ID: 946387768

View in Genome Browser
Species Human (GRCh38)
Location 2:219395624-219395646
Sequence AGTTATGACCTGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946387768_946387771 -6 Left 946387768 2:219395624-219395646 CCTTCCAGTTTCAGGTCATAACT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 946387771 2:219395641-219395663 ATAACTCTTGGCGTTAGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946387768 Original CRISPR AGTTATGACCTGAAACTGGA AGG (reversed) Intronic
902463141 1:16594762-16594784 AGTGATGTCCTCAAACTGAAAGG + Intronic
902625199 1:17672344-17672366 ATTTATGACATGAAACGGGTGGG + Intronic
903203224 1:21760623-21760645 AGAAATCACTTGAAACTGGAAGG + Intronic
907011829 1:50969674-50969696 CGTTACGACCTGTAACTTGAGGG + Exonic
909840439 1:80314939-80314961 AATTATGACCTGAACAAGGATGG - Intergenic
911554414 1:99325890-99325912 ACTTATGACCTGAAATTTGTGGG + Intergenic
913543836 1:119847203-119847225 AGTGATGTCCTCAAACTGAAGGG + Intergenic
913639934 1:120802842-120802864 AGTGATGTCCTCAAACTGAAGGG - Intergenic
913991240 1:143614154-143614176 AGTGATGTCCTAAAACTGAAAGG + Intergenic
914212560 1:145593673-145593695 AGTGATGTCCTCAAACTGAAGGG + Intergenic
914241424 1:145855681-145855703 ATTTATGAACTGAAACGGTAAGG + Intronic
914278543 1:146147496-146147518 AGTGATGTCCTCAAACTGAAGGG + Intronic
914539591 1:148598444-148598466 AGTGATGTCCTCAAACTGAAGGG + Intronic
914627089 1:149473184-149473206 AGTGATGTCCTCAAACTGAAGGG - Intergenic
921405016 1:214769204-214769226 ACTGATGACCAGAAACAGGAGGG - Intergenic
921465537 1:215482736-215482758 AGTTATGATCCACAACTGGAAGG + Intergenic
923094265 1:230762221-230762243 AGCTAGACCCTGAAACTGGATGG + Intronic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
924695177 1:246391984-246392006 GGTGATAAGCTGAAACTGGAGGG - Intronic
1064992448 10:21267674-21267696 ATTTATGATCTAAAACTGCATGG + Intergenic
1065527663 10:26639131-26639153 AGTTATAACCAGAACTTGGAGGG - Intergenic
1066458082 10:35588822-35588844 AGCAATGAACTGAAACAGGATGG - Intergenic
1066802351 10:39206033-39206055 ACTTCTGACTTGTAACTGGAAGG - Intergenic
1068397040 10:56476256-56476278 AGTTTTGACCCTAAACTGGAAGG + Intergenic
1069202778 10:65643367-65643389 ATTTATGACCTGAAACTTCAAGG + Intergenic
1071851342 10:89573476-89573498 AGTTCTGACCTGGCACTGGATGG - Intergenic
1073417964 10:103400314-103400336 AGTGATGACCTGAAATAGGAGGG + Intronic
1077018801 11:408338-408360 AGAAGTGACCTGAACCTGGAGGG + Intronic
1079709821 11:23666891-23666913 AGAAATCACCTGAAAGTGGATGG - Intergenic
1079821309 11:25134034-25134056 AGTATAGACCTGTAACTGGAAGG - Intergenic
1080987503 11:37486850-37486872 AGTTGTGACCAAAAACTGCATGG - Intergenic
1080993502 11:37571315-37571337 ACTTAAGAGCTGAAACTTGATGG + Intergenic
1087131381 11:94672033-94672055 AGGGATGACCTGAAACATGAGGG + Intergenic
1088512480 11:110592380-110592402 AGTGATGTCCAAAAACTGGATGG - Intronic
1088713135 11:112526000-112526022 ACTTATGACTTGACCCTGGAGGG - Intergenic
1091821871 12:3481433-3481455 AGTTAGGGCCAGAAACTGAAAGG + Intronic
1092179618 12:6436601-6436623 AGTCTTGACCTGGAACTGAAGGG - Intergenic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1095519610 12:43047313-43047335 ACATATGAACTGAAACTGGAAGG + Intergenic
