ID: 946391308

View in Genome Browser
Species Human (GRCh38)
Location 2:219418416-219418438
Sequence GGGCGCACGGAGGAGGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 499}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946391308_946391320 11 Left 946391308 2:219418416-219418438 CCCGCCGCCTCCTCCGTGCGCCC 0: 1
1: 1
2: 3
3: 57
4: 499
Right 946391320 2:219418450-219418472 CCGCGCCGTCACCATGAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946391308 Original CRISPR GGGCGCACGGAGGAGGCGGC GGG (reversed) Exonic
900181384 1:1312544-1312566 GGGTGCTCGGGGCAGGCGGCTGG - Intronic
900227703 1:1540650-1540672 GGGAGGAGGGAGGAGGAGGCAGG - Intergenic
900309815 1:2028325-2028347 GCGCGCGCGGAAGGGGCGGCGGG - Intronic
900355114 1:2257502-2257524 GGCAGCTGGGAGGAGGCGGCTGG - Intronic
900384047 1:2401300-2401322 GGAAGGAGGGAGGAGGCGGCAGG - Intronic
902600894 1:17539701-17539723 TCGCGCACGGCGGCGGCGGCGGG + Intergenic
902940983 1:19799972-19799994 GCGCGCTCGGGGCAGGCGGCGGG - Intergenic
903781276 1:25821398-25821420 GAGCCCACGCAGGAGGTGGCAGG + Intronic
903827157 1:26154869-26154891 AGACTCACGGAGGAGGGGGCAGG - Intergenic
904005438 1:27360940-27360962 GCGCCCGCGGAGGAGGCGGAGGG - Exonic
904083005 1:27883766-27883788 GGGAGCACAGAAGAGGAGGCAGG - Intronic
904562773 1:31409881-31409903 GGGGGCACTGAGGCGGGGGCAGG + Intronic
904615316 1:31746381-31746403 GGGACCACAGAGGAGGTGGCAGG + Intronic
904751179 1:32742087-32742109 CGGCGCAAGAAGAAGGCGGCGGG + Exonic
905399758 1:37692669-37692691 TGGCGCTCGGCGGAGGCTGCGGG - Exonic
905448928 1:38045111-38045133 GGGGGCAGAGAGCAGGCGGCGGG + Exonic
905789703 1:40783669-40783691 GAACGCGCGGAGCAGGCGGCGGG - Intergenic
906532828 1:46533232-46533254 GGGCGCTCGGCGGCCGCGGCGGG - Intergenic
906653864 1:47533687-47533709 GGGAGGAAGGAGGGGGCGGCGGG + Intergenic
907528590 1:55070178-55070200 GGGCGCAGGGAGGAGGGGCTGGG + Intronic
908128299 1:61050971-61050993 GGGGGCAGGGAGGGGGCGTCCGG + Intronic
910034731 1:82776867-82776889 GAGCCCACGGAGGTGGCGGAAGG + Intergenic
911027298 1:93448566-93448588 CGGCGCACGCAGGAGCCCGCGGG - Intronic
912625796 1:111204052-111204074 GGGGGCGAGGGGGAGGCGGCGGG - Intronic
914203397 1:145505955-145505977 GAGCCCACGGAGGGGGCGGGAGG + Intergenic
914482519 1:148079109-148079131 GAGCCCACGGAGGGGGCGGGAGG + Intergenic
914681943 1:149944686-149944708 GGTGGCAAGGAGGAGGCAGCTGG - Exonic
914847168 1:151289693-151289715 GGGCGCTTGGAGGAGACTGCTGG + Exonic
919712147 1:200739152-200739174 GGGAGCACAGAGGAGGGGACGGG + Intergenic
919748925 1:201024659-201024681 GGGGGCAGGGAAGAGGCGTCTGG - Intergenic
919991465 1:202710559-202710581 GGAGGCCCGGAGGAGGCGGAGGG + Intergenic
920102845 1:203528786-203528808 GGGCTCACGGTGGTGGCGGTGGG - Intergenic
920264576 1:204712256-204712278 GGGGGCACGGAGGAGGCAGAGGG - Intergenic
921089696 1:211830773-211830795 GGGCGGCGGGAGGAAGCGGCGGG + Intergenic
922804513 1:228378469-228378491 GGACGGAAGGAGGAGGGGGCGGG - Intronic
922958464 1:229625552-229625574 GGGCTCGGGGAGGAGGTGGCGGG - Intronic
923055881 1:230425889-230425911 GGGCGCGCGGAGGAGGGCGCCGG - Intergenic
923744346 1:236686585-236686607 GGACCCACGGAGGCGGCGGGCGG - Exonic
924198871 1:241639806-241639828 GGACGCACGGAGCGGGCAGCGGG + Intronic
924383417 1:243483194-243483216 GAGCCCGGGGAGGAGGCGGCGGG + Intronic
924436873 1:244049442-244049464 TGGCGCCCGGGGGAGGGGGCCGG + Intronic
924632549 1:245754484-245754506 GGGCACAGGGAGGAGGAAGCTGG + Intronic
924946738 1:248851562-248851584 GGGCCAAAGGAGGAGGCTGCAGG - Intronic
1063424963 10:5943672-5943694 GGGCGTGCGGAGGAGGCTGGTGG + Intronic
1063463572 10:6229392-6229414 AGCCGCAGAGAGGAGGCGGCCGG - Intronic
1063593145 10:7410972-7410994 GGGCGCGCGAGGGAGGCGGCGGG - Intronic
1065023198 10:21517329-21517351 GGGCGCGCGGCGGCGGCGCCCGG + Exonic
1065046896 10:21753395-21753417 AGGCCCACGGAGGACGTGGCGGG + Intergenic
1065342890 10:24723394-24723416 GGGCGCCCGGCGGGGGCGGAGGG - Intronic
1065596663 10:27319852-27319874 GGCCGCTCTGGGGAGGCGGCGGG + Intergenic
1067082472 10:43219367-43219389 GGTGCCACGGAGGAGGGGGCTGG + Intronic
1067749142 10:48958388-48958410 GGCAGCCAGGAGGAGGCGGCTGG + Intronic
1069384779 10:67874405-67874427 GGTGGCATGGTGGAGGCGGCTGG - Intergenic
1070305366 10:75235928-75235950 TGGCGCGGGCAGGAGGCGGCGGG + Exonic
1070752827 10:78973990-78974012 GGTCGCCGGGAGGTGGCGGCGGG - Intergenic
1072453970 10:95560734-95560756 GGGCGCAAGGACGACGCGGTTGG - Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072652975 10:97309951-97309973 GGCGGCATGGTGGAGGCGGCTGG + Intergenic
1072711554 10:97718788-97718810 GGGCACAGGGAGGAGGAGCCTGG - Intergenic
1072800363 10:98388513-98388535 GCGGGCAGGGAGGAGACGGCAGG + Intronic
1073035686 10:100562850-100562872 GGGTGGCGGGAGGAGGCGGCCGG + Intergenic
1073207230 10:101775709-101775731 GGGTGCGCGGAGGCGGGGGCCGG - Intronic
1073251027 10:102120416-102120438 GGGCGCTCGGCGACGGCGGCGGG - Exonic
1073441431 10:103555121-103555143 GGGAGCGGGGAGGCGGCGGCCGG + Intronic
