ID: 946386583

View in Genome Browser
Species Human (GRCh38)
Location 2:219387694-219387716
Sequence GCCCCGGAGGGCGCCGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946386575_946386583 3 Left 946386575 2:219387668-219387690 CCACTGCAGCACCGCGCTAAGCT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 946386583 2:219387694-219387716 GCCCCGGAGGGCGCCGGACCCGG 0: 1
1: 0
2: 1
3: 18
4: 200
946386579_946386583 -8 Left 946386579 2:219387679-219387701 CCGCGCTAAGCTTGGGCCCCGGA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 946386583 2:219387694-219387716 GCCCCGGAGGGCGCCGGACCCGG 0: 1
1: 0
2: 1
3: 18
4: 200
946386573_946386583 5 Left 946386573 2:219387666-219387688 CCCCACTGCAGCACCGCGCTAAG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 946386583 2:219387694-219387716 GCCCCGGAGGGCGCCGGACCCGG 0: 1
1: 0
2: 1
3: 18
4: 200
946386574_946386583 4 Left 946386574 2:219387667-219387689 CCCACTGCAGCACCGCGCTAAGC 0: 1
1: 0
2: 0
3: 7
4: 43
Right 946386583 2:219387694-219387716 GCCCCGGAGGGCGCCGGACCCGG 0: 1
1: 0
2: 1
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946386583 Original CRISPR GCCCCGGAGGGCGCCGGACC CGG Intronic