1096120883 12:49088909-49088931 AGTCATGGCCTGAAAAAGGAAGG - Intergenic
1097373442 12:58812337-58812359 AGGTTTGACCTGGAACAGGAGGG + Intronic
1097491179 12:60271828-60271850 AGTAATCACCTGAACCTGGGAGG - Intergenic
1103208558 12:119149779-119149801 AGTCAAGACCTGAGATTGGAGGG + Intronic
1103447720 12:121004994-121005016 AGTTCTCACCTGGAGCTGGAGGG + Exonic
1109792760 13:67270930-67270952 ACTTAGGACCTGCTACTGGAAGG + Intergenic
1110464428 13:75784372-75784394 ATTTATGACATAAAACTTGAGGG + Intronic
1111354448 13:87080146-87080168 AGGAATGGCCTGAACCTGGAAGG - Intergenic
1116753322 14:48914475-48914497 ATTTATGACCAGAGACTTGAAGG + Intergenic
1118868645 14:69723453-69723475 AGTTATCACTTGAACCTGGGAGG + Intergenic
1119072419 14:71600232-71600254 ACATATGACCTGAAACTATAAGG - Intronic
1119609845 14:76052446-76052468 AGTTATGACCCCCAACTGCAGGG - Intronic
1122218797 14:100222231-100222253 AGTGATGAGCGGAAGCTGGAAGG + Intergenic
1122499678 14:102188437-102188459 AGGCATGAACTGGAACTGGAGGG + Intronic
1127500634 15:59550774-59550796 AGTAATGACCTGAAAGTTCAGGG - Intergenic
1127911224 15:63417807-63417829 TGCTAAGACCTGAAACTGGCTGG - Intergenic
1128445713 15:67758190-67758212 AGTTCTGATCAGAAATTGGAGGG + Intronic
1133534368 16:6686720-6686742 AGTTATGGCCTGAAACATAATGG - Intronic
1133776121 16:8896614-8896636 AACGATGAACTGAAACTGGAAGG - Intronic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1138434652 16:56990506-56990528 AGCCAGGACCTGAAACTGGCTGG + Intronic
1141423913 16:83933468-83933490 AGCCCAGACCTGAAACTGGAAGG + Intronic
1144812916 17:18012381-18012403 ATGTAAGACCTGAAACTGGCAGG + Intronic
1144995452 17:19265039-19265061 GGTTTTGTCCTGAAACTGGAGGG + Intronic
1149336290 17:55639749-55639771 AGTTATGACCAGATGGTGGAAGG - Intergenic
1149638088 17:58186198-58186220 GGTTATGACCCAAAACAGGAAGG + Intergenic
1153929204 18:9863905-9863927 AGTTATGCCCTGAGGCTGGGAGG + Intergenic
1155051360 18:22150640-22150662 AGTTGGGTCCTGAAAATGGAAGG + Intergenic
1156973189 18:43182983-43183005 AGTTATTACCTTACAATGGAAGG + Intergenic
1157658215 18:49414145-49414167 AGAGGTGACCAGAAACTGGAGGG + Intronic
1159252767 18:65902873-65902895 ATTTATGAAATAAAACTGGAAGG + Intergenic
1159389316 18:67768269-67768291 AGTTATAAGCTAAAACTGGGAGG - Intergenic
1202678802 1_KI270711v1_random:32195-32217 AGTGATGTCCTCAAACTGAAAGG + Intergenic
927466680 2:23341916-23341938 CTTTAGGACCTGAACCTGGAGGG - Intergenic
932735292 2:74250219-74250241 AGTGATGGCCTCAACCTGGATGG + Intronic
933729527 2:85446387-85446409 AGAAATGACCTGGAAATGGAGGG - Intergenic
937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG + Intergenic
939764800 2:146233625-146233647 ATTTATGACCTAAAACTTAAAGG + Intergenic
942220738 2:173766742-173766764 AATGATGCCCTGAGACTGGAGGG + Intergenic
942590823 2:177544953-177544975 ACTGATGACCTGAAGCTTGACGG - Intergenic
942600551 2:177636653-177636675 AGTGAAGAACTGAAACTGCAGGG + Intronic
944284488 2:197932879-197932901 AGAGATCACCTGAAACTGGGAGG + Intronic
945911923 2:215659717-215659739 GGGTATGACCTGAAATCGGATGG + Intergenic
946387768 2:219395624-219395646 AGTTATGACCTGAAACTGGAAGG - Intronic
948249271 2:236512498-236512520 AGGGATGACGTGGAACTGGATGG - Intergenic