1073812351 10:107164651-107164673 GGGCGGGCGGAGGCGGCGCCGGG + Intergenic
1074996306 10:118760232-118760254 GAGCCCACGGAGGCGGGGGCAGG + Intergenic
1075559858 10:123460556-123460578 GGCTGCACGGAGGAGCCTGCTGG - Intergenic
1075714244 10:124546760-124546782 GGGAGCACGGATGATGAGGCTGG - Intronic
1076116966 10:127907450-127907472 GGGCGCGCCGCGGGGGCGGCGGG - Intronic
1076371565 10:129959210-129959232 GGGCGCCCGGGGGAGGAGGCTGG - Intronic
1076547074 10:131252610-131252632 GGGCGCTCGTTGGAGACGGCTGG - Intronic
1076568473 10:131414817-131414839 GGGTCCAAGGAGGAGGCGACTGG + Intergenic
1076618455 10:131771860-131771882 GTGAGCACTGAGGAGGCAGCAGG - Intergenic
1076674327 10:132140371-132140393 GGGCAGCGGGAGGAGGCGGCGGG + Intronic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1077066056 11:641333-641355 GGGAGCAGGGAGGCGGCAGCGGG + Intergenic
1077097473 11:805142-805164 GGGCGGGCGGAGGGGGCGGCGGG - Intronic
1077250056 11:1556996-1557018 GAGCGCGCGGGGGAGCCGGCGGG + Exonic
1077376785 11:2208999-2209021 GGGCACAAGGAGGCGGCGGCAGG + Intergenic
1077602019 11:3580868-3580890 GGGCGCAGGGTAGGGGCGGCGGG - Intergenic
1078390386 11:10931451-10931473 TGACGCGGGGAGGAGGCGGCCGG + Intergenic
1081607626 11:44537205-44537227 GGGCCCACGGAGGGGGCTGCCGG - Intergenic
1082076648 11:47980572-47980594 TGACGCGCGGAGGAGGCAGCGGG + Exonic
1083428418 11:62601458-62601480 GTGCGGCCGGAGGCGGCGGCGGG - Exonic
1083477470 11:62923470-62923492 GGGGGCACTCAGGAGGAGGCAGG - Intergenic
1083546145 11:63550480-63550502 GGGCCCACGGAGGTGGGGGAAGG - Intergenic
1083572690 11:63768724-63768746 GGGCGCATGCACGGGGCGGCCGG + Exonic
1083605298 11:63975041-63975063 CGGCGCAGCGAGGAGGCGACAGG - Intronic
1084107446 11:66989069-66989091 GAGCCCACGGAGGGGGTGGCAGG - Intergenic
1086455484 11:86955550-86955572 GGGCGGCCGGAGGAGGGGGCCGG - Intergenic
1089738350 11:120564747-120564769 GAGCGCGCGGAGGTGGCTGCTGG + Intronic
1090450950 11:126805905-126805927 GGCCGCACGGAGAAGGTGGAGGG - Intronic
1090799135 11:130159882-130159904 GGGCGCGGGGCGCAGGCGGCGGG - Exonic
1090983831 11:131748550-131748572 GGGCACAGGGAGGAGGGGGCAGG - Intronic
1091173798 11:133541907-133541929 GCTCGCTCGGAGGAGGTGGCTGG + Intergenic
1091549947 12:1529982-1530004 GGGCGCCCCGAGGGGGCTGCTGG + Intronic
1091567884 12:1661849-1661871 CGGGGCAGGGAGGAGGCGGGAGG + Intergenic
1091915434 12:4269514-4269536 GGGAGAAGGGCGGAGGCGGCCGG + Intergenic
1092428162 12:8390211-8390233 GGGCGCAGGGTAGGGGCGGCGGG - Intergenic
1094605827 12:31948319-31948341 GGTGGCATGGTGGAGGCGGCTGG - Intergenic
1095819669 12:46463765-46463787 GGGGGCATGGAGGAGGCTTCTGG - Intergenic
1096460724 12:51820429-51820451 CGGCGCGCGGGGGAGGCCGCGGG - Intergenic
1096738860 12:53677178-53677200 GGGAGCCGGGAGGGGGCGGCGGG - Intronic
1096771597 12:53939146-53939168 GGGCGCCCAGGGGAGCCGGCGGG - Exonic
1097946761 12:65377419-65377441 CGGGGGACGGAGGAGGGGGCAGG - Intronic
1098963606 12:76763914-76763936 GGCTGCCCGGGGGAGGCGGCCGG - Exonic
1098973421 12:76878761-76878783 GGGCGCAGGGATGAGAAGGCTGG + Intronic
1099697990 12:86045050-86045072 GGGCCAAAGGAGGAGGAGGCTGG - Intronic
1101504177 12:105330968-105330990 GGGCGGGCGGGAGAGGCGGCGGG + Intronic
1101592646 12:106138362-106138384 GGGCGCTGGGTGGACGCGGCCGG - Intronic
1101640104 12:106581520-106581542 GGGCGGACCGAGGGGGCGGGGGG + Intronic
1102101321 12:110281127-110281149 GGGAGCCGGGAGGAGGGGGCGGG + Intronic
1102145062 12:110648912-110648934 GGGCACACAGAGGAGGGGCCTGG + Exonic
1102394259 12:112574228-112574250 GGGGGCATGGAGGAGGGGGAGGG + Intronic
1102453251 12:113056752-113056774 GGACGGACGCAGGAGCCGGCTGG - Intronic
1102471390 12:113161782-113161804 GGGGGCGGGGAGGAGGGGGCGGG - Intronic
1102713952 12:114953355-114953377 GGAGGCAGGGAGGAGGAGGCAGG + Intergenic
1102887513 12:116533332-116533354 GGGCCCACGCCGGAGGGGGCGGG - Intergenic
1103527832 12:121579487-121579509 GGGCGGGCGGCGGGGGCGGCTGG - Intronic
1103562792 12:121800859-121800881 GGGAGCCCGGAGCAGGAGGCGGG - Intronic
1103926952 12:124428522-124428544 GGCCCCAGGGAGGGGGCGGCTGG - Intronic
1103927458 12:124430835-124430857 GTGGGCAGGGGGGAGGCGGCGGG - Intronic
1104376520 12:128268347-128268369 GGCCGCGCGGATGCGGCGGCGGG + Intronic
1104568297 12:129903952-129903974 GGGCGGGCCGAGGCGGCGGCCGG - Intergenic
1104748243 12:131223127-131223149 GGGCGCAGGGAGGAGGAGCAGGG - Intergenic
1104776892 12:131394883-131394905 GGGCGCAGGGAGGCAGCGGAGGG - Intergenic
1104843161 12:131834272-131834294 GGGAGGAGGGAGGAGGCGGGAGG - Intronic
1104891796 12:132143816-132143838 GGGAGCAGCGAGGAGGCGCCGGG - Exonic
1104891807 12:132143852-132143874 GGGAGCAGCGAGGAGGCGCCAGG - Exonic
1106388514 13:29312149-29312171 GGGAGCATGGAGGAGGAGCCAGG - Intronic
1106510473 13:30408511-30408533 AGGCGCGAGGAGGAGGGGGCGGG + Intergenic
1107133447 13:36920084-36920106 CGGCGCTCGGAGCGGGCGGCCGG - Intronic
1108594261 13:51936441-51936463 GGGGGCAGGGAGCAGGGGGCGGG + Intronic
1110119372 13:71864817-71864839 GCGCGCACGGAGGAGGCGGCGGG - Intronic
