenic
1060813088 9:126620882-126620904 CAGCCAATGGAGAAGGGGGTAGG + Intronic
1061005768 9:127927827-127927849 CACAGGTCGGGGAAGGGGGCCGG - Intronic
1061412563 9:130429440-130429462 CTGAAACTGGAGAAGGGGACAGG + Intronic
1061615946 9:131779014-131779036 CAGAGATGGAAGAAGGGGCCAGG + Intergenic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061724133 9:132572294-132572316 CTAAGATTGAAGCAGGGGGCAGG + Intronic
1062483857 9:136764626-136764648 CAAACAATGGACAAGGGGGCCGG - Intronic
1202798964 9_KI270719v1_random:155316-155338 CAGACAGTGAAGAAGGTGGCAGG + Intergenic
1186102601 X:6172996-6173018 CAGAGAGTGGAGTAGGGGTGAGG - Intronic
1186151857 X:6683137-6683159 CTAATATTGGAGAAGGGGCCAGG - Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1187180641 X:16940243-16940265 CAGAGATTGGAAAAGTGTGGAGG - Intergenic
1187249004 X:17580149-17580171 GAGAGAGTGGGGAAAGGGGCAGG - Intronic
1187275479 X:17813245-17813267 GAGAGATTGGAGGAGCTGGCGGG - Intronic
1187470715 X:19567097-19567119 CAGAGGTTAGGGAAGGGGGTGGG + Intronic
1187695244 X:21913000-21913022 AAGAAATTGGAGAAGATGGCCGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1188885974 X:35549568-35549590 CAGAGACTGGAGAAGGGATTAGG - Intergenic
1189124605 X:38433164-38433186 CAGAGACCAGAGAAGGGGTCAGG - Intronic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189203495 X:39217973-39217995 CAGAGATAGGCCAAGGGGACAGG - Intergenic
1190217976 X:48492799-48492821 CAGAGTTTGGAGCTGGGGGCGGG + Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1191586822 X:62836009-62836031 CAGAGTTTGGAGAACGGGCATGG + Intergenic
1191851234 X:65587872-65587894 TAGAGATTGGAGAAGGGGAGGGG - Intergenic
1192144151 X:68669739-68669761 CAGAGCTTGGGGGAGGGGTCTGG - Intronic
1192196062 X:69028998-69029020 CAGAGATTGGTGAGGGGTGTGGG + Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192536943 X:71936245-71936267 TAGAGATGGGAGCAGGAGGCTGG + Intergenic
1193601258 X:83510292-83510314 TAGAGATTTGGGAAGGGGGGGGG - Intergenic
1194205112 X:91002841-91002863 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1194329517 X:92563406-92563428 CATATATTGGAGATGGGGCCAGG - Intronic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1195638960 X:107153136-107153158 AAAAGATTGAAGAATGGGGCAGG - Intronic
1196881367 X:120200902-120200924 TGGAGCTTGGAGAGGGGGGCTGG - Intergenic
1197253520 X:124238868-124238890 CAGAGGTTGGGATAGGGGGCAGG + Intronic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1199188069 X:144939737-144939759 CTGAGATTGGAGCAGGAGCCGGG + Intergenic
1200102630 X:153695526-153695548 CAGAGCCTGGAGAGGTGGGCAGG - Exonic
1200550932 Y:4577962-4577984 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1200638218 Y:5682603-5682625 CATATATTGGAGATGGGGCCAGG - Intronic
1200842152 Y:7793421-7793443 CAGAGATTGGGGGAGGTGGTGGG - Intergenic
1201474048 Y:14361822-14361844 CAGACATTGGAGAAAGGGAAAGG + Intergenic