1173498950 20:43538669-43538691 ATGTCTGACCTGCAACTGGATGG + Intronic
1174749160 20:53094987-53095009 AGTTATGACCTCAAAGTGAAAGG + Intronic
1174822384 20:53737894-53737916 ACCTATGATCTGAAACTGGGGGG - Intergenic
1175550210 20:59812660-59812682 AGCTTTTACCTGAAACTGCATGG + Intronic
1176344307 21:5727934-5727956 AGTAATGACACAAAACTGGATGG - Intergenic
1176351121 21:5848518-5848540 AGTAATGACACAAAACTGGATGG - Intergenic
1176500520 21:7596522-7596544 AGTAATGACACAAAACTGGATGG + Intergenic
1176538628 21:8126003-8126025 AGTAATGACACAAAACTGGATGG - Intergenic
1177583162 21:23054114-23054136 AATTATGACATTAACCTGGAAGG + Intergenic
1177922647 21:27171735-27171757 AGTTATGATCTTAAAATGAAGGG - Intergenic
1179043345 21:37824383-37824405 AGAAATGACCAAAAACTGGATGG + Intronic
1184025668 22:41854251-41854273 AGTTATCACTTGAACCTGGGAGG - Intronic
1184702927 22:46189048-46189070 AGCTCTGACCTGATACAGGATGG - Intronic
1203243574 22_KI270733v1_random:42358-42380 AGTAATGACACAAAACTGGATGG - Intergenic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
950565118 3:13764795-13764817 GGTTATCACCTGAAACAGGCAGG - Intergenic
951149403 3:19270101-19270123 AATTATGACCTGTATCTGGCAGG + Intronic
951529347 3:23684142-23684164 GGTTCTGCCCTGAAACTGGAGGG - Intergenic
951639961 3:24826213-24826235 AGTTATGCCTTGAAAGTGGAAGG - Intergenic
952026336 3:29087377-29087399 AGTTCTTACCTGAATCAGGATGG + Intergenic
953247976 3:41213609-41213631 TGCTATGACCTGAAACTAAAAGG + Intronic
960169037 3:114437052-114437074 AGTTTTGAACTGGAGCTGGAGGG + Intronic
960632022 3:119742075-119742097 AGTCATGATCAGAAACTGAAAGG - Intronic
963883199 3:150551144-150551166 AGTTTTAACCTAAAAATGGAAGG - Intronic
964816941 3:160727731-160727753 AGAAATGACCTGAAGCAGGAGGG + Intergenic
966259531 3:177958944-177958966 AATTTTGACCTGATATTGGATGG + Intergenic
967520789 3:190429981-190430003 ATTTAGGAGCTGAAACTAGAAGG + Intronic
969229934 4:5823076-5823098 AGTTGTCACCTGCAACAGGAAGG + Intronic
972294457 4:37723240-37723262 AGGTATGACCTGAATGTGGTTGG - Intergenic
974118007 4:57604379-57604401 AGTTTAGGCCAGAAACTGGAAGG + Intergenic
986376355 5:7135977-7135999 AGTCATTACCTGAAAGTGTATGG - Intergenic
988451572 5:31349438-31349460 ATTTATGAACTGACATTGGATGG - Intergenic
989145513 5:38245708-38245730 AGTGATGTCCTGAAGCTGGAAGG - Intergenic
989273441 5:39558721-39558743 AATGATGACCGGAATCTGGAAGG + Intergenic
990949742 5:61286824-61286846 AGTGGTGAGCTGAAACTGAAGGG + Intergenic
992260730 5:74967691-74967713 AGCTTTGATATGAAACTGGATGG - Intergenic
992529680 5:77642331-77642353 AGTCTTGATCTGGAACTGGACGG - Intergenic
1006829667 6:36961295-36961317 AGTTTTGTCCTGAACCTGCATGG + Intronic
1007835317 6:44669525-44669547 AGTTTTGAGCTGAACCTTGAAGG + Intergenic
1011440888 6:87386149-87386171 AGTTTTGACCTGGGACTTGAAGG + Intronic
1011559863 6:88603320-88603342 AGTTATCTCCTGGATCTGGAAGG - Intergenic
1015579784 6:134711200-134711222 AGATGTGTCCTGAGACTGGATGG - Intergenic
1016265080 6:142223235-142223257 ATCTATGACCTGAAATTGTATGG + Exonic
1017092531 6:150773080-150773102 ATTTATGACCTGAGATTGAAAGG - Intronic
1017359897 6:153555523-153555545 AGATTTGAACTGAAACTGGAAGG - Intergenic