1110775659 13:79405845-79405867 CGGCGCGCGGAGGAGGGGGCGGG - Exonic
1112091569 13:96089977-96089999 CGGGGCTCGGAGGAGGCAGCTGG - Intergenic
1113119036 13:106906620-106906642 GGCAGCAGGGAGCAGGCGGCGGG + Intergenic
1113541841 13:111115355-111115377 GGGCGCACGGAGAAGCGGGCCGG + Exonic
1113614182 13:111669537-111669559 GGGGGCAGGGGGCAGGCGGCCGG - Intronic
1113619650 13:111754451-111754473 GGGGGCAGGGGGCAGGCGGCCGG - Intergenic
1113887415 13:113668124-113668146 GGGTGCAGGGATGGGGCGGCAGG + Intronic
1115579109 14:34740826-34740848 GGCGGCATGGTGGAGGCGGCTGG + Intergenic
1117898387 14:60509998-60510020 GAGCGCACCGGGGAGGAGGCGGG + Intronic
1119286383 14:73458343-73458365 GGGGCCAGGGCGGAGGCGGCGGG - Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1120439076 14:84512994-84513016 GGGCCCACGGAGGGGGTGGGAGG + Intergenic
1121496431 14:94394709-94394731 GGGCAGACAGAGGAGGCGGGTGG - Intergenic
1121720579 14:96105913-96105935 TGGAGCACAGAGGAGGAGGCTGG + Intergenic
1122221237 14:100240064-100240086 GGGGGCGCGGCGGCGGCGGCGGG + Intronic
1122272154 14:100573190-100573212 GGGCTTCCGGAGGAGGGGGCTGG + Intronic
1122272170 14:100573228-100573250 GGGCTTCCGGAGGAGGGGGCTGG + Intronic
1122300123 14:100726812-100726834 GTGCGCACGGAGGCGGGGGCGGG + Exonic
1122645133 14:103189145-103189167 GGGCGCAGGGAGGGCGCGACCGG + Intergenic
1122666682 14:103334721-103334743 GCGCGCGGGGAGGGGGCGGCCGG - Intronic
1122889560 14:104726027-104726049 GGGAGCACGGAGGATGCAGCAGG + Intronic
1123165809 14:106324131-106324153 GGGCCCACAGAGCAGGAGGCCGG - Intergenic
1124439192 15:29674775-29674797 GGGGGCGCGGAGGAAGGGGCGGG + Intergenic
1124971889 15:34496300-34496322 GGGGGCTGGGAGGAGGTGGCTGG - Intergenic
1125685080 15:41559185-41559207 GAGGGCGGGGAGGAGGCGGCGGG - Exonic
1128149741 15:65355511-65355533 GCGAGCCCGGAGGACGCGGCGGG + Intronic
1128357791 15:66940635-66940657 GGGGGCACAAAGGAGGCAGCAGG - Intergenic
1128978427 15:72169464-72169486 GGCCACAGGAAGGAGGCGGCAGG - Intronic
1129844655 15:78762683-78762705 GGAGGCACTGAGGGGGCGGCTGG - Intronic
1130564301 15:84981267-84981289 CGGCGTCCGGAGGAGGTGGCGGG + Intronic
1131119787 15:89814953-89814975 GGGCGGACGGGGGAGGAGCCCGG - Intronic
1131144261 15:90001469-90001491 GGGCGGCAGGAGCAGGCGGCGGG + Exonic
1132398209 15:101489477-101489499 GGGGGCGCGGAGCAGGCGGCAGG + Exonic
1132551537 16:555749-555771 GGAGGCCTGGAGGAGGCGGCTGG + Intergenic
1132574874 16:659697-659719 GTGCTCACGGAGGAGGAGGCTGG + Intronic
1132701851 16:1225352-1225374 GGGAGGACGGAGGAGGAGGCCGG + Intergenic
1132899490 16:2245389-2245411 GTGTGCGAGGAGGAGGCGGCTGG + Intronic
1132900449 16:2251381-2251403 GGGCGGACGGAGCGGGCGGCCGG - Exonic
1132906499 16:2285268-2285290 GGGTGCAGGGAGGAGGCGAGGGG + Intronic
1133085211 16:3356834-3356856 GGGCGCACTGAGGAGGTTGCTGG + Exonic
1133327255 16:4949272-4949294 GAGAGCACGGAGGAGGAGCCAGG - Intronic
1133347616 16:5081073-5081095 AGGCTCAGGGAGGAGGCGGGGGG + Intronic
1133802253 16:9092725-9092747 GGGGGCAGGGAGGTCGCGGCGGG - Intronic
1134438901 16:14285838-14285860 GGGCGCACGGGAGCGGCGCCAGG + Intergenic
1135057327 16:19241700-19241722 GGGCGCAGGAAGGAGGTGGATGG - Intronic
1136061034 16:27726683-27726705 GGCCACAGGGAGGAGGAGGCTGG + Intronic
1136682576 16:31976674-31976696 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1136782836 16:32917842-32917864 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1136886960 16:33936008-33936030 GGGTGCAGGGAGGAGGGGGAAGG + Intergenic
1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG + Intronic
1137592529 16:49702535-49702557 GGGGGCAGGGTGGAGGCGGGGGG + Intronic
1138619014 16:58197520-58197542 GGGCCCGCGGAGGGGTCGGCGGG + Intronic
1139420124 16:66844768-66844790 GGCTTCGCGGAGGAGGCGGCAGG - Intronic
1140219958 16:73036573-73036595 AGGCGCAGGGAGGAGGAGGGAGG + Intronic
1141173216 16:81704175-81704197 GGGGGCAGGGAGGAGGCTGAGGG - Intronic
1141173234 16:81704215-81704237 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141173317 16:81704420-81704442 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141777673 16:86135028-86135050 GGGTGCAGGGAGGAGGCAGGTGG - Intergenic
1141989647 16:87602680-87602702 GGGCGCCCGAGGGCGGCGGCGGG - Intronic
1142136386 16:88453694-88453716 GGGCGCGCGGAGGGGACCGCGGG - Intronic
1142240268 16:88941595-88941617 GGGCGCGGGGAGGGGGCGACGGG + Intronic
1142252626 16:88999667-88999689 GGGCGGAGGGAGGGGGCGGGGGG + Intergenic
1142253305 16:89002506-89002528 GGGGGGACGGAGGAGCCGGGGGG + Intergenic
1142253311 16:89002523-89002545 GGGGGGACGGAGGAGCCGGGAGG + Intergenic
1142253345 16:89002625-89002647 GGGCGGACAGAGGAGCCGGGAGG + Intergenic
1203085484 16_KI270728v1_random:1181826-1181848 GGGTGCAGGGAGGAGGGGGAAGG - Intergenic
1142610979 17:1109130-1109152 GGGAGGAGGGAGGAGGCGGGCGG + Intronic
1142631528 17:1229289-1229311 GGGCGGCCGGAGAAGCCGGCGGG - Intergenic
1142697694 17:1643062-1643084 GGGCGCCGGGAGGAGGGGTCAGG - Intronic
1142762770 17:2051349-2051371 GGGGGCGCGGAAGCGGCGGCGGG + Intergenic
1142850658 17:2703261-2703283 GGGCCCACGGAGGCAGAGGCAGG - Intronic
1143562932 17:7705801-7705823 GTGGGCAGGGAGGAGGCGGGAGG + Intronic
1144621499 17:16821379-16821401 GGGAGCAGGGGGGAGGGGGCTGG + Intergenic
1144884918 17:18451334-18451356 GGGAGCAGGGAGGAGGGGGCTGG - Intergenic
1145147305 17:20493043-20493065 GGGAGCAGGGAGGAGGGGGCTGG + Intergenic
1146057813 17:29589743-29589765 GGGCGCGGGCAGGAGGGGGCGGG + Intronic
1146909782 17:36641386-36641408 AGGCGCGCTGTGGAGGCGGCGGG - Intergenic
1147143099 17:38470014-38470036 GGGTGCAGGGAGGAGGAGGAAGG - Intronic
1147971555 17:44221028-44221050 AGCCGCCCGGAGGAGGCGGAGGG - Intronic
1148021651 17:44557591-44557613 AGCCGCAGCGAGGAGGCGGCGGG + Exonic
1148048780 17:44759281-44759303 GGGGGCAGGGAGGGGGCGCCGGG - Intronic
1148105044 17:45114516-45114538 GAGCTCACTGAGGAGGCTGCAGG + Intronic
1148139138 17:45316414-45316436 GGGCGGAGGGAGGATGCTGCGGG + Intronic
1148462683 17:47847396-47847418 GGCGCCAAGGAGGAGGCGGCTGG - Exonic
1148555795 17:48577950-48577972 GGGCGCAGGGAGGCGGCGGGGGG + Exonic
1148605829 17:48928221-48928243 GGGGGCACGGGGGAGGCGGAAGG - Exonic
1148646844 17:49224197-49224219 GGGCCAACGGCGGAGGGGGCGGG - Exonic
1148743715 17:49907216-49907238 GGGTGCAGGGAGGAGGCGGGTGG - Intergenic
1148782597 17:50130087-50130109 GGCGGCGGGGAGGAGGCGGCTGG + Intergenic
1148786837 17:50149733-50149755 GGGCGGGCGGCGGCGGCGGCGGG + Exonic
1148844199 17:50519125-50519147 GGGTCCATGGAGGAGGGGGCGGG + Intronic
1149512832 17:57256899-57256921 GGGCGCGCGGGAGAGGCGGGGGG - Intronic
1149896761 17:60434205-60434227 GGCGGCATGGTGGAGGCGGCTGG + Intergenic
1149995813 17:61405453-61405475 GGGCGCAAGGAGGCGGCCGAGGG + Exonic
1150128254 17:62652695-62652717 GGGCGCACGGCGGTGGAGGGAGG + Intronic
1150128321 17:62652894-62652916 GGGCGCACGATGGCGGGGGCAGG + Intronic
1151440635 17:74126695-74126717 GGGGGCGAGGAGGAGGAGGCAGG - Intergenic
1151559079 17:74861273-74861295 GGGCTCAAGGAGGGGGCGGCTGG - Intronic
1151699882 17:75737461-75737483 GGGCGCAGGGAGGGGGCGTGTGG + Intronic
1152069809 17:78128853-78128875 GGGCGCCCGGAGGAGGGCGGGGG - Intronic
1152245467 17:79182824-79182846 GGGCGCGCAGAGGTGGCGGCGGG - Intronic
1152362539 17:79839348-79839370 GGGCGAGCGGCGGCGGCGGCGGG - Exonic
1152447675 17:80355407-80355429 GGGCTCACGGAGGAAGAAGCGGG + Intronic
1152447784 17:80355739-80355761 GGGCTCACGGAGGAAGAAGCGGG + Intronic
1152500719 17:80707087-80707109 GGGCCCAGGCAGGAGGCGGAGGG + Intronic
1152627729 17:81396036-81396058 GGGCGCACGCTGGCGGCGCCCGG - Intronic
1152714337 17:81891347-81891369 GCGCGGCCGGCGGAGGCGGCAGG - Exonic
1152771778 17:82174216-82174238 GGGAGCACGGAGGAGCCAGCGGG - Intronic
1152824810 17:82458312-82458334 GGGCCCGCGGAGGCCGCGGCCGG - Intronic
1152918418 17:83053130-83053152 GGGAACCCGGAGAAGGCGGCCGG + Intergenic
1152924086 17:83079676-83079698 GGCCGCGCGGAGGACGCGGGGGG + Exonic
1153911332 18:9708567-9708589 GGGCGCGCGGACGAGGGGGACGG - Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155928932 18:31685559-31685581 GGGCGCGGGGAGGGGGCTGCTGG - Intronic
1156448482 18:37253690-37253712 CGGAGGCCGGAGGAGGCGGCGGG + Intronic
1156501996 18:37566082-37566104 GCGCGCGCGGAGGAGGGCGCGGG + Intergenic
1158954697 18:62526613-62526635 GGGTGCGCGGCGGCGGCGGCGGG - Intronic
1160319256 18:77875089-77875111 GGGCAGACGGAGGAGGAGGGTGG - Intergenic
1160447191 18:78936847-78936869 GGCCGCACGGAAGAGGAGACAGG + Intergenic
1160453335 18:78979739-78979761 GGCCGCCCGGCGGCGGCGGCGGG + Intergenic
1160730339 19:639170-639192 CGGGGCACGTCGGAGGCGGCAGG - Intergenic
1160738810 19:676605-676627 GGGGGCGCGGCGGCGGCGGCGGG + Intronic
1160750826 19:733617-733639 GGGGGCACGGAGGAGCCGGCTGG + Intronic
1160902961 19:1438334-1438356 GCGCGCACGGCCGAGGGGGCGGG + Intergenic
1160948169 19:1652808-1652830 GGACGCGCAGAGGAGGCGGTCGG + Intergenic
1161014942 19:1978830-1978852 GGGGGCACGGCGGTGTCGGCCGG - Intronic
1161022103 19:2015459-2015481 GAGCGGGCGGAGGAGGCGGCGGG - Exonic
1161042045 19:2115461-2115483 GGGCTCACGGGGAGGGCGGCGGG + Intronic
1161415806 19:4145686-4145708 GGGAGCAGGGAGGAGGAGGAAGG + Intergenic
1161570075 19:5025643-5025665 GGGAGCGCAGAGGAGGCGGCAGG - Intronic
1161591641 19:5131643-5131665 GGGGGCAGGGAGGAGGGGACAGG + Intronic
1161714665 19:5868416-5868438 GGGCGACCGGAGGAGGAGGAGGG + Intronic
1162237784 19:9321872-9321894 GAGCCCACGGAGGAGGAGGCGGG - Intergenic
1162778728 19:12995868-12995890 GGTCGCGCGGGGGCGGCGGCCGG - Intronic
1165305507 19:35000518-35000540 GGGCGCGCGGGGGAGGCCACCGG + Intronic
1165349981 19:35269956-35269978 GGGGGCACAGAGGCAGCGGCGGG - Exonic
1165421099 19:35722371-35722393 GGGCAGATGGAGGAGGTGGCCGG + Exonic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1166092580 19:40519810-40519832 GTGCGCGCCCAGGAGGCGGCGGG + Exonic
1166100388 19:40568106-40568128 GGCTGCGCGGAGGCGGCGGCCGG + Exonic
1166310395 19:41959162-41959184 GGGAGGAGGGAGGAGGGGGCCGG + Intronic
1166354769 19:42220428-42220450 GGGCGGACGGAGGGGGCGGAAGG + Intronic