1021414116 7:20362171-20362193 AGTTCTGACCTGGAGGTGGAAGG - Intronic
1022462635 7:30625617-30625639 TCTTATAACCTGAAACTGAATGG + Intronic
1024020655 7:45364853-45364875 TGTTATGATTTGTAACTGGAAGG + Intergenic
1025718361 7:63984799-63984821 AGTTATGATCTTAAAGAGGAGGG + Intergenic
1026497257 7:70913960-70913982 AGACATGAGCAGAAACTGGAAGG + Intergenic
1028280536 7:88921247-88921269 AGTTAAGACAAAAAACTGGATGG + Intronic
1028706337 7:93851800-93851822 AGTGAGTACCTGAAACTGAATGG - Intronic
1029976696 7:104841706-104841728 AGCTATGATATAAAACTGGACGG + Intronic
1030861552 7:114637793-114637815 AGTAATGACCTGAAAATGAGAGG + Intronic
1032205634 7:129862694-129862716 AGTTTTTTCCTGAAACTGAAGGG + Intronic
1032370486 7:131345360-131345382 AGTTCTGACATGACACTGCAAGG - Intronic
1033685089 7:143632302-143632324 TGTGATGAAGTGAAACTGGATGG - Intronic
1033688262 7:143711521-143711543 TGTGATGAAGTGAAACTGGATGG - Intronic
1033699525 7:143825319-143825341 TGTGATGAAGTGAAACTGGATGG + Intergenic
1037248052 8:16859658-16859680 TGTCTTGAGCTGAAACTGGAAGG - Intergenic
1037250875 8:16892487-16892509 AGATATTACATGAAAGTGGAGGG - Intergenic
1038053837 8:23838981-23839003 AGTTAAGACAGGACACTGGAGGG + Intergenic
1039812949 8:41065979-41066001 GATTCTGACCTGAAACTGTATGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1042001782 8:64131397-64131419 AATTATGACCAGCAATTGGAAGG + Intergenic
1042866380 8:73359861-73359883 AGGTATGACCTGCTACTGCAGGG + Intergenic
1044617583 8:94158017-94158039 AGTTATCACCTGCCTCTGGATGG + Intronic
1045180898 8:99781117-99781139 ACTTATGACCTAAAGGTGGAAGG - Intronic
1045333889 8:101180923-101180945 AGACATGACCTTCAACTGGAAGG + Intronic
1047374395 8:124282268-124282290 AGTTCTGACCTGGAAGTTGAAGG - Intergenic
1048605520 8:135964410-135964432 TGGTAAGAACTGAAACTGGAGGG + Intergenic
1050553079 9:6764803-6764825 AATTAATACCTGGAACTGGATGG - Intronic
1052423067 9:28269075-28269097 AGTTCTGAACTGGAACTTGAAGG - Intronic
1054972296 9:71102442-71102464 AGCTAGGACCAGAAACAGGAAGG - Intronic
1055138872 9:72852399-72852421 AGTGATGACGATAAACTGGAAGG + Intergenic
1055572461 9:77631259-77631281 AGTGATGACCTGAAAAGGAAAGG - Intronic
1055697035 9:78896375-78896397 AGTCATGGCCTGAGACTGGTTGG + Intergenic
1056901917 9:90607788-90607810 AATAATGACCTGAAGCTGGGCGG + Intergenic
1203459903 Un_GL000220v1:25441-25463 AGTAATGACACAAAACTGGATGG - Intergenic
1187974493 X:24691866-24691888 AGTTTTGAACTGAAAGTGTAGGG + Intergenic
1188228724 X:27634352-27634374 ACATATGAACTGAATCTGGAAGG - Intronic
1188811090 X:34655694-34655716 AGAGAAGACATGAAACTGGAAGG + Intronic
1190755527 X:53398095-53398117 AGTTATCGCTTGAACCTGGAAGG + Intronic
1191896310 X:65997192-65997214 AGATTTGAACTGAAACTTGAAGG - Intergenic
1192201008 X:69066693-69066715 AGTTAAGACCTGCAACTAAATGG - Intergenic
1194790554 X:98143789-98143811 TGTTATGTCCTGAAACTGAAAGG - Intergenic
1195573958 X:106428999-106429021 GGTTATGACCTGAAGATGAAGGG - Intergenic
1198018986 X:132639932-132639954 AGTTAAGACCTGAAACATGCAGG - Intronic
1199239748 X:145532564-145532586 AGTTATAATGTGAAACTGAAAGG + Intergenic
1199837214 X:151603505-151603527 AGTTATGAGATGGAACTGGAAGG + Intronic
1200417274 Y:2925648-2925670 AGGTATCATCTGAACCTGGAAGG - Intronic