1166375130 19:42323775-42323797 GGGCTTACGGAGGTGGCGGGCGG - Exonic
1166546167 19:43635895-43635917 GGGTCCAGGGAGGAGGGGGCTGG - Intronic
1167041060 19:47022596-47022618 CGGGGCATGGAGGAGGGGGCGGG + Intronic
1167269319 19:48498782-48498804 GGGCCCGAGGAGGTGGCGGCGGG + Exonic
1167269513 19:48499293-48499315 GGGCGCAGGGAAGAGGGGGGAGG + Exonic
1167272522 19:48513872-48513894 GGGCGCACGGCCTAGGCTGCAGG + Intergenic
1167368192 19:49065428-49065450 GGGCTAATGGAGGAGGAGGCTGG - Intergenic
1167426586 19:49432764-49432786 GGGGGCGCGGAGGGGTCGGCGGG - Intronic
1167463972 19:49640566-49640588 GGGCGCTCCGAGGAAGCAGCAGG + Intergenic
1167470569 19:49673517-49673539 GGGCACAGGGATGAGGGGGCAGG - Intronic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1168152588 19:54456892-54456914 GGGCGCACGGTGGACGGGTCGGG - Exonic
1168315343 19:55482510-55482532 GGGCGGACGGGGGTGGCGGCGGG - Exonic
1168670621 19:58238518-58238540 GAGAGCACGCAGGAGGCGTCAGG + Intronic
926146328 2:10399035-10399057 GGGTGCACAGGGGAGGCGCCTGG + Intronic
926270994 2:11365785-11365807 GGGCTGAGGGAGGAGGGGGCAGG - Intergenic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
926581169 2:14633792-14633814 GGAGGCACGGAGGACTCGGCTGG + Intronic
926980192 2:18560319-18560341 GCGCGCGCCGAGGAGGCGGCGGG - Exonic
927111654 2:19868349-19868371 GGGACCACTGAGGAGGAGGCAGG + Intergenic
927146250 2:20168401-20168423 GGGGGCACGGAAGAGACGTCTGG + Intergenic
927809307 2:26172971-26172993 GGGCGGACAGAGCAGGGGGCGGG + Intergenic
927904593 2:26847877-26847899 GAGCGGACGGAGGGCGCGGCCGG - Intronic
927979660 2:27366763-27366785 GGGAGCACATAGGAGGCTGCAGG + Exonic
929711395 2:44270606-44270628 GGCGGCATGGTGGAGGCGGCTGG - Intergenic
929778521 2:44943053-44943075 GGACGCGCGGAAGAGGGGGCCGG + Intronic
930872829 2:56184944-56184966 GGGTGCCCCGAGGAGGAGGCGGG + Intronic
931021295 2:58047219-58047241 GGGCGGACGGACCAGGCGGCTGG + Intronic
931253489 2:60552385-60552407 GGGCCGGGGGAGGAGGCGGCCGG - Intronic
932307713 2:70715755-70715777 GGGGGCAGAGAGGAGGGGGCTGG - Intronic
932763744 2:74457558-74457580 GGGCGCACGGGGCGAGCGGCGGG + Exonic
934780388 2:96966148-96966170 GGGAGCCTGGAGGAGGGGGCTGG - Intronic
935449133 2:103189556-103189578 GGGCTGATGGAGGAGGCAGCTGG + Intergenic
936555917 2:113498910-113498932 GGGTGCGAGGAGGAGGGGGCTGG + Exonic
937061358 2:118982488-118982510 AGGCCCACGGAGGAGGCAGAGGG + Intronic
937208609 2:120252947-120252969 GTGCGGACGGCGGAGGCGGCGGG + Exonic
937284493 2:120741606-120741628 GGGGGCGGGGAGGAGGCGGAGGG - Intronic
937409290 2:121658965-121658987 GGCAGCATGGTGGAGGCGGCTGG + Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
938391769 2:130912270-130912292 GGCCCCACGGAGGCAGCGGCCGG + Intronic
938406312 2:131035064-131035086 GGCCGCACGGAGCGGGAGGCCGG + Intronic
939629393 2:144515895-144515917 CGGCGCGGGGAGGGGGCGGCTGG - Intronic
940775220 2:157876764-157876786 GGGCGCGCGGGGCAGGCGGGCGG + Intronic
944796442 2:203190765-203190787 GGCGGCATGGTGGAGGCGGCTGG - Intronic
944843114 2:203642953-203642975 GAGCCCACGGAGGGGGCGGGGGG + Intergenic
946391308 2:219418416-219418438 GGGCGCACGGAGGAGGCGGCGGG - Exonic
946737898 2:222772960-222772982 GGACGCAGGGAGAAGGCGGCCGG + Intergenic
946843201 2:223837646-223837668 GGGCGCGGGGAGGAGGCAGCGGG - Intronic
946865691 2:224039385-224039407 GGCCACACAAAGGAGGCGGCGGG - Intergenic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948630727 2:239301005-239301027 TGGAGCCCGGAGGAGGGGGCAGG - Intronic
948809339 2:240466838-240466860 GGGCGCAGGGAGGTGGGGCCGGG - Exonic
1170885735 20:20338493-20338515 GGTGGCAAGGAGGAGGCGGGTGG - Intronic
1172118638 20:32585221-32585243 GGGCGGCCGGGGGAGGCGGGAGG + Intronic
1172408147 20:34704396-34704418 GGACTCGCGGGGGAGGCGGCGGG - Exonic
1172690122 20:36784308-36784330 TGGGGCATGGAGGAGGCGGCTGG + Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174494656 20:50931070-50931092 GGGCGGAGGGAGGAGACGGAGGG + Exonic
1174953883 20:55074629-55074651 GGCGGCATGGTGGAGGCGGCTGG - Intergenic
1175215999 20:57391954-57391976 GCGCGCCCGGGAGAGGCGGCAGG - Intronic
1175529729 20:59666241-59666263 TGGCGCAGGGAGGAGATGGCAGG - Intronic
1175723877 20:61303703-61303725 GGGAGCAGGGAGGAGGAGGTAGG + Intronic
1175831096 20:61965873-61965895 GGGGGCAGGGCCGAGGCGGCAGG - Intronic
1175859876 20:62144165-62144187 GGGCGGACGCTGGAGGCTGCCGG + Intronic
1175887989 20:62303081-62303103 GGGCGACCGGAGGCGGGGGCAGG + Intronic
1175923186 20:62459391-62459413 GGGCCCTCCGAGGAGGAGGCTGG + Intergenic
1175944127 20:62550916-62550938 TGGCTCCCGGAGGAGGTGGCTGG + Exonic
1176029993 20:63007190-63007212 GGGCGGCCGGAGGCGGCGGCCGG - Intergenic
1176061602 20:63175140-63175162 GTGCGCACCGAGGCGGCCGCCGG + Intergenic
1176081780 20:63277076-63277098 GGGGGCCGGGAGGAGGCTGCGGG + Intronic
1176156904 20:63626673-63626695 GGGTCCACCGAGGAGGCCGCTGG + Intronic
1176197962 20:63846337-63846359 GGGAACGCAGAGGAGGCGGCAGG + Intergenic
1176515457 21:7780471-7780493 GGGAGCAGGGAGGAGGGGCCAGG - Intergenic
1176550165 21:8217358-8217380 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1176577007 21:8444628-8444650 CGGCGCGCGGCGGCGGCGGCGGG + Intergenic
1178649485 21:34410483-34410505 GGGAGCAGGGAGGAGGGGCCAGG - Intergenic
1179297331 21:40075061-40075083 GGTTGTGCGGAGGAGGCGGCGGG - Exonic
1179489800 21:41734006-41734028 GGGTGCATGGAGGAGGAGGAAGG - Intergenic
1179501306 21:41810701-41810723 GGGCGCACGCGGCAGGCTGCCGG - Intronic
1179965312 21:44801581-44801603 GGGCTCACGGTGGAGGCCCCGGG + Intronic
1180042784 21:45288479-45288501 GGGGGCACCCAGGAGGCCGCAGG - Intergenic
1180177798 21:46098631-46098653 GGCCGGACGGAAGGGGCGGCGGG + Intronic
1180951883 22:19724157-19724179 GGGCGCACGCTCGGGGCGGCCGG - Exonic
1181902672 22:26169291-26169313 CGGCGGCCAGAGGAGGCGGCTGG + Intergenic
1182037973 22:27214247-27214269 GAGGGGACGGAGGAGGCAGCCGG - Intergenic
1182271187 22:29154553-29154575 GGGCGGCAGGAGGCGGCGGCTGG - Intronic
1182355260 22:29719941-29719963 GGGAGCGCGGAGGGGGCGGGCGG + Intergenic
1182767271 22:32766632-32766654 GGGCTCACGGAGGTGGGGACAGG - Intronic
1182804391 22:33058132-33058154 GGGCGCACGGAGGGGCAGGGAGG - Intronic
1183264624 22:36817588-36817610 CGACGCAGGGAGGAGGTGGCAGG + Intronic
1183359278 22:37375083-37375105 GGGCACTCGGAGAAGGCGGTGGG + Exonic
1183588990 22:38769184-38769206 GGGCCCAGGGAGGGGGCGGCTGG + Intronic
1184039158 22:41933191-41933213 GGGCTGAGGGAGGAGACGGCCGG - Intergenic
1184228291 22:43143252-43143274 GGGCGCCCGGCGGAGGCACCGGG + Exonic
1184238523 22:43199569-43199591 GGGCCCACGGTGGAGGCCTCAGG - Exonic
1184406351 22:44302917-44302939 GGGTGCAGTGAGGAGGCAGCAGG + Intronic
1184677974 22:46053848-46053870 CGGAGCACGGAGGACGGGGCCGG + Exonic
1184698003 22:46150495-46150517 GGACGCGCGGAGGCGGCGCCGGG + Intergenic
1184707600 22:46225054-46225076 GGGTGCACGGAGGAGGCTGTGGG + Intronic
1185281752 22:49972641-49972663 GGGACCAGGGAGGAGGAGGCGGG - Intergenic
1185375632 22:50481618-50481640 GGGCGCAAGGCGGAGCGGGCTGG - Exonic
950153904 3:10708228-10708250 GTGCGCGCGGAGGAGGACGCGGG - Intergenic
950198442 3:11026138-11026160 GGTGGCCCGGAGGAGGGGGCTGG - Intronic
950417424 3:12876371-12876393 GGGCGCACGGAGCAGGCCCCAGG - Intergenic
950442204 3:13016576-13016598 AGGAGCACAGAGGAGGAGGCTGG - Intronic
950584008 3:13880156-13880178 GGGCGCTCCGGGGAGGCGGGCGG - Intergenic
950902999 3:16513711-16513733 GGACGCGCGGCGGCGGCGGCGGG - Intronic
951543523 3:23805730-23805752 GGGCGTCCGGAGGAGGCGCTGGG + Intergenic
951881402 3:27484197-27484219 GGGGGCTCGGCGGCGGCGGCAGG - Intronic
951881489 3:27484540-27484562 GGGCGCGCTGAGGAGGCTGGCGG - Intergenic
953030642 3:39177720-39177742 GGGCGGAGGGGGGAGGGGGCGGG + Intergenic
953326120 3:42013738-42013760 GGGCGCGCGGGGGCGGCGGCCGG - Intergenic
953386601 3:42509848-42509870 GGGCACAGAGAGGAGGGGGCAGG - Intronic
953447369 3:42979605-42979627 GAGCGCGCCGAGGAGCCGGCCGG + Exonic
954025627 3:47781441-47781463 GGGCGCCCAGAGCGGGCGGCGGG + Intronic
955106115 3:55900168-55900190 TGGGGCAGGGTGGAGGCGGCAGG - Intronic
961053361 3:123766421-123766443 GGGAGCACGGAGGAGGGTGAGGG + Intronic
961365177 3:126395026-126395048 GGGCGCGTGGGGGCGGCGGCAGG + Intronic
961372619 3:126440780-126440802 GGGGGCAGGGAAGAGGCTGCGGG - Intronic
961467370 3:127089996-127090018 GGGGGCAGGGAGGAAGGGGCCGG + Intergenic
961827510 3:129606700-129606722 GGGAGCCCGGAGGCGGCGGGAGG + Exonic
963061826 3:141232151-141232173 GGGCGCACGGGGGGAGTGGCAGG - Intronic
964474829 3:157089034-157089056 GGGCCCACGGGGGAGCCGCCTGG - Intergenic
966182156 3:177197369-177197391 GGGCGCACGCGGCCGGCGGCGGG + Intronic
966915766 3:184583485-184583507 GGCCGCGCGGAGGAGGCCGCGGG + Intronic
967972868 3:195012214-195012236 GGGGGCAGGGAGCAGGCAGCTGG - Intergenic
968046160 3:195624841-195624863 GGGCGCGGGGCGGAGGCTGCGGG + Intergenic
968137068 3:196227351-196227373 GGGAGCAAGGATGAGGCGGCTGG - Intronic
968308494 3:197665246-197665268 GGGCGCGGGGCGGAGGCTGCGGG - Intergenic
968606045 4:1536243-1536265 GGGCGCGGGGTGGAGGCTGCCGG - Intergenic
968649579 4:1755178-1755200 GGTGGCACAGAGGAGGCGGTGGG - Intergenic
968652889 4:1767124-1767146 GGGCGGGCGGAGGGGGCGGTGGG - Intergenic
968701281 4:2059347-2059369 GGGCGCGGGGCGGAGGCGGCGGG - Intergenic
968736131 4:2297417-2297439 GGCCACACGGAGGAGTCGCCAGG + Intronic
969596005 4:8149608-8149630 GGGGGCAGGCAGAAGGCGGCAGG + Intronic
969715829 4:8867724-8867746 AAGGGCACGGAGGCGGCGGCCGG + Exonic
969718922 4:8882383-8882405 GGGGGTAGGGAGGAGGGGGCGGG - Intergenic
970967848 4:21948778-21948800 GGGCGCGCGGAGCGGGCTGCAGG + Exonic
971244334 4:24914559-24914581 GGGGGCGTGGAGGGGGCGGCAGG - Intronic
977937860 4:102827186-102827208 GGGCGCGTGGTGGAGGTGGCTGG - Intronic
978361078 4:107931693-107931715 AGGCGCACGCAGGAGGCGCGCGG - Exonic
979318939 4:119300627-119300649 CGGCGCACTGCGCAGGCGGCCGG - Exonic
979688627 4:123538193-123538215 GAGCCCACGGAGGAGGTGGGAGG - Intergenic
983229205 4:165112722-165112744 GAGTGCACGGAGGCGGCGGGCGG - Intronic
983904199 4:173168308-173168330 GGTCCAACGGAGGGGGCGGCGGG + Intergenic
985279028 4:188269032-188269054 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279044 4:188269082-188269104 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279060 4:188269132-188269154 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279076 4:188269182-188269204 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279092 4:188269232-188269254 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279108 4:188269282-188269304 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279124 4:188269332-188269354 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279140 4:188269382-188269404 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279156 4:188269432-188269454 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279172 4:188269482-188269504 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279188 4:188269532-188269554 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279204 4:188269582-188269604 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279220 4:188269632-188269654 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279236 4:188269682-188269704 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279252 4:188269732-188269754 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279268 4:188269782-188269804 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985688570 5:1294772-1294794 TGGCGGAAGGAGGGGGCGGCGGG + Exonic
985747151 5:1654034-1654056 GGGCGCGGGGCGGAGGCTGCGGG - Intergenic
985878425 5:2618886-2618908 GAGGCCACGGAGGAGGCGCCAGG - Intergenic
986402884 5:7396336-7396358 GACCGCTCCGAGGAGGCGGCGGG + Exonic
990557619 5:56951821-56951843 AGCCGGACGGAGGTGGCGGCCGG - Intronic
991584189 5:68186121-68186143 GAGCGCACGGCGGTGGGGGCGGG - Intergenic
993457265 5:88141315-88141337 GGGAAAAGGGAGGAGGCGGCAGG + Intergenic
997292360 5:132747271-132747293 GCGCGCACCCAGGATGCGGCAGG - Intergenic
1001314703 5:170633726-170633748 GGGGGGACGGAGGGGGGGGCGGG + Intronic
1001688744 5:173616413-173616435 TGGCGGACGGCGGCGGCGGCGGG - Exonic
1002067326 5:176658400-176658422 GAGCCCAGGGAGGGGGCGGCAGG - Exonic
1002078830 5:176725925-176725947 GGGCACCAGGAGCAGGCGGCTGG + Intergenic
1002190131 5:177473566-177473588 GGGCGGACGGAGGAGGAGGGAGG + Intronic
1002648476 5:180674048-180674070 GGGCGCGGGGAGAAGGCGGCGGG + Intergenic
1002691371 5:181053004-181053026 GCGCGCGCGGCGGAGGGGGCGGG - Intronic
1002691381 5:181053028-181053050 GCGCGCGCGGCGGAGGGGGCGGG - Intronic
1002700919 5:181124386-181124408 GGGGGCACTGAGGAAGGGGCTGG - Exonic
1002705175 5:181155839-181155861 GGGGGCACTGAGGAAGGGGCTGG + Exonic
1002714707 5:181219715-181219737 GGGCGCTCGGAGGCGGAGACGGG - Intergenic
1003074410 6:2971155-2971177 GCGCCCACGGAAGAGGCGGCCGG - Intronic
1004310525 6:14540995-14541017 GGGTGCATAGAGGAGGGGGCGGG + Intergenic
1006105774 6:31715451-31715473 GGGCCCTCGGTGGAGCCGGCTGG - Intronic
1006505602 6:34486699-34486721 GGGCCCACGGAGGAGGGCCCCGG - Intronic
1006682198 6:35805326-35805348 CCGCGGACGGAGGAGGGGGCGGG + Exonic
1006849958 6:37091297-37091319 GGCCACATGGTGGAGGCGGCTGG - Intergenic
1007238781 6:40410330-40410352 GGGAGCACGGGGGAGGCAGGAGG + Intronic
1009407073 6:63326534-63326556 GAGCCCACGGAGGAGGTGGGAGG + Intergenic
1011470376 6:87701990-87702012 GAGCGGACGGCGGGGGCGGCCGG - Exonic
1011765036 6:90611122-90611144 GCGCGCGCGGAGGAGGCGGCCGG + Intergenic
1012939679 6:105403235-105403257 GGGCGCACGGAGGAGCACGCCGG + Intergenic
1013225734 6:108118478-108118500 GGGCGCACGGCCTCGGCGGCTGG - Intronic
1013491056 6:110646585-110646607 GGGCCAACGGCGGAGGGGGCGGG + Intronic
1013507463 6:110814827-110814849 GGCCGCGCGGGGGAGGCGGGCGG + Intronic
1015181564 6:130366406-130366428 AGGCGGACGAAGAAGGCGGCAGG - Intronic
1016329849 6:142945057-142945079 CGGCGCGCGGCGCAGGCGGCCGG - Intronic
1016618355 6:146079056-146079078 GGGAGCAGGGAGGAGGAGCCTGG - Intronic
1018188291 6:161286924-161286946 GGGAGCACCCAGGAGGCTGCGGG + Intergenic
1018400586 6:163415469-163415491 GGGCGCACAAAGGAGGTGCCGGG + Intronic
1019013335 6:168860897-168860919 GGGGGCAGAGAGGAGGAGGCAGG + Intergenic
1019270999 7:149205-149227 CGGCGCAATGAGGAGGCGGCCGG - Intergenic
1019291776 7:254064-254086 GGGCGCGGGAAGGAGGGGGCAGG + Intronic
1019465426 7:1185587-1185609 GGGTGGACGGAAAAGGCGGCAGG - Intergenic
1019475580 7:1242636-1242658 GGGAGCGGGGAGGAGGAGGCGGG - Intergenic
1019603345 7:1896126-1896148 GGGCCCCAGGAGGAGGAGGCAGG - Intronic
1020013040 7:4816730-4816752 AGGCGCACAGAGGTGGCGCCTGG + Intronic
1020139745 7:5605872-5605894 GGGGGCTGGGAGGAGGTGGCTGG - Exonic
1021827940 7:24573354-24573376 GCGCGCGCGGAGGCAGCGGCGGG + Exonic
1022012796 7:26323540-26323562 GGAGGCACCCAGGAGGCGGCAGG + Intronic
1022119813 7:27297379-27297401 GGGCGATGGGAGGAGACGGCTGG - Intergenic
1023914932 7:44581875-44581897 GGCCGCACGTCGGAGGGGGCCGG - Intronic
1024226525 7:47329877-47329899 GGCAGCAGGGAGGAGGAGGCAGG + Intronic
1025174007 7:56787666-56787688 GGTCGCGGGGAGGAGGTGGCGGG - Intergenic
1025698094 7:63790289-63790311 GGTCGCGGGGAGGAGGTGGCGGG + Intergenic
1027233981 7:76287094-76287116 GGGCCCCAGGAGGAGGGGGCTGG - Exonic
1027244657 7:76358934-76358956 GGCTGCGCGGAGGAGGCGGCTGG + Exonic
1028303269 7:89228851-89228873 GGGCGCACGGAGCAGGTAGGGGG + Intronic
1028792186 7:94865537-94865559 GGGAGCAAGGAGGGGGAGGCGGG - Intergenic
1029114955 7:98232030-98232052 GGGTGCCCAGAGGAGGAGGCAGG + Intronic
1029449646 7:100633585-100633607 GGGCGCCCGGAGGAGAGGGAGGG + Intronic
1029709499 7:102291919-102291941 GGGTGCAGAGAGGAGGCTGCAGG + Intronic
1029724910 7:102396421-102396443 GGTCGCACCGAGGAGGCGGCTGG - Exonic
1030820163 7:114084930-114084952 CGGCGCGCGGAAAAGGCGGCCGG + Intergenic
1033339230 7:140479112-140479134 GGGCGCGGGGAGGGGGCCGCGGG - Intronic
1033732892 7:144195827-144195849 GGGCGCACGGGCCAGGCCGCGGG + Intergenic
1033743744 7:144294407-144294429 GGGCGCACGGGCCAGGCCGCGGG + Intergenic
1033750157 7:144355190-144355212 GGGCGCACGGGCCAGGCCGCGGG - Intergenic
1034306447 7:150048342-150048364 GGGCGCGGGGAGGAGGCCGGTGG - Intergenic
1034418000 7:150975209-150975231 TCGGGCATGGAGGAGGCGGCGGG - Intronic
1034426920 7:151018791-151018813 GTGCGCAGGAAGGCGGCGGCGGG + Exonic
1034800399 7:154052300-154052322 GGGCGCGGGGAGGAGGCCGGTGG + Intronic
1034928778 7:155144046-155144068 GAGCCCACAGAGGAGGTGGCAGG + Intergenic
1035169679 7:157010519-157010541 GCCCGCACGGAGGAGGCGCCGGG - Exonic
1035185474 7:157122906-157122928 GAGCCCACAGAGGAGGTGGCAGG - Intergenic
1035185565 7:157123296-157123318 GGCAGCAGGGAGGGGGCGGCGGG - Intergenic
1035186147 7:157127192-157127214 GGGCGCACGGAGGATTCTCCAGG - Intergenic
1035220160 7:157401824-157401846 GGGCGCGTGGAGACGGCGGCAGG - Intronic
1035253664 7:157613040-157613062 GGGTGGCCGGAGGAGGAGGCAGG + Intronic
1036915008 8:12796540-12796562 GAGCCCACGGAGGAGGTGGGAGG - Intergenic
1037807376 8:22066331-22066353 GAGCGCGGGGAGGTGGCGGCGGG + Intronic
1038205309 8:25459212-25459234 CGGCGGGCGGAGGAGGCGGGTGG + Exonic
1040900634 8:52414069-52414091 GGGGGCGCGGCGGAGGCAGCAGG - Intronic
1042750655 8:72154265-72154287 GGGGCCAGGGAGGAGGAGGCAGG - Intergenic
1044988574 8:97775879-97775901 GGGCGCACGGGCGAGCGGGCCGG + Exonic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049164362 8:141117210-141117232 GGGCAGAGGGAGGAGGCAGCAGG - Intergenic
1049322280 8:142002945-142002967 GGGCCAGAGGAGGAGGCGGCTGG - Intergenic
1049409250 8:142465072-142465094 GGGCGGACAGAGGAGGTGGGCGG + Intronic
1049789207 8:144465427-144465449 GGGGGCACGGCAGAGGAGGCAGG - Intronic
1051170569 9:14315376-14315398 GGGCGCGGGGAGGAGGTGGAGGG - Intronic
1053011829 9:34637887-34637909 GGGAGCACGGAGGAGTGGGGCGG + Intergenic
1053269407 9:36739925-36739947 GGGGGCCAGGAGGAGGCAGCCGG - Intergenic
1053740208 9:41128709-41128731 GGGTGCGAGGAGGAGGGGGCTGG - Intergenic
1054688140 9:68302604-68302626 GGGTGCGAGGAGGAGGGGGCTGG + Intergenic
1054731425 9:68705605-68705627 GGGAGGGCGGAGGGGGCGGCGGG - Intronic
1055030792 9:71769636-71769658 GGGGGCAGGGTGGCGGCGGCAGG - Intronic
1056369751 9:85941648-85941670 GGGAGCAATGAGGAGCCGGCAGG - Intronic
1057023045 9:91715368-91715390 GTGCCCACGATGGAGGCGGCAGG + Intronic
1058413859 9:104764452-104764474 GCGCGCAAGGAGGAGGCTACAGG + Intronic
1060106484 9:120876456-120876478 GGGAGGACGGAGGCGGGGGCTGG - Intronic
1060192055 9:121599593-121599615 GGGCGGGCGGAGTAGGCGGCTGG - Intronic
1060407195 9:123378633-123378655 GAGCGTGGGGAGGAGGCGGCTGG + Exonic
1060700793 9:125747531-125747553 GGCCGTGCGGGGGAGGCGGCAGG - Exonic
1060813831 9:126624604-126624626 GGGCGCAGGAGGGAGGGGGCTGG - Intronic
1060925235 9:127451310-127451332 GGCGGCATGGTGGAGGCGGCTGG + Exonic
1060936832 9:127520976-127520998 GGACTCAGGGAGAAGGCGGCCGG + Intronic
1061128116 9:128689452-128689474 GAGCGCCGGGAGGAGGCGGCCGG + Intronic
1061208455 9:129177418-129177440 GGGGGCGCGGAGCAGGCGGCCGG + Exonic
1061348226 9:130043299-130043321 GGGAGCCCGGGGGAGGGGGCCGG - Intergenic
1061808572 9:133149533-133149555 GGGAGTACTGAGCAGGCGGCTGG - Intergenic
1062149611 9:135010935-135010957 AGGAGCATGGAGGAGGTGGCTGG - Intergenic
1062397441 9:136358152-136358174 GGGGGCCCGGAGCAGGGGGCAGG + Exonic
1062433521 9:136536041-136536063 GGGCGCACTGAGGACACTGCTGG + Intronic
1062555790 9:137112912-137112934 GGGCGCAGGGAGAGGCCGGCTGG - Intronic
1203772411 EBV:56286-56308 GGGGGCACTGAGGCGGCGGGAGG + Intergenic
1185463044 X:341084-341106 GCGCGCCCGGTGGGGGCGGCAGG - Intronic
1185623200 X:1465876-1465898 TTGCGCACGGAGGAGGCGCACGG - Exonic
1189398841 X:40646967-40646989 GGACGGAAGGAGGAAGCGGCGGG - Intronic
1189491379 X:41473884-41473906 GGGCACGCTGAAGAGGCGGCAGG - Exonic
1190708267 X:53048475-53048497 GGGCGGGCGGAGGAGGAGGGAGG - Intergenic
1195899459 X:109782214-109782236 GGGGGCAGGGTGGGGGCGGCGGG + Intergenic
1196124347 X:112082980-112083002 GGGAGGACGGGGCAGGCGGCAGG + Intergenic
1199724554 X:150568285-150568307 GGGCGCCGGGCGGAGGCGGCTGG - Intergenic